ID: 993881801

View in Genome Browser
Species Human (GRCh38)
Location 5:93371633-93371655
Sequence TTATTTTACCATTTCATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993881801_993881802 3 Left 993881801 5:93371633-93371655 CCTTTCATGAAATGGTAAAATAA No data
Right 993881802 5:93371659-93371681 TACCAGTCTTGCAAAAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993881801 Original CRISPR TTATTTTACCATTTCATGAA AGG (reversed) Intergenic
No off target data available for this crispr