ID: 993901162

View in Genome Browser
Species Human (GRCh38)
Location 5:93584945-93584967
Sequence GCGCGCGGGCGCGCTGGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 396}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993901162_993901174 3 Left 993901162 5:93584945-93584967 CCCCTCCCAGCGCGCCCGCGCGC 0: 1
1: 0
2: 7
3: 40
4: 396
Right 993901174 5:93584971-93584993 GCGGCCCTCGGCGAGCAGCTCGG 0: 1
1: 0
2: 0
3: 9
4: 104
993901162_993901177 23 Left 993901162 5:93584945-93584967 CCCCTCCCAGCGCGCCCGCGCGC 0: 1
1: 0
2: 7
3: 40
4: 396
Right 993901177 5:93584991-93585013 CGGCTCCCCCCAGCGCTCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 316
993901162_993901178 24 Left 993901162 5:93584945-93584967 CCCCTCCCAGCGCGCCCGCGCGC 0: 1
1: 0
2: 7
3: 40
4: 396
Right 993901178 5:93584992-93585014 GGCTCCCCCCAGCGCTCCCCGGG 0: 1
1: 0
2: 0
3: 38
4: 349
993901162_993901169 -9 Left 993901162 5:93584945-93584967 CCCCTCCCAGCGCGCCCGCGCGC 0: 1
1: 0
2: 7
3: 40
4: 396
Right 993901169 5:93584959-93584981 CCCGCGCGCCCCGCGGCCCTCGG 0: 1
1: 1
2: 7
3: 40
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993901162 Original CRISPR GCGCGCGGGCGCGCTGGGAG GGG (reversed) Exonic
900113729 1:1020061-1020083 GCGGGCGGGCGGGCGGGGGGGGG - Intergenic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900237491 1:1599766-1599788 GGACGCTGGCGCGCAGGGAGCGG + Exonic
900322280 1:2090701-2090723 TGGCGTGGGCGCCCTGGGAGCGG + Intronic
900534445 1:3170117-3170139 GAGCGCGGACGGGCTGGGAAGGG + Intronic
901011796 1:6206449-6206471 GGGCGCGGGCGCCCGGGCAGAGG + Intronic
901324490 1:8358614-8358636 GCGAGCGGGAGCTCCGGGAGCGG - Exonic
901762659 1:11480658-11480680 GTGCACGCGCGCGCTGGGGGTGG - Intronic
901797990 1:11691654-11691676 GGGGGCGGGAGCGCGGGGAGGGG - Intergenic
901875904 1:12167046-12167068 GCGCGAGGGCGCGAGGGCAGGGG + Exonic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903034534 1:20485659-20485681 GCGCGCTGGGGCTCTGGGCGGGG + Exonic
903078099 1:20787319-20787341 GCGCGCGGGGCCGCGGGTAGGGG - Intronic
903078130 1:20787375-20787397 GCGAGGGGGCGCGCGGGGACGGG + Intergenic
903206019 1:21783104-21783126 GCGGGCGGGCGCGGCGGCAGTGG - Exonic
903349921 1:22711209-22711231 CCCCGCGGGCGCCCGGGGAGCGG + Intronic
903887390 1:26548320-26548342 ACGCGCTGGGGAGCTGGGAGTGG + Intronic
904181381 1:28668927-28668949 GCGGGCGGGCGCGCAGGGGGCGG + Intronic
904652086 1:32013544-32013566 GCGCGCGGGCCCGCGGAGTGTGG - Intergenic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
906027141 1:42682957-42682979 GCGCGCGGCCGCAGGGGGAGGGG - Intronic
906320597 1:44813255-44813277 GCGCGCGTGGGCGCGGTGAGTGG + Exonic
906320599 1:44813257-44813279 GCGCGTGGGCGCGGTGAGTGGGG + Exonic
906640456 1:47438023-47438045 GCGCGCGGGCGGGGAGGGGGCGG - Exonic
906680927 1:47725114-47725136 GCGCGCGGGCTGGCTGGGCCGGG + Intergenic
907351797 1:53838121-53838143 TCGCGCGTGCGCGCTGGGCGGGG - Intronic
907429835 1:54405659-54405681 GCGCGGGGGCCCGCGGTGAGTGG - Intronic
907430036 1:54406295-54406317 GCGCGCGAGCGAGCGGAGAGCGG - Exonic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908544081 1:65147769-65147791 CCGCCCGCGCGCGCTCGGAGGGG - Intronic
912270125 1:108200212-108200234 GCGCGAGGCCGGGCTGGGCGGGG + Exonic
915722168 1:157993553-157993575 GGGCGCGGGCGGGCGGGGGGCGG + Intronic
916660786 1:166920977-166920999 GCGCGCGGGAGCGCCAGGCGCGG - Exonic
920120239 1:203650644-203650666 GGGCGAGGGCGGGCGGGGAGCGG + Intronic
920666191 1:207964251-207964273 GCGTGCGGGGGCGGTGAGAGTGG + Intergenic
920924489 1:210328896-210328918 GCGCGCGGGCACGGCGGCAGGGG + Exonic
921185466 1:212665958-212665980 CCGCGCGCGCGCACTTGGAGAGG + Intergenic
921944905 1:220879790-220879812 GTGGGTGGGCGCGCGGGGAGGGG - Exonic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
