ID: 993899742

View in Genome Browser
Species Human (GRCh38)
Location 5:93577146-93577168
Sequence CAGGAGAAGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993899742_993899748 -8 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899748 5:93577161-93577183 TTCTCCTGGGCCCTCTAACTGGG No data
993899742_993899747 -9 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899747 5:93577160-93577182 CTTCTCCTGGGCCCTCTAACTGG No data
993899742_993899752 0 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899752 5:93577169-93577191 GGCCCTCTAACTGGGGGCCTAGG No data
993899742_993899749 -7 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899749 5:93577162-93577184 TCTCCTGGGCCCTCTAACTGGGG No data
993899742_993899755 8 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899755 5:93577177-93577199 AACTGGGGGCCTAGGCCAAAAGG No data
993899742_993899750 -6 Left 993899742 5:93577146-93577168 CCTTCCTCCTGCTGCTTCTCCTG No data
Right 993899750 5:93577163-93577185 CTCCTGGGCCCTCTAACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993899742 Original CRISPR CAGGAGAAGCAGCAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr