ID: 993901216

View in Genome Browser
Species Human (GRCh38)
Location 5:93585105-93585127
Sequence CAGGCGGCCCGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 2, 2: 9, 3: 105, 4: 577}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993901209_993901216 -9 Left 993901209 5:93585091-93585113 CCAACCCCGCAGCGCAGGCGGCC 0: 1
1: 0
2: 1
3: 19
4: 183
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901203_993901216 1 Left 993901203 5:93585081-93585103 CCCGGCGGCCCCAACCCCGCAGC 0: 1
1: 0
2: 1
3: 25
4: 384
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901208_993901216 -8 Left 993901208 5:93585090-93585112 CCCAACCCCGCAGCGCAGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 169
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901201_993901216 12 Left 993901201 5:93585070-93585092 CCGGGGGCAACCCCGGCGGCCCC 0: 1
1: 0
2: 0
3: 11
4: 235
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901202_993901216 2 Left 993901202 5:93585080-93585102 CCCCGGCGGCCCCAACCCCGCAG 0: 1
1: 0
2: 3
3: 21
4: 287
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901204_993901216 0 Left 993901204 5:93585082-93585104 CCGGCGGCCCCAACCCCGCAGCG 0: 1
1: 0
2: 6
3: 23
4: 250
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901206_993901216 -7 Left 993901206 5:93585089-93585111 CCCCAACCCCGCAGCGCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 165
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577
993901197_993901216 28 Left 993901197 5:93585054-93585076 CCGCAGGACGACGTGGCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 95
Right 993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG 0: 1
1: 2
2: 9
3: 105
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993901216 Original CRISPR CAGGCGGCCCGCGGCGGCGG CGG Exonic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900176050 1:1291799-1291821 AAGGAGGCCCGGGGCGGAGGGGG + Exonic
900180240 1:1308040-1308062 CGGGCGGCGCGCGCGGGCGGCGG - Intronic
900237479 1:1599707-1599729 CACGCGGCGCGCGGCGGCCGGGG + Exonic
900342217 1:2194610-2194632 CGGGAGGCCCGCGGGGGCGCCGG + Intronic
900349542 1:2228149-2228171 CGGGCGGGCCGCGGAGCCGGCGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901425937 1:9182496-9182518 CAGGCGGGCGGCGGCGGTGAAGG - Intergenic
902044290 1:13513597-13513619 CGGGGGGCCCGCGCCGGCCGCGG + Exonic
902823251 1:18956262-18956284 CCGCCGGGCGGCGGCGGCGGGGG - Exonic
902870661 1:19312006-19312028 GAGGCGACCCGCGGTGGCGGTGG + Exonic
902919228 1:19656583-19656605 CAGGGGGATCGCGGCGGTGGGGG + Intronic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903153267 1:21428164-21428186 CAGGCCGCCCGCAGCGGCGCGGG - Intergenic
903875859 1:26472670-26472692 CAGGGAGGCGGCGGCGGCGGTGG - Intronic
903907378 1:26696420-26696442 CAGGCTGCTGGCGGCGGCGGGGG - Exonic
903907482 1:26696758-26696780 GAGCCGCCCGGCGGCGGCGGTGG + Exonic
904063154 1:27726478-27726500 CAGGGAGACCGCGGCGGCGGGGG - Intronic
904483292 1:30807388-30807410 GCGGCGGCCCGGGGCGGGGGCGG - Intergenic
904618964 1:31764175-31764197 GAGGCGGCGCGCGGCGCGGGCGG - Intronic
904769052 1:32870865-32870887 CAGGCGGCTCGGGGCGGCGCAGG - Intronic
905107735 1:35574176-35574198 CAGGCGGCCTGAGGAGGCTGCGG - Exonic
905137118 1:35808329-35808351 CAAGCGTTACGCGGCGGCGGCGG + Exonic
905912180 1:41662487-41662509 GAGGCGCCCCGGGCCGGCGGCGG - Intronic
906032970 1:42735095-42735117 CAGGGGGCCCTTGGCGGAGGCGG + Exonic
906319724 1:44808536-44808558 CTGGCTGGCGGCGGCGGCGGCGG - Exonic
906614545 1:47225484-47225506 CGCGCGGCCGGGGGCGGCGGGGG + Exonic
906637009 1:47416482-47416504 CGCCCGGCCCGGGGCGGCGGCGG + Exonic
907010632 1:50959896-50959918 TCGGCGCCCGGCGGCGGCGGCGG - Exonic
907053505 1:51345072-51345094 CGGGCGGCCCCTCGCGGCGGCGG + Exonic
907189050 1:52633454-52633476 CTGGTGGCCCGAGGTGGCGGCGG + Exonic
909314406 1:74197794-74197816 CAGATGGCCCGGGGTGGCGGGGG + Intronic
909352748 1:74673659-74673681 CGGGCGCCCAGGGGCGGCGGCGG - Exonic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910277456 1:85464677-85464699 ACGGCGGCCGGCGGCGGGGGAGG + Intronic