923612035 1:235504349-235504371 GAGGGCGGGCGTGCTCGGAGTGG - Exonic
923684164 1:236142450-236142472 GCGCGCGGGGGCGGCGGGCGCGG + Intergenic
923783158 1:237042964-237042986 GCCCGTGGGGGCGCGGGGAGCGG + Intronic
924042454 1:239997614-239997636 TCCCGCGGGCGCGCAGGGACTGG + Intergenic
924953553 1:248906753-248906775 GTGCCGGGGCGCGCTGGGGGCGG + Intronic
1063393687 10:5666604-5666626 CCGCGCGGGGCCGCTGGGCGGGG + Intergenic
1065020131 10:21496292-21496314 GCGCGTGGACGCGATGGAAGGGG - Intronic
1065100366 10:22325572-22325594 GCGCGGGGGCGGGGTGGGTGCGG - Intronic
1065712828 10:28533504-28533526 GCGGGCGGGCGCGCAGGCGGCGG - Exonic
1066464401 10:35640334-35640356 GGGCGCGGGCGCGGCGGGCGCGG - Exonic
1066963638 10:42242458-42242480 GAGGGGGGGCGCGCGGGGAGCGG - Intergenic
1067015209 10:42753248-42753270 TGGCGTGGCCGCGCTGGGAGCGG - Intergenic
1067091347 10:43267088-43267110 GGGCGCGAGAGCGCGGGGAGCGG + Intergenic
1068953865 10:62804841-62804863 GTGCGCGTGCGCGCTCAGAGGGG + Exonic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1070835624 10:79445460-79445482 GCGAGCGGGCGGCCGGGGAGGGG - Exonic
1070963680 10:80516548-80516570 GGGCGGGGGCAGGCTGGGAGGGG + Intronic
1072003562 10:91220795-91220817 GCGCGCTGGCGGGCGAGGAGCGG + Intronic
1073049664 10:100659419-100659441 ACGCGCAGGCCCGCGGGGAGCGG - Intergenic
1073446613 10:103584774-103584796 GCGCGCCGGCGCGCAGGGCGTGG - Exonic
1074088638 10:110226967-110226989 GCGCGCGGGTGTGAGGGGAGGGG + Intronic
1074586023 10:114768290-114768312 ACCCGCGGCCGCGCTGGGCGGGG + Intergenic
1076014276 10:127015332-127015354 GGGCGGGGGCGCTCAGGGAGAGG - Intronic
1076394154 10:130126422-130126444 GCTCTCGGGCACGCTGGCAGGGG + Intergenic
1076402004 10:130190701-130190723 GGGGGCGGCCGTGCTGGGAGTGG + Intergenic
1076554295 10:131311824-131311846 GGGCGCGGGCGGGCGGGGACCGG - Intergenic
1076909203 10:133379064-133379086 GCGCGGGGAGGCGCGGGGAGGGG - Intergenic
1076909257 10:133379174-133379196 GCGCGGGGAGGCGCGGGGAGGGG - Intergenic
1076909277 10:133379214-133379236 GGGCGGGGAGGCGCTGGGAGGGG - Exonic
1080034908 11:27700546-27700568 TAGCGCGGGCGAGCGGGGAGCGG - Intronic
1080551394 11:33376369-33376391 GCGCGCCGGCGCGATTGGGGCGG - Intergenic
1081870659 11:46381360-46381382 GCGGGCGGCGGCGCAGGGAGTGG + Intronic
1082810471 11:57476451-57476473 GCGCGCGGCCGCTCTGGGCCTGG + Exonic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083289230 11:61680539-61680561 GGGCGCGGGCGCGGTGCGAGCGG + Intronic
1083303737 11:61752505-61752527 GCCCGCGGCCGGGCTGGGCGCGG + Intergenic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1084010931 11:66347844-66347866 GCGCGCCGGCGGGGAGGGAGAGG - Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084544487 11:69807874-69807896 GAGCGTGGGCTCCCTGGGAGGGG - Intergenic
1085266797 11:75242143-75242165 GCCCGCGGGCGCGGCGGGCGCGG - Exonic
1087014631 11:93543261-93543283 GCGGGCAGGTGGGCTGGGAGCGG - Exonic
1090056857 11:123431079-123431101 GCGCGGGGACGCGCTGGGTGTGG - Exonic
1090385538 11:126355862-126355884 GCGCGGGGGCCCGCGGGGCGGGG + Intronic
1091023856 11:132124623-132124645 GCGCGCGCACGCGCAGGGCGGGG + Intronic
1091550234 12:1530826-1530848 GCCCGCGGGGGCGCAGGGGGCGG - Intronic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092377933 12:7970903-7970925 GCTCTCCGGCGGGCTGGGAGTGG - Intergenic
1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG + Intergenic
1094218509 12:27970347-27970369 GCGGGCGGGCGCGCGGGGGGCGG + Intronic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1097872006 12:64610091-64610113 GTGCGGGGGCGAGCAGGGAGTGG + Intergenic
1098897810 12:76083965-76083987 GGGGGCGGCCGCGCGGGGAGGGG - Intronic
1100679895 12:96907446-96907468 GCGCGGCGGCGCGCTGGGCTGGG + Exonic
1101254711 12:102965744-102965766 GCCCGCGGGGGAGCAGGGAGCGG - Intergenic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101494003 12:105236300-105236322 GCTCGCCGGCTCGCGGGGAGCGG + Intronic
