ID: 993900588

View in Genome Browser
Species Human (GRCh38)
Location 5:93581646-93581668
Sequence GGATTCAGGAATCGGGGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993900570_993900588 21 Left 993900570 5:93581602-93581624 CCGCTCCTCCCGCCTGCCCCTCC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900581_993900588 -4 Left 993900581 5:93581627-93581649 CCGCGACCAATCACCTTCAGGAT No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900573_993900588 12 Left 993900573 5:93581611-93581633 CCGCCTGCCCCTCCTCCCGCGAC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900572_993900588 13 Left 993900572 5:93581610-93581632 CCCGCCTGCCCCTCCTCCCGCGA No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900578_993900588 0 Left 993900578 5:93581623-93581645 CCTCCCGCGACCAATCACCTTCA No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900576_993900588 4 Left 993900576 5:93581619-93581641 CCCTCCTCCCGCGACCAATCACC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900575_993900588 5 Left 993900575 5:93581618-93581640 CCCCTCCTCCCGCGACCAATCAC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900568_993900588 30 Left 993900568 5:93581593-93581615 CCGCGGGACCCGCTCCTCCCGCC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900574_993900588 9 Left 993900574 5:93581614-93581636 CCTGCCCCTCCTCCCGCGACCAA No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900569_993900588 22 Left 993900569 5:93581601-93581623 CCCGCTCCTCCCGCCTGCCCCTC No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900571_993900588 16 Left 993900571 5:93581607-93581629 CCTCCCGCCTGCCCCTCCTCCCG No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900577_993900588 3 Left 993900577 5:93581620-93581642 CCTCCTCCCGCGACCAATCACCT No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900580_993900588 -3 Left 993900580 5:93581626-93581648 CCCGCGACCAATCACCTTCAGGA No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data
993900583_993900588 -10 Left 993900583 5:93581633-93581655 CCAATCACCTTCAGGATTCAGGA No data
Right 993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993900588 Original CRISPR GGATTCAGGAATCGGGGTCT CGG Intergenic
No off target data available for this crispr