ID: 993891292

View in Genome Browser
Species Human (GRCh38)
Location 5:93477608-93477630
Sequence AGTGAATAAAAGTGGCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993891292_993891294 24 Left 993891292 5:93477608-93477630 CCACTTTGCCACTTTTATTCACT No data
Right 993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993891292 Original CRISPR AGTGAATAAAAGTGGCAAAG TGG (reversed) Intergenic
No off target data available for this crispr