1101750844 12:107581309-107581331 GCGCGGGGGCGGGCGGGGGGCGG + Intronic
1101772059 12:107760927-107760949 GCGCGCGGGCCCGGCCGGAGCGG - Intronic
1103563586 12:121804608-121804630 GCGCGCTGGCAAGGTGGGAGGGG + Intronic
1103764368 12:123270814-123270836 GCGCGCGGGCGTGGGGGCAGTGG - Intronic
1104841650 12:131828658-131828680 GCGCGCGGGCGGGACGGGCGCGG + Intronic
1104929376 12:132329787-132329809 GGGCGCGCGGGCGCGGGGAGCGG + Intergenic
1104929378 12:132329789-132329811 GCGCGCGGGCGCGGGGAGCGGGG + Intergenic
1105472504 13:20705304-20705326 GCGAGCGGGGGCGGTGGGGGTGG + Intronic
1105890644 13:24680445-24680467 GCCGGCGCGCGCGCAGGGAGGGG - Exonic
1112498302 13:99922898-99922920 GAGCGTGGGCGTGCTGGGAGAGG + Intergenic
1112505471 13:99972067-99972089 GCGCGCCGGCACGCGGGCAGAGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655612 13:112066672-112066694 GCGCGCGCGCGCTCAGGAAGCGG + Intergenic
1114494988 14:23126303-23126325 GTGTGCGGGTGTGCTGGGAGTGG + Exonic
1114523405 14:23352591-23352613 GGGGGCGGGGGTGCTGGGAGAGG + Intronic
1114614279 14:24060020-24060042 GCGCTCAGGCGCGCTGCGATAGG - Exonic
1118019357 14:61695448-61695470 GCGCTCGGGCGCGCGGGGAGGGG - Intergenic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118925547 14:70187869-70187891 GCACGCGGGCGCGCGCCGAGTGG + Intronic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1121711010 14:96039306-96039328 GCGCGGGGGCGGGCGGGGCGGGG - Exonic
1122300159 14:100726953-100726975 GGGCGCGGGCGCGCAGCGAGGGG - Exonic
1122315820 14:100825595-100825617 ACGCACGGGTGGGCTGGGAGGGG + Intergenic
1122542731 14:102507110-102507132 GCGACCGGCCGCGCTGGCAGCGG - Exonic
1122857984 14:104569053-104569075 GGGCTCAGGGGCGCTGGGAGGGG - Intronic
1122910720 14:104826575-104826597 GCCAGGGGGCGCGCGGGGAGCGG - Intergenic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1123024044 14:105415234-105415256 GCGGGCGGGGGCGCGGGGCGCGG + Intronic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1124118183 15:26867099-26867121 GCGCTCGGGCGAGGTGAGAGCGG + Exonic
1124251040 15:28106723-28106745 GCGCGCGGGGGCCCTGGTGGCGG + Intergenic
1124612088 15:31215816-31215838 GGGCTCGGGCGTGCGGGGAGAGG - Intergenic
1124712963 15:32030447-32030469 GCGCGGGGGCGGGCGGGGCGGGG + Intergenic
1124789859 15:32717779-32717801 CCGCCCGGGCCGGCTGGGAGAGG - Intergenic
1124848217 15:33311510-33311532 GCGTGGGGGCGCCCTGGAAGAGG - Intronic
1125677655 15:41511433-41511455 GCGCCCGGGAGCGGCGGGAGAGG - Exonic
1126766926 15:52019126-52019148 GCGTGCGGGTGCGCTGGGCAGGG + Intronic
1127488018 15:59437464-59437486 GAGCCAGGACGCGCTGGGAGGGG + Intronic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129410568 15:75348283-75348305 GCGCGGGGGAGCGGCGGGAGCGG - Intronic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1129983550 15:79896714-79896736 GGGCGTGCGCGCGCCGGGAGGGG + Intronic
1130023698 15:80252106-80252128 GGGCGCGGGCTCGCGGGGCGCGG + Intergenic
1132641657 16:981004-981026 GGGGGCGGGAGCGCTGGGCGGGG - Intronic
1132665481 16:1079578-1079600 GCGTGCGGCGGCGCTCGGAGCGG + Exonic
1132778864 16:1612309-1612331 GTGCGCGGGCGCGCGGGGCGGGG - Exonic
1132915212 16:2340398-2340420 GGGCGCGGGCGCGGCCGGAGGGG + Intronic
1133156424 16:3880034-3880056 GCGGGCGGGCGCCGAGGGAGAGG + Exonic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1135040525 16:19114167-19114189 GCGCGCGGGGGCGCCGGGCGGGG + Intronic
1136141601 16:28292410-28292432 GCGCGAGGGCGCGCGCCGAGCGG + Intergenic
1136622148 16:31436351-31436373 GCGGAAGGACGCGCTGGGAGAGG + Exonic
1136636855 16:31529593-31529615 GGGCGGGGGCGCGCGGGGGGAGG + Intergenic
1136712688 16:32253233-32253255 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136755228 16:32676196-32676218 GGGCGCGGCCGTGCAGGGAGGGG + Exonic
