ID: 993898975

View in Genome Browser
Species Human (GRCh38)
Location 5:93571620-93571642
Sequence TTATGTGAGCTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993898970_993898975 -2 Left 993898970 5:93571599-93571621 CCTTAGACTCTTTCATCCTTGTT No data
Right 993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG No data
993898969_993898975 29 Left 993898969 5:93571568-93571590 CCTATGCAAGAGCGTTTGGGGAA No data
Right 993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993898975 Original CRISPR TTATGTGAGCTCAGGGAGGA AGG Intergenic
No off target data available for this crispr