ID: 993891294

View in Genome Browser
Species Human (GRCh38)
Location 5:93477655-93477677
Sequence CTATCACCTGTAGCATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993891292_993891294 24 Left 993891292 5:93477608-93477630 CCACTTTGCCACTTTTATTCACT No data
Right 993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG No data
993891293_993891294 16 Left 993891293 5:93477616-93477638 CCACTTTTATTCACTCACATCTT No data
Right 993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993891294 Original CRISPR CTATCACCTGTAGCATTCTG AGG Intergenic
No off target data available for this crispr