1136812885 16:33194173-33194195 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136819361 16:33304253-33304275 GGGCGCGGCCGTGCAGGGAGGGG - Intronic
1136825924 16:33360788-33360810 GGGCGCGGCCGTGCAGGGAGGGG - Exonic
1136830990 16:33459559-33459581 GGGCGCGGCCGTGCAGGGAGGGG - Intergenic
1137029335 16:35507085-35507107 GAGCGCGGCCGTGCAGGGAGGGG + Intergenic
1137787757 16:51151892-51151914 GCGCGCCGGCCCGCGGGGGGAGG + Intergenic
1137855751 16:51792927-51792949 GCGCGCGCGCGCCCTAGGAAGGG - Intergenic
1138142761 16:54582909-54582931 GCGGGAGGGCGAGCCGGGAGGGG - Intergenic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1139473740 16:67192215-67192237 GCGGGCGGGCGCGATGGCGGAGG + Exonic
1139637144 16:68264592-68264614 ATGGGCGGGCGCGCCGGGAGCGG + Intronic
1140664077 16:77212700-77212722 GCGGGCGGGGGTCCTGGGAGCGG + Intronic
1140926573 16:79589821-79589843 GCCCTGGGGCGCGCTGGGTGTGG + Intronic
1141989588 16:87602467-87602489 GCGCGCGGGCGGGCGGGGTGCGG + Intronic
1142156290 16:88534153-88534175 GCGCACAGGCGCGGCGGGAGAGG - Exonic
1142263320 16:89052433-89052455 GCGTGCGGGCTCGCGGGGTGTGG - Intergenic
1202991462 16_KI270728v1_random:17143-17165 GGGCGCGGCCGTGCAGGGAGGGG - Intergenic
1203057370 16_KI270728v1_random:936535-936557 GGGCGCGGCCGTGCAGGGAGGGG + Intergenic
1143026613 17:3945014-3945036 GCGGGCGGGCGGCCTGGGGGCGG - Intronic
1143183490 17:4997904-4997926 ACGCGCGAGCGCGCGCGGAGGGG - Intergenic
1144756076 17:17681516-17681538 GCGCCCGGGGACGCGGGGAGCGG - Exonic
1144840483 17:18183030-18183052 GCGTGGGGGCGCGCTGGGGTTGG - Intergenic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1145126711 17:20306648-20306670 GCGCACGTGCGCGCAGAGAGAGG + Intronic
1146398573 17:32487060-32487082 GCGCTCGGGGGCGCTCGGCGGGG - Exonic
1146403713 17:32519652-32519674 GCGGGCAGGCGGGCTGGGAGGGG - Intronic
1147200607 17:38799225-38799247 GCGCGGGGCCGCGCTCAGAGGGG + Intronic
1147636314 17:41966724-41966746 GCACCCGGGCGGGCTGGGGGCGG - Exonic
1148443720 17:47725482-47725504 GTGGGCGGGTGAGCTGGGAGTGG - Intergenic
1148733573 17:49851970-49851992 CCACGCCGGCGCTCTGGGAGGGG - Intergenic
1150137663 17:62704359-62704381 GCGCGAGGGGGCGCTGGGATCGG + Intronic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1151210462 17:72540469-72540491 GGGCGCGGGCGCGGGCGGAGCGG - Intergenic
1152174873 17:78781428-78781450 ACGCGCGGGAGCGAAGGGAGCGG + Intronic
1152450062 17:80373105-80373127 GCGGGCGGCCGGGCTTGGAGAGG - Exonic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152654994 17:81515123-81515145 GCGGGCGGGCGGGCAGGGCGAGG + Intronic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1156275875 18:35581989-35582011 GGGCGCGGGCACGCTCGGCGCGG + Intronic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160726789 19:620967-620989 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160726800 19:620988-621010 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160776808 19:860435-860457 GCGCGGGGGCGGGGGGGGAGGGG - Intronic
1160788704 19:913062-913084 GAGCGCGGGCGGGCGGGGCGCGG - Intronic
1160864289 19:1250267-1250289 GCGCGCTGGGGGGCTGGGGGCGG - Exonic
1160930748 19:1568423-1568445 GGGCGCAGGCGCGCGGGGCGGGG + Intergenic
1161210330 19:3062356-3062378 GGGGCCGGGCGCGCGGGGAGGGG - Intronic
1161219204 19:3110338-3110360 GCCCGCGGGCGCCTGGGGAGGGG + Intronic
1161401049 19:4066380-4066402 GCTCCCAGGCGCGCGGGGAGCGG - Intronic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161664641 19:5568003-5568025 GAGCGCGGGCGCGGCGGGGGCGG - Intergenic
1161779122 19:6279663-6279685 GCGGGCGGGCGGGCGCGGAGCGG + Intronic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162571964 19:11479500-11479522 ACGCGCGGCGGCGCGGGGAGCGG + Intronic
1162580749 19:11528908-11528930 GGGCGGGGACGCGCTGGGAAAGG - Intronic
1162778924 19:12996532-12996554 GGGGGCGGGCGCGCTGCCAGCGG + Intronic
1162951313 19:14073451-14073473 GCGCGCGGGAGCGCGGGGCCAGG - Exonic
1163012244 19:14433445-14433467 GCGCGCGTGCGCCCCGGGCGTGG - Intronic
1163320552 19:16572271-16572293 GCGCGAGGGCGCGCGGGTGGCGG - Exonic
1163725154 19:18919186-18919208 GGGCGCGGGGACGCTGGGGGCGG - Intronic
1163807225 19:19406376-19406398 GCACGTGGGCGCGCGGGGCGGGG + Intronic
1164648133 19:29873738-29873760 GGGCGCGGGGGCGCTGGGTGGGG - Intergenic
1164835148 19:31350974-31350996 GCGCCCGGGCGCGCCGGCTGGGG + Intergenic
1165089196 19:33373839-33373861 CCGCGCGGGGCCGCTCGGAGTGG + Exonic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165157701 19:33797958-33797980 GCGCGGGGCTGGGCTGGGAGGGG - Intronic
1165355252 19:35300067-35300089 GGGCGGGGCCGGGCTGGGAGAGG + Intronic
1166347768 19:42177014-42177036 GCGGGCGGGCGGGCGGGCAGGGG + Intronic
1166361305 19:42253996-42254018 GCGCCCGAGCGCGCAGGGGGAGG - Intronic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167072778 19:47230543-47230565 GCGGGCGCGCGCCCTGGGTGTGG + Intronic
1167643784 19:50695253-50695275 GGGCGCGGGGGCGCGGGGCGCGG + Intronic
1168081189 19:54011860-54011882 GTGGGCGGGAGGGCTGGGAGCGG + Intronic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
926095637 2:10079679-10079701 GGGGGCGATCGCGCTGGGAGCGG - Intronic
926238690 2:11068881-11068903 GGGAGCGGGCGTGCTGGGATGGG + Intergenic
927794275 2:26034371-26034393 CCGGGCGGACGGGCTGGGAGAGG + Exonic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
932042874 2:68319095-68319117 ACCCCCGGGCCCGCTGGGAGCGG + Intronic
934078985 2:88452044-88452066 GCGCTCGGGCGCGCTCTGAATGG + Exonic
935301665 2:101698150-101698172 GCGAGCGGGCGCGCGGGGAGCGG + Intronic
935590842 2:104844571-104844593 GCGCGGGGGCTCACCGGGAGGGG + Intergenic
940883491 2:158969131-158969153 GCGAGCGGGCGCGCCGGGCGGGG - Intronic
941463242 2:165794780-165794802 GTACGCGGGCGCTCTGGTAGGGG + Intergenic
942083937 2:172427493-172427515 GGCCGCGGGCGCGCAAGGAGGGG + Intronic
942150942 2:173075756-173075778 ACGCGCGGGCGAGCGGGGCGTGG - Intronic
942578567 2:177392611-177392633 GAGCGCCGGCGCGGTGGGTGGGG + Intronic
942681395 2:178480769-178480791 GGGCCCGGGCGGGCCGGGAGGGG + Exonic
943589911 2:189784479-189784501 GCGCGCGTGCGTGCTGGGTGCGG + Exonic
944632582 2:201642680-201642702 GCGCGCGACCGAGCCGGGAGGGG - Intronic
946235742 2:218323465-218323487 GGAGGCGGGCGCGCTGGGAGAGG + Intronic
946692433 2:222319548-222319570 GCGGGCAGGCGCGCGGGCAGCGG + Intergenic
947119236 2:226799129-226799151 GCGCGCGCGCGCTCCTGGAGGGG - Exonic
947846924 2:233251950-233251972 GCGCCGGTGCGGGCTGGGAGTGG + Intronic
948115820 2:235493972-235493994 GCGCGCGGGCAGGCGGGGCGCGG + Intergenic
948140652 2:235670054-235670076 GCCCGCGGGCTCGCTGGATGCGG + Intronic
948487328 2:238289110-238289132 GCGGGCGGGGGAGCTGGGCGCGG + Intronic
948910302 2:240999232-240999254 GCGCGCGGGCGGGGCGGGGGCGG + Intronic
1168795944 20:610286-610308 GCGCGCGGGAGCGCACGGCGGGG - Exonic
1168965091 20:1894254-1894276 GCGCGGGGGCGCGGGGGGCGGGG - Exonic
1168965093 20:1894256-1894278 GGGCGCGGGGGCGCGGGGGGCGG - Exonic
1169093231 20:2873810-2873832 GCTCCCGGGGGCGGTGGGAGGGG + Intronic
1169142437 20:3234041-3234063 CCGGGCGGGGGCGTTGGGAGGGG - Intronic
1169164114 20:3407683-3407705 GCGCGCGGGCCCGGCGGGGGCGG + Intergenic
1169164194 20:3407963-3407985 GGGCGGGGCCGGGCTGGGAGAGG - Intergenic
1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG + Intergenic
1170558022 20:17531149-17531171 GGGCGCGGGCCCGCTGGACGTGG + Exonic
1170574647 20:17653177-17653199 GCCCGAGGGCGCGCTGGGCACGG - Intronic
1170889631 20:20367228-20367250 GAGCGCGGGCGGGCTGGGCTGGG - Intergenic
1173516171 20:43667026-43667048 GCGCGCGGGCGCCGGGGGAGGGG - Intronic
1173548126 20:43914736-43914758 GCGCGCGGGCGGGGCGGGGGCGG + Intergenic
1175358548 20:58389304-58389326 CCGGGTGGGCGCGCTGGGGGGGG - Exonic
1175429473 20:58891538-58891560 GCGCGCGGACGGGCGGGAAGGGG - Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1175926978 20:62475860-62475882 GGGCCCCGCCGCGCTGGGAGGGG + Intronic
1176223614 20:63981645-63981667 GCGGGCGGGCGGGCGGGGGGGGG - Intronic
1176237969 20:64063094-64063116 GAGCGCGGGCGCGGCGGGCGCGG + Intronic
1176286107 21:5020473-5020495 CCGCCCGGGGGCGGTGGGAGAGG - Intergenic
1176547880 21:8209251-8209273 GCCCGCGGGCGCGCGAGGCGGGG - Intergenic
1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176569036 21:8400268-8400290 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176576950 21:8444503-8444525 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1177834134 21:26170875-26170897 GCGCCCGCTCGCGCCGGGAGGGG + Intronic
1178493651 21:33070155-33070177 GCGCGCAGGTCCGCGGGGAGGGG + Exonic
1178953901 21:37006634-37006656 GCGCGGGCAAGCGCTGGGAGGGG - Exonic
1179674842 21:42974452-42974474 GCCCGCCGCCGCGCAGGGAGGGG + Intergenic
1179871074 21:44243002-44243024 CCGCCCGGGGGCGGTGGGAGAGG + Intergenic
1180110188 21:45643825-45643847 GCCCGCGGGCCGGCGGGGAGAGG - Exonic
1180201759 21:46228838-46228860 GCGCGCGGGAGGGGCGGGAGGGG - Intergenic
1180843641 22:18970444-18970466 GGCCGCGGGCGCGCAGGGCGCGG - Intergenic
1181514388 22:23402721-23402743 GAGCGCGGGCGCGAGGGGGGCGG + Intergenic
1183293873 22:37018943-37018965 GCCCCCGGGCCGGCTGGGAGGGG - Exonic
1183586501 22:38755894-38755916 GCGCGCGGGCACGCGAAGAGCGG + Exonic
1183697180 22:39430093-39430115 GCGAGTGGGCGGGCCGGGAGCGG - Exonic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184034935 22:41913858-41913880 GGGTGGGGGCGGGCTGGGAGGGG - Intronic
1184265354 22:43343283-43343305 GCGTGCGGGCGTGCGGGGCGCGG + Exonic
1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
952867232 3:37862128-37862150 GCGCGCGGGGGCGCGGCGCGGGG - Intronic
960101335 3:113746253-113746275 GCGCGCCGGCGCGCGAGGGGCGG - Exonic
962575495 3:136752048-136752070 GCGAGCGGGCGGGCCGGGCGCGG - Intronic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
964720748 3:159765207-159765229 GCGGGCGGGAGCGCAGGGAGGGG - Intronic
964801751 3:160565443-160565465 GCGGGGGGGCGGGCGGGGAGAGG - Exonic
966182225 3:177197638-177197660 GCGGGCGGGCGCGCGGGGGAGGG + Intergenic
966919382 3:184602053-184602075 GCCCGCGGGCGGGGCGGGAGGGG + Intronic
967596217 3:191329328-191329350 GCGGGCGGGCCGGCTGGGGGAGG - Exonic
968497491 4:926838-926860 GAGCGCAGGTGAGCTGGGAGGGG - Intronic
968794498 4:2693669-2693691 GCAGGCGAGAGCGCTGGGAGGGG - Exonic
969255112 4:5996162-5996184 GAGCACGGACGCGCTGGGACAGG - Intergenic
969597714 4:8158441-8158463 GCCGGCCGGCGCGCTGGGAAAGG + Intronic
971405617 4:26319463-26319485 GGGCGCGGGCGGGGTGGGAAGGG - Intronic
975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG + Exonic
976719786 4:88158720-88158742 GCGCTCGGGCGCGCCGGGTGTGG - Exonic
976733278 4:88284841-88284863 GCGCGCTTGCGCGGTGGGTGGGG + Intergenic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
978749532 4:112231710-112231732 GGGCCTGGGCGCGCTGGGGGCGG + Intergenic
979469018 4:121072671-121072693 GCGCGCTGGCGCGCAGCGGGAGG - Intronic
982198158 4:152936387-152936409 GAGCGGGGGCGCGCTGGCCGCGG + Exonic
985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG + Exonic
985628935 5:1004968-1004990 GCGGGCGGCCGTGCCGGGAGCGG + Intergenic
985749828 5:1667586-1667608 GGGCGGGGGCGCGCAGGAAGGGG + Intergenic
985780987 5:1871718-1871740 GCACGCGGGCGCCCTGGGGCAGG - Intergenic
987156737 5:15096608-15096630 GCGGGCGGGCGGGCGGGGGGTGG + Intergenic
987258423 5:16179958-16179980 CCGAGCGGGCGGGCTGGAAGTGG + Intronic
987373945 5:17217539-17217561 GCGGGCGGACGCGCGGGGGGAGG + Exonic
992365415 5:76084566-76084588 GCGCGCGGGGGCGGGGGGAGGGG + Intronic
993168433 5:84384907-84384929 GCGGGCGGGCGCCGGGGGAGTGG - Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
996378978 5:122845310-122845332 GCGCGCCAACGCGCTGGGCGCGG - Intronic
997963269 5:138338384-138338406 GCGGGCGGTCGGGCTGGGGGAGG - Intronic
999374945 5:151080653-151080675 GCGCGCGTGCGCACTGCGCGGGG - Intronic
1001065049 5:168529523-168529545 TCGCGCGGGGGCGGTGGGGGCGG + Exonic
1001402022 5:171451357-171451379 GAGCGAGGGGGCGCTGGGCGGGG - Intronic
1002140238 5:177133533-177133555 GCGAGCGGGCGCGCAGGGGGAGG + Intronic
1002190210 5:177473795-177473817 GCGCGCAGGGGCGGTGGGTGAGG - Intronic
1002592895 5:180303442-180303464 GGGCGCGGGCGCAATGAGAGTGG + Intronic
1003645602 6:7910866-7910888 CGGCGCGGGCGGGCGGGGAGAGG - Intronic
1004561805 6:16759969-16759991 GTGCGCGCGCGCGCCGGGCGGGG - Intronic
1004864119 6:19837241-19837263 GGGCGGGGGCGCGGAGGGAGAGG - Intergenic
1005040461 6:21595643-21595665 GTGCGAGGGCGCGCTGGACGGGG - Exonic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006694742 6:35921184-35921206 GCGCGCTTGCGCGTTGGGCGCGG + Exonic
1007390182 6:41546343-41546365 GCGCGCGGGCGGGGCGGGAGGGG - Intergenic
1007800499 6:44388136-44388158 GCGGGGGGGCGGGGTGGGAGGGG - Intronic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1011640308 6:89411765-89411787 GCGCACGGCCGGGCTGGGGGCGG + Intronic
1012245812 6:96924579-96924601 GCGCGCGGGCTAGCTGGAGGCGG + Intergenic
1012465860 6:99515524-99515546 GGGCCCGGGAGCGCGGGGAGGGG + Intronic
1012475748 6:99613638-99613660 GCGTGCGGGCGCCCCGGGAGCGG + Exonic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1013225061 6:108114956-108114978 GGCTGCGTGCGCGCTGGGAGCGG - Intronic
1013369104 6:109455053-109455075 GCGCCCGGGCGCACAGGGGGCGG - Intronic
1015842258 6:137488492-137488514 GCGCGTGAGGGCGCTGGGACCGG + Intergenic
1017880551 6:158559992-158560014 GGCCGCGGGCGCGCGGCGAGGGG - Intronic
1019387777 7:768084-768106 GCGGGAGCTCGCGCTGGGAGCGG + Intronic
1019471958 7:1225691-1225713 GCGGCCGGGCGGGCTCGGAGGGG - Intergenic
1019618499 7:1978066-1978088 GCACGCGGGCGCAGGGGGAGAGG - Intronic
1019689619 7:2403469-2403491 GGGCGCAGGCGCGCTGAGGGCGG + Intergenic
1020007766 7:4791471-4791493 GGGCGCGGGAGTCCTGGGAGAGG + Exonic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1022363293 7:29684743-29684765 GAGCGCGGGCGCGTGGAGAGGGG + Intergenic
1022428033 7:30285834-30285856 GAGCGCGGGTGCGCGGAGAGGGG - Intronic
1022698094 7:32729017-32729039 GAGCGCGGGCGCGTGGAGAGGGG - Intergenic
1023405814 7:39833274-39833296 GCGCGCGAGCGAGCGGAGAGCGG + Intergenic
1023638575 7:42237077-42237099 GCGAGCGGCCGGGCTGGGCGCGG + Intronic
1023724834 7:43132155-43132177 GGGCGGGGGGGCGCTGTGAGGGG - Intronic
1025173980 7:56787578-56787600 GCGGTCGGGCGCGCTGGGGCTGG - Intergenic
1025198615 7:56949171-56949193 GGGCGCGGGCGCGCAGGGTCAGG - Intergenic
1025673337 7:63627765-63627787 GGGCGCGGGCGCGCAGGGTCAGG + Intergenic
1025698120 7:63790377-63790399 GCGGTCGGGCGCGCTGGGGCTGG + Intergenic
1025829598 7:65038146-65038168 GCGGGCGGGCGCGGAGGGTGGGG - Intergenic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1027592555 7:80134752-80134774 GCGGGCGCGCGCTCTGGGAGTGG + Intronic
1027592655 7:80135114-80135136 GCACTCGGGCGCGGAGGGAGCGG + Exonic
1027654965 7:80919202-80919224 TCTCGCGGGCGCGCTCGGGGTGG - Exonic
1028417457 7:90595921-90595943 GCGCGCGGGCGGGGCGGGGGAGG + Intronic
1028477239 7:91265441-91265463 GCGCGCGCTCGCACAGGGAGCGG - Exonic
1029168689 7:98616519-98616541 GCGCGCGAGGGCTCTGCGAGTGG + Intergenic
1029238828 7:99144142-99144164 GCGCGGGGGCGCGCAGGGCCGGG - Intergenic
1029375743 7:100176079-100176101 GGGGGTGGGCGGGCTGGGAGGGG + Intronic
1029640441 7:101816484-101816506 GTGCGCGCGCGAGCGGGGAGCGG + Intronic
1032087304 7:128890933-128890955 GCGCGGGTGCGCGCAGGGCGCGG + Exonic
1033406430 7:141074212-141074234 GCGGGCGGCCGAGCTGGGGGAGG - Exonic
1033756857 7:144403445-144403467 GGGCGCGGGGGAGCGGGGAGGGG + Intronic
1034313824 7:150111884-150111906 GCGGGCCAGCGCGCCGGGAGTGG - Intergenic
1034793074 7:153988908-153988930 GCGGGCCAGCGCGCCGGGAGTGG + Intronic
1035435511 7:158856543-158856565 ATGCGCAGGCGCACTGGGAGAGG + Intergenic
1036561435 8:9903282-9903304 GGCCGCGGGCGCGAGGGGAGGGG - Intergenic
1037575270 8:20197170-20197192 GCGCGCGGGCGCAGAGGGAAGGG - Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037947741 8:22999756-22999778 GCGCGCAGGGGCGCCGGGAGAGG - Intronic
1038266745 8:26044164-26044186 GCGGCCGGGAGCTCTGGGAGGGG - Intronic
1038326696 8:26577527-26577549 GCGCGCAGGCGGGCAGGGACCGG + Intronic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1038808061 8:30812648-30812670 GCGCGCGGCCGGGCGGGGAAGGG - Exonic
1039875030 8:41578096-41578118 GCGCGCGGGCCGGCAGGGCGGGG - Intronic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1040501461 8:48008684-48008706 GCGCGCCGGCGGGCTGGGGGCGG + Intronic
1041044969 8:53880334-53880356 GCGCTCTGGCTAGCTGGGAGGGG + Intronic
1041244846 8:55880131-55880153 GGGCGCGGGCACGCGGGCAGTGG + Intronic
1043388273 8:79768382-79768404 GCGCGAGGGCGCGCCGGCGGGGG + Intergenic
1045583405 8:103501483-103501505 GGGCGAAGGCGCGCTGGCAGGGG + Intronic
1045737937 8:105318532-105318554 GAGCGCGGGGGCGCAGGGCGCGG - Intronic
1048009302 8:130443425-130443447 GCGCTCGGGCGCGCTCGGCGGGG - Intronic
1049109534 8:140634964-140634986 GCGCACGGGCGGGAGGGGAGGGG - Intronic
1049419444 8:142510510-142510532 GCGCGTGGGCGCACGTGGAGCGG - Intronic
1049452505 8:142669798-142669820 GCAGGCGGGCGCGCGGGGCGGGG - Intronic
1049457286 8:142700240-142700262 GGGCGCGGGAGCCCTGGGAAAGG - Exonic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1049724320 8:144138441-144138463 GCGCCCGCGCGGGCGGGGAGGGG + Intronic
1049988375 9:972005-972027 CCGCGAGGCCGGGCTGGGAGGGG + Intergenic
1051079598 9:13279304-13279326 GTGCGCGGGCGCCCTGGGCTCGG - Intronic
1052807493 9:33025646-33025668 CCGCGGGGGCGCGCACGGAGGGG - Intronic
1055611733 9:78031420-78031442 GGCCGGGGGCGCGGTGGGAGCGG + Exonic
1057361188 9:94374894-94374916 GCGCGCGGGCGCGCAGGCCGCGG + Exonic
1057573260 9:96219688-96219710 TGGCGCGGGCGGGTTGGGAGGGG - Intergenic
1057662175 9:97013270-97013292 GCGCGCGGGCGCGCAGGCCGCGG - Exonic
1057900391 9:98943832-98943854 GCGCGGGGGAGCGCAGGGCGCGG + Exonic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060514559 9:124257874-124257896 GCGCGCACGAGCGCTGGGGGCGG + Intronic
1061348319 9:130043644-130043666 GCAGGCTGGCGCGGTGGGAGTGG + Intergenic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1061987057 9:134136056-134136078 GTGCGCGTGCGCGAGGGGAGGGG - Intronic
1062499850 9:136847628-136847650 CCTCGAGGGCGAGCTGGGAGAGG - Exonic
1062547423 9:137069993-137070015 GCGGGCGGCGGCGCTGGGACCGG + Exonic
1062656005 9:137605020-137605042 CCGCGCGGGCGTCCTGGGCGGGG - Intergenic
1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1185747465 X:2584186-2584208 GCGCGCGGGGGCGCGGGGCGCGG + Intergenic
1185747620 X:2584648-2584670 GGGGGCGAGCGCGCGGGGAGGGG + Intergenic
1185778802 X:2828819-2828841 GCGCGCGGGCTTGCGGGCAGGGG + Exonic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1189002841 X:36963862-36963884 GCACAGGGGCGCGCTGGGCGCGG + Intergenic
1189137107 X:38561485-38561507 GCGGGCGGGCGCGCGGGAGGGGG - Exonic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1197774624 X:130110995-130111017 GCGGGCGGGCGGGGTGGGGGAGG + Intergenic
1198767159 X:140091569-140091591 GCGGGCGGGCGCGCGGGCGGCGG - Intergenic
1200098147 X:153673739-153673761 GCGCGGGGACGCGCGGGGCGGGG - Intronic
1200129016 X:153830953-153830975 GGGCGCACGCGCGCCGGGAGGGG + Intergenic
1201291217 Y:12421686-12421708 GCGCGCGGGCTTGCGGGCAGGGG - Intergenic