ID: 993889903

View in Genome Browser
Species Human (GRCh38)
Location 5:93461172-93461194
Sequence TGTCCTTTGCAAGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993889899_993889903 16 Left 993889899 5:93461133-93461155 CCATGGAATACTATGCAGCCATA 0: 24516
1: 14054
2: 8260
3: 5392
4: 3574
Right 993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG No data
993889901_993889903 -2 Left 993889901 5:93461151-93461173 CCATAAAAAGGAACGAGATCATG 0: 121
1: 1644
2: 3424
3: 7013
4: 15665
Right 993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993889903 Original CRISPR TGTCCTTTGCAAGACATGGA TGG Intergenic
No off target data available for this crispr