ID: 993901216

View in Genome Browser
Species Human (GRCh38)
Location 5:93585105-93585127
Sequence CAGGCGGCCCGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 2, 2: 9, 3: 105, 4: 577}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993901204_993901216 0 Left 993901204 5:93585082-93585104 CCGGCGGCCCCAACCCCGCAGCG 0: 1
1: 0
2: 6
3: 23
4: 250
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901202_993901216 2 Left 993901202 5:93585080-93585102 CCCCGGCGGCCCCAACCCCGCAG 0: 1
1: 0
2: 3
3: 21
4: 287
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901206_993901216 -7 Left 993901206 5:93585089-93585111 CCCCAACCCCGCAGCGCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 165
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901203_993901216 1 Left 993901203 5:93585081-93585103 CCCGGCGGCCCCAACCCCGCAGC 0: 1
1: 0
2: 1
3: 25
4: 384
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901209_993901216 -9 Left 993901209 5:93585091-93585113 CCAACCCCGCAGCGCAGGCGGCC 0: 1
1: 0
2: 1
3: 19
4: 183
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901208_993901216 -8 Left 993901208 5:93585090-93585112 CCCAACCCCGCAGCGCAGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 169
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901197_993901216 28 Left 993901197 5:93585054-93585076 CCGCAGGACGACGTGGCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 95
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901201_993901216 12 Left 993901201 5:93585070-93585092 CCGGGGGCAACCCCGGCGGCCCC 0: 1
1: 0
2: 0
3: 11
4: 235
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993901216 Original CRISPR CAGGCGGCCCGCGGCGGCGG CGG Exonic