ID: 993891293

View in Genome Browser
Species Human (GRCh38)
Location 5:93477616-93477638
Sequence AAGATGTGAGTGAATAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993891293_993891294 16 Left 993891293 5:93477616-93477638 CCACTTTTATTCACTCACATCTT No data
Right 993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993891293 Original CRISPR AAGATGTGAGTGAATAAAAG TGG (reversed) Intergenic
No off target data available for this crispr