912305200 1:108560099-108560121 CAGACGGGCGGCAGCGGCGGCGG + Exonic
912379717 1:109240756-109240778 CAGGGGGTACGCGGCGGGGGCGG + Intergenic
912627161 1:111215061-111215083 CAGATGGTCGGCGGCGGCGGGGG - Intronic
913521409 1:119648362-119648384 CAGGGCGCCCGCTGCTGCGGTGG - Intergenic
913592546 1:120342347-120342369 CCGGCGGCCCGCGGCCGGGCCGG - Intergenic
913615716 1:120558163-120558185 CAAGCTTCCCGAGGCGGCGGCGG + Intergenic
913650804 1:120912783-120912805 CCGGCGGCCCGCGGCCGGGCCGG + Intergenic
914170308 1:145216284-145216306 CCGGCGGCCCGCGGCCGGGCCGG - Intergenic
914255300 1:145957706-145957728 CGGGCTGCCGGCGGCGCCGGGGG + Exonic
914525426 1:148460250-148460272 CCGGCGGCCCGCGGCCGGGCCGG - Intergenic
914574560 1:148952739-148952761 CAAGCTTCCCGAGGCGGCGGCGG - Intronic
914598248 1:149175580-149175602 CCGGCGGCCCGCGGCCGGGCCGG + Intergenic
914640975 1:149606878-149606900 CCGGCGGCCCGCGGCCGGGCCGG + Intergenic
914730408 1:150364715-150364737 ATGGCGGCCGGCGGCGGCGGAGG + Exonic
915246351 1:154558636-154558658 AGTGCGGACCGCGGCGGCGGCGG - Intronic
915325320 1:155078908-155078930 CAGTCGGGGGGCGGCGGCGGCGG + Exonic
916108623 1:161447868-161447890 CTGGCGGCCCCGGGCGGCGAGGG - Intergenic
916110211 1:161455249-161455271 CTGGCGGCCCCGGGCGGCGAGGG - Intergenic
916111796 1:161462659-161462681 CTGGCGGCCCCGGGCGGCGAGGG - Intergenic
916113383 1:161470040-161470062 CTGGCGGCCCCGGGCGGCGAGGG - Intergenic
916563424 1:165952869-165952891 CAGGCCGGGCGCGGTGGCGGTGG - Intergenic
916694556 1:167221769-167221791 GAGGTGGCCTGGGGCGGCGGGGG + Intronic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
918282946 1:183023496-183023518 GAGGCGGCGCGCGGGGGCAGTGG + Exonic
918511367 1:185317245-185317267 CGAGCGGTCGGCGGCGGCGGAGG - Exonic
918550296 1:185734402-185734424 CAGGCGGAGAGCAGCGGCGGCGG + Intergenic
918792037 1:188841398-188841420 CACCCGGCCAGCGGCTGCGGAGG - Intergenic
919730581 1:200911565-200911587 CAGGCGGCGTGGGGCAGCGGGGG - Exonic
919847039 1:201648810-201648832 AAGGCGCCCGGCGGCGGCGGCGG + Exonic
921472611 1:215567374-215567396 CAGGCAGGCTGCGGCGGCGTCGG + Exonic
922476705 1:225911530-225911552 CCGGCCGCCCGCGGCCGAGGAGG - Intronic
922739384 1:228006916-228006938 GGGGCGGCGCGGGGCGGCGGGGG - Intergenic
922821410 1:228487930-228487952 CAGGGGGACCGGGGCGGGGGCGG - Intronic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923171674 1:231422327-231422349 CGGGCGGCGCGCGAGGGCGGAGG + Exonic
923490418 1:234478946-234478968 GAGGAGGCGCGCGGCAGCGGGGG - Exonic
923623105 1:235593939-235593961 CAGGCTGCCCGCGCCAGCTGGGG - Intronic
923684162 1:236142444-236142466 CGGTCGGCGCGCGGGGGCGGCGG + Intergenic
1064179187 10:13100180-13100202 CCGGCGGGCGGCGGCGGTGGCGG - Exonic
1064179189 10:13100183-13100205 CTGCCGGCGGGCGGCGGCGGTGG - Exonic
1064208802 10:13347312-13347334 CAGGACGCCCGCGTCGGAGGCGG + Intronic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1064274202 10:13891779-13891801 CCGAGGGCCCGCGGCGGGGGCGG - Intronic
1064274262 10:13891979-13892001 CGGGCGGCGGGCGGTGGCGGCGG - Intronic
1065102056 10:22340883-22340905 CCGGCGGCCCGCGGCGCGGAGGG + Intergenic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1066022862 10:31319887-31319909 CAGGCGGGCTGCGGCGGCGGCGG + Intronic
1066370459 10:34814997-34815019 GGGCCCGCCCGCGGCGGCGGCGG - Exonic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1067091302 10:43266905-43266927 CGCGCGGCCGGCGCCGGCGGCGG + Intronic
1069474567 10:68721385-68721407 CCGGCGGCCCCGGGCGGCGACGG + Intronic
1069664509 10:70145761-70145783 CGCGCGGCCCGCGGGGGCGCTGG - Exonic
1069949295 10:72008247-72008269 CAGGCGGCCCACGACGGCAGCGG + Exonic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070800805 10:79243450-79243472 TAGCCGGACGGCGGCGGCGGTGG + Intronic
1071966580 10:90858068-90858090 CAGGGGAGCGGCGGCGGCGGCGG - Intergenic
1071997559 10:91162980-91163002 GAGGGAGCCCGCGCCGGCGGGGG - Intergenic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1072731574 10:97850212-97850234 CAGGTGGGCGGCGGCGGTGGCGG - Intergenic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1073139166 10:101236483-101236505 TGGGCGCCGCGCGGCGGCGGCGG - Intergenic
1073449689 10:103602122-103602144 CAGGCGGCCCTTGGCCTCGGCGG + Exonic
1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG + Exonic
1074586027 10:114768317-114768339 CCGGCGGCTCGGGGCGGGGGAGG - Intergenic
1074618588 10:115093817-115093839 CGGCCGGCGGGCGGCGGCGGCGG + Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1075031941 10:119029750-119029772 CGTCCGGCCCGCGCCGGCGGCGG + Exonic
1075206988 10:120456923-120456945 CAGGGAGGCGGCGGCGGCGGTGG + Intergenic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1075430405 10:122375142-122375164 CGGGAGGCCCGCGGCGGTCGCGG + Intronic
1075748521 10:124744340-124744362 CAGGCGGCGTGCGGCGGCGGCGG + Intronic
1075802011 10:125159914-125159936 CCGGAGGGCAGCGGCGGCGGCGG - Intronic
1076374061 10:129971909-129971931 CAGGCGGCGCGGGGCGAGGGCGG - Intergenic
1076680376 10:132168590-132168612 CACGCGGCCCGCGGCGGCCACGG - Exonic
1076792827 10:132785990-132786012 CCGGCGGGCAGGGGCGGCGGCGG - Exonic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1076850146 10:133088585-133088607 CAGGCCGCCCGCGGAGGGGAGGG + Intronic
1077204938 11:1337495-1337517 CCGGGGGCCCGAGGCGGGGGCGG + Intergenic
1081672714 11:44950612-44950634 CAGGCGGCGGGCGGCGGGAGGGG + Intronic
1081699822 11:45146123-45146145 CAGGCGTCCCGCGAAGGCTGAGG - Intronic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1081925751 11:46826821-46826843 CCGGCAGGCGGCGGCGGCGGCGG + Intronic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083203044 11:61131833-61131855 CAGGCAGGCCCCGGCGGTGGTGG + Exonic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1083658444 11:64241383-64241405 AAGGCGGAGCCCGGCGGCGGGGG + Intronic
1083722029 11:64607922-64607944 CGGGCGGCGCGCGGCGGGCGGGG + Exonic
1084008683 11:66336086-66336108 CAGGCGGGCCGCAGCGGCCGGGG - Exonic
1084028455 11:66467064-66467086 CAGGCGGGCCCCGGCGGGCGCGG + Intronic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084212286 11:67629812-67629834 CGCGCGGCCCGCGTCGGCCGCGG - Exonic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1085332810 11:75667702-75667724 GAGGCGGCCCCCGGCGGAGCGGG - Exonic
1085504100 11:77046220-77046242 CATGCGGCCCGCGGCCGCCAGGG + Intergenic
1086888242 11:92226777-92226799 CATTGGGCGCGCGGCGGCGGCGG - Intergenic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1089525662 11:119094935-119094957 CTGGCGGCCGGCCGCGGCGCGGG + Exonic
1090002941 11:122977745-122977767 CAGCCGAGCCTCGGCGGCGGTGG + Exonic
1090558013 11:127897980-127898002 CAGGCTGCCCGCACCAGCGGTGG - Intergenic
1090636881 11:128694912-128694934 CAGGAGTCCCGCGGAGCCGGCGG - Intronic
1090699181 11:129279247-129279269 CGGGCGGCGCTCGGCGGCGGCGG - Intronic
1090782845 11:130022415-130022437 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
1091201347 11:133783213-133783235 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
1091740830 12:2959459-2959481 CTGGCGGGACGCGGCGGCGCCGG - Exonic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1091973933 12:4810126-4810148 CCGGAGGCCGGCGGGGGCGGGGG + Exonic
1092796040 12:12111047-12111069 GAGGAGGCGCGCGGCGGAGGCGG - Intronic
1092834100 12:12472034-12472056 CAGGCTGCCCGAGCCAGCGGTGG - Intergenic
1092957388 12:13562998-13563020 CAGGCAGCCCACGGTGGCGGGGG - Exonic
1096073504 12:48788673-48788695 CAGGCGGCGGGCGACGGGGGTGG + Intronic
1096156613 12:49345000-49345022 CAGGCGGGCGGAGGGGGCGGGGG - Intergenic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1096784406 12:54009030-54009052 CGAGCGGGCGGCGGCGGCGGCGG - Intronic
1096863833 12:54549596-54549618 CTGGCAGCGCGCGGCGGCGGCGG + Exonic
1096983735 12:55743391-55743413 CGAGGGCCCCGCGGCGGCGGCGG + Exonic
1097107672 12:56634957-56634979 CGGGCCGCAGGCGGCGGCGGCGG + Intronic
1097929709 12:65170113-65170135 CTGGCGGCCAGGGGCGCCGGCGG - Exonic
1098105956 12:67069297-67069319 CCGGCGGCTCCGGGCGGCGGCGG + Intergenic
1098550369 12:71755133-71755155 GCTGCGGCCGGCGGCGGCGGCGG + Exonic
1099550552 12:84038383-84038405 CAGGGGGCCAGCGGGGGTGGTGG + Intergenic
1100186532 12:92145550-92145572 GGGGCGGCCCGGGGCGGCTGGGG + Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1101640132 12:106581637-106581659 CCGGCGGGCCGCGGCGGGGGCGG - Intronic
1101970722 12:109310090-109310112 CAGGCGGGGCGGGGCAGCGGCGG - Intergenic
1102197193 12:111034069-111034091 CGGGCGGCCGGCGGCGGCCCCGG + Exonic
1102884066 12:116508484-116508506 CAGGCGGGACGCGGCGTCGGGGG + Intergenic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1103400507 12:120640495-120640517 CGGGCGGCCCCTGGCGGCGAAGG - Intergenic
1103779358 12:123389014-123389036 CGGGCGGCCCGGGGCTGCCGCGG + Intronic
1103807472 12:123584559-123584581 CAGCGGGGCGGCGGCGGCGGCGG + Exonic
1104021266 12:124993887-124993909 CAGGGGGCGCGGGGCCGCGGCGG + Exonic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1105217447 13:18297500-18297522 CGGGCGGCCCGGGGCTGCCGCGG + Intergenic
1105389184 13:19959138-19959160 GAGGCGGCCGCCAGCGGCGGGGG + Intronic
1105900025 13:24745859-24745881 CAGGCCGCCCGCTGCAGCGCTGG - Intergenic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1106208408 13:27620508-27620530 CAGGAAATCCGCGGCGGCGGCGG - Intergenic
1106269487 13:28139105-28139127 GGGGCGGGCCGCGGCGGCGGAGG + Intronic
1106643273 13:31608143-31608165 CAGGCTGCCCGAGCCGGCAGTGG - Intergenic
1107058545 13:36131368-36131390 GAGGAGGGCGGCGGCGGCGGCGG + Intergenic
1107851497 13:44576825-44576847 CGGCCGGGGCGCGGCGGCGGCGG + Intronic
1108643844 13:52407620-52407642 CAGGCTGCACGCGCCGGCAGTGG - Intergenic
1110775661 13:79405849-79405871 CGGGCGGCGCGCGGAGGAGGGGG - Exonic
1110965484 13:81689952-81689974 GAGGAGGCGCGCGGCGGAGGCGG - Intergenic
1111951314 13:94711543-94711565 GGGGCTGCCCGCGGCGGCGGCGG + Exonic
1112216314 13:97434310-97434332 CTGGGCGCCGGCGGCGGCGGCGG - Exonic
1112402251 13:99086865-99086887 CGTGCGGCCCGGGGCGGAGGCGG - Intergenic
1113201224 13:107868338-107868360 CAGCTCGCCCGCGGCTGCGGAGG - Intergenic
1113656104 13:112068509-112068531 CGCGCCGCCCGCAGCGGCGGCGG - Exonic
1114516166 14:23301617-23301639 CGGTCGGCGCGCGGCGGGGGCGG + Exonic
1114523401 14:23352579-23352601 CAGACGCTCCGCGGGGGCGGGGG + Intronic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1115399160 14:32938868-32938890 CAGGCGACCGGCGGCGGCGGCGG - Intronic
1115474351 14:33799701-33799723 CGGGGGGCCGGCGGTGGCGGGGG - Intronic
1115754282 14:36517684-36517706 CAGCAGGACAGCGGCGGCGGCGG - Exonic
1115761314 14:36581065-36581087 CAGCCGTGCGGCGGCGGCGGCGG - Exonic
1115851234 14:37591948-37591970 CCGGGGGCCGGCGGCGGGGGCGG - Exonic
1116835817 14:49768262-49768284 CAGGCGTGCCCCGGCGGCGGCGG + Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1117029069 14:51651345-51651367 AAGGCGGTCCCCGGCGGAGGTGG - Intronic
1119325861 14:73759383-73759405 CCGGCGGCCCGCGGCGGCTCGGG - Intronic
1119438200 14:74611638-74611660 CAGGAGGCCCACCGAGGCGGAGG - Exonic
1120167900 14:81220346-81220368 GAGGCGGGAAGCGGCGGCGGCGG + Intronic
1121192154 14:92040201-92040223 CAGGCGGCCAGCTTCGGCCGGGG + Exonic
1121546963 14:94769806-94769828 CGGGAGGCCCGCGCCGCCGGGGG + Exonic
1122143374 14:99675232-99675254 GGGGCGGCGGGCGGCGGCGGGGG + Exonic
1122231200 14:100306976-100306998 CTGCGCGCCCGCGGCGGCGGTGG + Intergenic
1122418584 14:101561715-101561737 CGGGCTGCCCCCGGCGGCGGCGG - Exonic
1122517647 14:102319922-102319944 AAGGGGGGCGGCGGCGGCGGCGG - Exonic
1122768225 14:104085672-104085694 GAGGAGGCCCGGGGCGCCGGGGG - Exonic
1122975216 14:105168227-105168249 GAGGCTGCGCGCGGCGGCTGGGG - Intronic
1122984898 14:105207517-105207539 CAGGCAGCAGGAGGCGGCGGTGG + Intergenic
1123062626 14:105601148-105601170 CAGTCGTCCTGCGACGGCGGCGG - Intergenic
1202929089 14_KI270725v1_random:23139-23161 GAGGCGGACAGCGGCGGCGAGGG - Intergenic
1124500731 15:30225046-30225068 GAGGTGACCTGCGGCGGCGGCGG - Intergenic
1124527580 15:30471280-30471302 GCGGCGGCCCACGGCTGCGGCGG + Intergenic
1124742838 15:32313621-32313643 GAGGTGACCTGCGGCGGCGGCGG + Intergenic
1124771079 15:32536422-32536444 GCGGCGGCCCACGGCTGCGGCGG - Intergenic
1124929148 15:34101897-34101919 CAAGCCGCCAGCGGCGGCGGTGG - Exonic
1125329055 15:38564696-38564718 GAGCCGGCAGGCGGCGGCGGTGG - Exonic
1125516422 15:40323701-40323723 CAGGCGGCCGGCGGCCGGGCAGG + Intergenic
1125665434 15:41426707-41426729 CAGGAGGCCGGCGGGGGGGGGGG - Intronic
1126849871 15:52790373-52790395 AGGGCGGGCCGCTGCGGCGGCGG - Intronic
1127414934 15:58749216-58749238 CTGGCGGCCCCGGGAGGCGGGGG - Intronic
1128119236 15:65133555-65133577 GAGGCCTCCCGCGGCGGAGGCGG - Exonic
1128547735 15:68579188-68579210 GCGGCGGCCCGGGGCGGCGGCGG - Exonic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129644712 15:77419758-77419780 CAGGGGGCGCGCGGCACCGGCGG + Intronic
1130076691 15:80695620-80695642 CGGCTGGGCCGCGGCGGCGGCGG - Exonic
1130370849 15:83284460-83284482 CAGGCGGCCCGGGACGCCGCTGG - Intronic
1130370918 15:83284704-83284726 CACGCGGTGCGCGGCGGGGGCGG - Exonic
1131472712 15:92710675-92710697 CAGGCTGCCCGAGGCCGCAGTGG - Intronic
1132251898 15:100341039-100341061 CAGGCCGCCGGCGGCGCCGCAGG + Exonic
1132365128 15:101251573-101251595 CGGCGGGCCCGCGGCGGCGGCGG - Exonic
1132734632 16:1379384-1379406 CAGGCGGCCCGAGCCCGCGCTGG + Intronic
1132873233 16:2124758-2124780 GAGGCGGCCAGCGCGGGCGGGGG - Intronic
1132889518 16:2196840-2196862 CAGGCCGCCCGCGTCCGCAGAGG - Intergenic
1132900446 16:2251369-2251391 CGGGCGGCCGGCGGCGGAGACGG - Exonic
1132983738 16:2752824-2752846 GAGGCGGCGGGCGGAGGCGGCGG + Exonic
1133156351 16:3879804-3879826 GAGGGGGTCCGGGGCGGCGGGGG - Intronic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1133156584 16:3880508-3880530 CCGGAGCCCGGCGGCGGCGGCGG - Exonic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1133784564 16:8964034-8964056 CAGGCGGGCCTCGGCGGCGGCGG - Intronic
1134065467 16:11225501-11225523 CAGGCGGCCCACGGAGGGGCGGG - Intergenic
1134149868 16:11797178-11797200 CAGGCGGGCAGCGGTGGCGGCGG + Intronic
1134696985 16:16232533-16232555 GCGGCGGCTGGCGGCGGCGGTGG + Exonic
1135040605 16:19114438-19114460 CCGGGCGCCCGGGGCGGCGGTGG - Exonic
1135262122 16:20989864-20989886 CACCCGGCCAGCGGCTGCGGAGG - Intronic
1135821888 16:25692390-25692412 CTCCCGGCTCGCGGCGGCGGCGG - Exonic
1136540226 16:30924386-30924408 TCGGCGGCCATCGGCGGCGGGGG - Intronic
1136556498 16:31010501-31010523 CAGGCCCCCCGCAGCGGCCGCGG - Exonic
1137707952 16:50548395-50548417 CAGTCGGGCCGCGGCGACGGCGG + Exonic
1138196608 16:55056977-55056999 CGGCCGGCGGGCGGCGGCGGCGG - Intergenic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1139402929 16:66696615-66696637 CAGTCGGGCGGCGGCGGCGGCGG - Exonic
1139548527 16:67660985-67661007 CAGGCGGCCCGCCGAGGCGCAGG - Exonic
1141054642 16:80804087-80804109 GCGGCGGCGGGCGGCGGCGGCGG - Intronic
1141582723 16:85011322-85011344 CTCCCGGCCTGCGGCGGCGGCGG + Exonic
1141784423 16:86189139-86189161 CAGGCTGCCCGGGGCTGCGGTGG + Intergenic
1141959023 16:87392361-87392383 CCGGCGGCTCCCGGGGGCGGCGG - Exonic
1141972391 16:87492566-87492588 CGGCCGGTGCGCGGCGGCGGCGG + Intergenic
1142406637 16:89893903-89893925 CAGGCGGCCCAGGGCAGTGGTGG - Intronic
1142795468 17:2303752-2303774 CTGGCTGCGCGCGGCGGTGGCGG - Exonic
1143483404 17:7239475-7239497 CAGGCGGCCGGCGGCGCGGGGGG - Exonic
1143596249 17:7916011-7916033 CTGGCGGCGCGCGGGGACGGCGG - Intergenic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1144021346 17:11241644-11241666 GGGGCAGCCCGCGGCGGCTGTGG + Exonic
1144500850 17:15786241-15786263 GGGGCGGCCCGGGGCGGCGGGGG - Intergenic
1144724543 17:17495264-17495286 CGGGCCGGCAGCGGCGGCGGCGG - Exonic
1144816500 17:18039184-18039206 CAGGAGGCGCGCGGCGGCGACGG - Intronic
1144828841 17:18120931-18120953 CAGCTGGCCTGCGGCGCCGGTGG - Exonic
1145163011 17:20588903-20588925 GGGGCGGCCCGGGGCGGCGGGGG - Intergenic
1146022517 17:29292601-29292623 CAGGAGGCCTGGGGGGGCGGCGG - Intronic
1146371177 17:32266276-32266298 GCGGCTGCCCGCGGCGCCGGAGG + Exonic
1147168694 17:38606037-38606059 AGGGCCGCCCGGGGCGGCGGGGG + Intergenic
1147312941 17:39605824-39605846 CAGGCGGCCGGCGGCCTGGGCGG - Exonic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1148849796 17:50549040-50549062 CAGGCCACCAGCAGCGGCGGGGG + Exonic
1148930048 17:51120674-51120696 CGGGCGGCCCGGGGCGTCGCCGG + Exonic
1150060593 17:62065389-62065411 GGGGCTGCTCGCGGCGGCGGCGG - Intergenic
1150423094 17:65056253-65056275 CAGGGGGGCTGGGGCGGCGGCGG - Intronic
1150747298 17:67825956-67825978 GGGGGGGCCGGCGGCGGCGGCGG - Exonic
1151780216 17:76240472-76240494 CACGCGGCCTGAGGCGGCGGCGG - Intergenic
1151821271 17:76498197-76498219 CAGGCTGACCTCGGCGGTGGTGG - Intronic
1152069878 17:78129126-78129148 CAGGAGGCTTGCGGGGGCGGCGG - Intronic
1152433103 17:80260507-80260529 CGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152730358 17:81967005-81967027 CAGGCGGGGCGGGGCGGCCGAGG - Intergenic
1152789894 17:82273275-82273297 CGGGCGGCGGGCGGGGGCGGCGG + Intronic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1152924494 17:83080874-83080896 GACTCGGCCCGCGGCGGGGGCGG - Intronic
1153239843 18:3021174-3021196 CAGGCGGGGCGCGGGGGGGGGGG - Intergenic
1153688207 18:7567245-7567267 CTAGCGGGCCGCGGCGGCGCCGG + Exonic
1153935244 18:9914656-9914678 CAGGCGGACCGCGGCGCGGGCGG - Intronic
1154173457 18:12067274-12067296 CAGGCCGGCCACGGCGCCGGGGG + Intergenic
1155096374 18:22559813-22559835 CCGGACGCCCGCGGGGGCGGGGG + Intergenic
1155928812 18:31685101-31685123 CCGGCGCCCCGCGGCCGCCGCGG + Intronic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1156488923 18:37485220-37485242 CACGCGGCCCGCGGGCCCGGCGG + Intronic
1157496800 18:48162090-48162112 TGGGCGGCCTGCGGCGGCGGGGG - Intronic
1157578856 18:48761705-48761727 CAGGGGGCGCGGGGCGGTGGTGG - Intronic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1158436028 18:57435921-57435943 CACGCGGGCCGCGGCGCCGCTGG + Exonic
1158460590 18:57643016-57643038 CAGGCTGCCCGAGCCAGCGGAGG - Intergenic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1159770498 18:72542173-72542195 GAGGCGGCGCGCGGGGGTGGAGG + Exonic
1160321494 18:77900242-77900264 CCGGCGGCCTGCAGGGGCGGTGG + Intergenic
1160566303 18:79788468-79788490 CCTGCGGCCCGCGGCGGAGCGGG - Intergenic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160719130 19:589891-589913 CCGGCCGGCGGCGGCGGCGGCGG + Exonic
1160725381 19:615956-615978 GAGGTGACCTGCGGCGGCGGCGG - Exonic
1160767569 19:815249-815271 CGGGGGGCCCGCCGGGGCGGAGG - Exonic
1160860484 19:1235422-1235444 CAGGCAGCCCGAGGGGGCGGCGG + Intronic
1160875797 19:1295746-1295768 CAACCGGCCCGCGGCGCCCGGGG + Exonic
1160967832 19:1754323-1754345 TAGGCGGCCAGCGGCGGGGGTGG - Exonic
1161014857 19:1978516-1978538 CGGGCGGCCCGCGGGTGGGGCGG + Intronic
1161153531 19:2721280-2721302 TAGGCGGCCCGGGGCGGGGAGGG - Intronic
1161265118 19:3360222-3360244 AAGGCGCCCGGCGGCGGCCGCGG - Intronic
1161382153 19:3971092-3971114 CAGGCGCGTCGCGGCGGCAGGGG - Intronic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1162027705 19:7903911-7903933 CGGGCGGTGCGCGGCGGCGGTGG + Exonic
1162034672 19:7932548-7932570 CAGGGTGCCGGCTGCGGCGGGGG + Intronic
1162312067 19:9913700-9913722 CAGGCGCCCCGGGGGGGCGTGGG + Intronic
1162644000 19:12035500-12035522 CAGGGGTCCCGAGGCGGGGGAGG - Intronic
1162687690 19:12401031-12401053 CCGGCGTCCCGAGGCGGGGGAGG - Intronic
1162692013 19:12440875-12440897 CCGGCGTCCCGAGGCGGGGGAGG - Intronic
1162751762 19:12833860-12833882 CGCGGGGACCGCGGCGGCGGCGG - Intronic
1162832975 19:13298661-13298683 CGGCCGGCCCGGGGCGGCGAGGG - Exonic
1162959624 19:14118096-14118118 CCGGCGGGGCGGGGCGGCGGAGG + Intergenic
1163398116 19:17075848-17075870 CCGGCGGCGCGCGGCGGCCGAGG + Exonic
1163635034 19:18433714-18433736 CAGGCCGGCCACGGCGCCGGGGG - Exonic
1163845753 19:19637398-19637420 AAGGCGGGCGGCGGGGGCGGCGG + Exonic
1164582105 19:29440978-29441000 CAGGCTGCCCGAGGCAGCAGCGG + Intergenic
1164834537 19:31349248-31349270 CAGCCCGGCAGCGGCGGCGGCGG - Exonic
1165065482 19:33225849-33225871 CTGGGGGCCCCGGGCGGCGGGGG + Exonic
1165349397 19:35268129-35268151 CAGGCGGGCGGCGGCTGCGCGGG - Intergenic
1165782225 19:38441388-38441410 AAGGAGGCCCTCGGCGGGGGCGG + Intronic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165850860 19:38849704-38849726 GGGGCGGCGGGCGGCGGCGGCGG - Exonic
1166214704 19:41327614-41327636 CAGGCGGCCCGGGGCCACAGAGG - Intronic
1166305166 19:41933129-41933151 CAGCCGGCCCGGGGAGGCGGAGG + Intergenic
1166306906 19:41940416-41940438 AATGGGGCGCGCGGCGGCGGGGG - Intergenic
1166807693 19:45496976-45496998 CAGGGCGGCGGCGGCGGCGGCGG - Exonic
1166883008 19:45940361-45940383 CAGGAGGTTGGCGGCGGCGGCGG + Exonic
1166883069 19:45940583-45940605 CAGCAGGCCGGAGGCGGCGGCGG + Exonic
1167072954 19:47231151-47231173 CGGGCGCCTGGCGGCGGCGGCGG - Intronic
1167080355 19:47273434-47273456 CGAGCGGCCCCCGGCAGCGGAGG - Intergenic
1167103893 19:47419451-47419473 GGGGCGGCCCGGGGCGACGGAGG + Intronic
1167218625 19:48182658-48182680 CAGGCGGCGCACGTCGGCTGGGG - Exonic
1167250990 19:48398387-48398409 CAGGCGATGCGCGGCGCCGGTGG + Exonic
1167371538 19:49085583-49085605 CCGGAGGCTCGCGGCGGCTGCGG - Exonic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
1168076323 19:53982538-53982560 GCGGGGGCCGGCGGCGGCGGCGG + Exonic
1168309358 19:55452721-55452743 GGGGCGGCCGGAGGCGGCGGCGG + Intergenic
1168640124 19:58025588-58025610 CAGGCCACCCGAGCCGGCGGTGG - Intergenic
925609789 2:5693142-5693164 AGCGCGGCCGGCGGCGGCGGCGG + Exonic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
926154898 2:10448285-10448307 GGGGCGGCGGGCGGCGGCGGCGG + Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927875670 2:26653707-26653729 CAGGTGGCCCGCGAGGGCAGAGG - Intergenic
927887589 2:26728188-26728210 CAGGCGGGCGGCGGCGGAGGGGG + Exonic
928983220 2:37156922-37156944 CCGGCCGGCGGCGGCGGCGGCGG - Exonic
929501401 2:42494005-42494027 GAGCCGGCTCGCGGCGGCGGGGG + Exonic
929604321 2:43225122-43225144 GCGGCGGCCCGCGCCGTCGGGGG - Exonic
930106076 2:47640521-47640543 CAGGCTGCCAGGGGCGCCGGAGG + Intergenic
930136228 2:47906057-47906079 GAGGCGAAGCGCGGCGGCGGCGG + Intergenic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
932567360 2:72918160-72918182 CGAGCGGCCCGCGCCCGCGGCGG - Exonic
933279954 2:80322554-80322576 GGGACGGCGCGCGGCGGCGGAGG + Intronic
933908060 2:86914278-86914300 CGGCCGGGCGGCGGCGGCGGCGG + Intronic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934296818 2:91749024-91749046 TGGCCGGGCCGCGGCGGCGGCGG - Intergenic
934736236 2:96691269-96691291 CACGCGCCCAGCGCCGGCGGCGG - Intergenic
934966856 2:98731113-98731135 GGGGCGGCCCGCAGCGGCGGCGG - Intronic
935275775 2:101474305-101474327 CAGGCAGCGAGCGGCGGCCGTGG + Intronic
935592700 2:104856109-104856131 CGGGAGGTGCGCGGCGGCGGCGG - Exonic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
935731065 2:106065461-106065483 CACGCGGCCCCCGCCGCCGGCGG + Intronic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936954977 2:118014117-118014139 CGGGCAGGCGGCGGCGGCGGCGG - Exonic
938012740 2:127841710-127841732 AAGGCCGCCTGAGGCGGCGGTGG - Intergenic
938073114 2:128318679-128318701 CAGGCCGCCCGCAGCGGCGCGGG + Intergenic
938073989 2:128322402-128322424 CAGGCGCCCCGCGGTGCTGGGGG - Intergenic
938273020 2:129992521-129992543 CATGAGGCCAGCGCCGGCGGCGG + Intergenic
938443204 2:131353585-131353607 CATGAGGCCAGCGCCGGCGGCGG - Intronic
940775001 2:157876054-157876076 CAGGCTGGCAGCGGCAGCGGCGG + Intergenic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942046520 2:172102303-172102325 CACCCGGCGGGCGGCGGCGGCGG - Exonic
942241108 2:173964674-173964696 CACCCGCCCCCCGGCGGCGGCGG + Intronic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
942446799 2:176083477-176083499 CTTGCGGCTCTCGGCGGCGGAGG + Exonic
942453556 2:176123069-176123091 GAGGCGGCCAGGGGCGGCGGGGG - Exonic
943060533 2:183038113-183038135 GAGGCGGCCGGCGGCGGCGGCGG - Exonic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
943790177 2:191922559-191922581 CAGGCTGCCCGAGCCGGCAGTGG + Intergenic
944451808 2:199851146-199851168 CGGGCCACGCGCGGCGGCGGAGG - Intronic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
946248570 2:218400239-218400261 GCGGCCGCCCGGGGCGGCGGCGG - Intronic
946306461 2:218859530-218859552 CAGGCGGCCGCGAGCGGCGGGGG + Intergenic
946335132 2:219030989-219031011 CAGGAGGCCGGTGGAGGCGGGGG + Intronic
946767347 2:223052900-223052922 CGTGCGGCCGGCGGCGGCAGCGG + Exonic
947641158 2:231708591-231708613 GAGGAGGCGCGCGGCGGAGGCGG - Exonic
948248695 2:236507640-236507662 CAGGCCTCCCGCGGTGGCGCAGG - Intergenic
948467436 2:238159069-238159091 CCCCAGGCCCGCGGCGGCGGCGG - Exonic
948492067 2:238320319-238320341 CAGGCGGGGCGCGGCGGGGCGGG - Intergenic
948824797 2:240568929-240568951 AAGGCGGGCAGCGGGGGCGGCGG - Exonic
948884015 2:240874116-240874138 CAGGTGGCCCGAGGCGGGAGGGG + Intronic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
948991730 2:241559070-241559092 CAGGACGCCAGCGGCGGAGGTGG + Intronic
1168795828 20:609758-609780 CTGGCGGCCGCCGTCGGCGGCGG + Exonic
1168965331 20:1894964-1894986 CAGGTGGGCAGCGGCGGGGGCGG + Intronic
1170150505 20:13221723-13221745 GCGGCGGCCGGCGGCGGCGGCGG - Intergenic
1170890258 20:20369528-20369550 GAGGCGGCCGGCGACGGCGAGGG + Exonic
1170999147 20:21396423-21396445 CCCGCTGCACGCGGCGGCGGCGG - Exonic
1171977593 20:31605413-31605435 GCTGGGGCCCGCGGCGGCGGTGG - Exonic
1172037355 20:32019287-32019309 CAGGCGGGCAGCGGCGGGGGAGG + Exonic
1172073666 20:32277728-32277750 AAAGCGGGCGGCGGCGGCGGCGG - Exonic
1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG + Intronic
1172107169 20:32523718-32523740 CAGGCAGCCCAGGGCAGCGGAGG - Intronic
1172409091 20:34709269-34709291 AGGGCGGCCCGCGGGGGCAGGGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1173885752 20:46457609-46457631 CAGGAGGCCGGCTGCGGGGGAGG - Intergenic
1174017670 20:47501941-47501963 GTGGCGGCCGGCGGCGGCTGCGG + Exonic
1174357819 20:50010093-50010115 GAGGGGGCCGGCAGCGGCGGCGG + Intergenic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1175267113 20:57709673-57709695 CAGGAGGCGCGCGGCGGGGGAGG + Exonic
1175340938 20:58228608-58228630 GATGCGGCGGGCGGCGGCGGGGG - Exonic
1175429527 20:58891680-58891702 CGGCCGGGCTGCGGCGGCGGCGG - Intronic
1175429541 20:58891716-58891738 GAGGCAGCCCATGGCGGCGGCGG - Intronic
1176156927 20:63626760-63626782 CAGGCGGGCGGCGCGGGCGGTGG - Intronic
1176157018 20:63627015-63627037 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1176550282 21:8217893-8217915 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1176569210 21:8400931-8400953 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1176577124 21:8445163-8445185 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1178162852 21:29939284-29939306 GAGGCAGCGCGCGGCGGCGCAGG - Intronic
1178983227 21:37282737-37282759 CAGGCTGCCCGCGCCAGCAGTGG - Intergenic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1180740893 22:18052760-18052782 CAGGCTGCCCGAGCCGGCAGAGG - Intergenic
1180960691 22:19761057-19761079 TAGGCGTGCGGCGGCGGCGGCGG - Exonic
1182237091 22:28884132-28884154 CAGGCAGCCCGCGGCGGGGTCGG - Intronic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182429877 22:30293166-30293188 CAGGCTGCCCTGGGCAGCGGTGG - Intronic
1183149935 22:36029020-36029042 GTGGCGGCCCGCGGGGGGGGCGG + Intergenic
1183483807 22:38078697-38078719 CAGGCGGCCTGGGGAGGAGGAGG + Exonic
1183484699 22:38082618-38082640 CAGGGGTCCCGGGGAGGCGGAGG + Intronic
1183524935 22:38317296-38317318 CGAGCGGAGCGCGGCGGCGGCGG - Exonic
1183613513 22:38927305-38927327 CAGGCTGCCGGGGGCGGGGGGGG + Intergenic
1183702154 22:39457059-39457081 CGGGCGGCGCGGGGCGGCGGCGG + Intergenic
1183856144 22:40636423-40636445 CAGGCGGGGCGAGGCCGCGGTGG + Intronic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184236738 22:43187104-43187126 CGGACGGCGGGCGGCGGCGGCGG - Exonic
1184717382 22:46289747-46289769 CAGGCAGCCCGCGGTGGGCGGGG + Intronic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1203255177 22_KI270733v1_random:134231-134253 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1203263233 22_KI270733v1_random:179310-179332 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
949559475 3:5188323-5188345 CGCGCGGCCCCGGGCGGCGGGGG - Intronic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
950940339 3:16884965-16884987 GCGGCGGCCCGAGGCGGCGGCGG + Intronic
953891749 3:46756260-46756282 CAGGCTGCCCAGGGCGGAGGCGG + Exonic
954004205 3:47578822-47578844 GCGGCGGACGGCGGCGGCGGCGG - Exonic
954539695 3:51385290-51385312 CAGTCGGTCGGCGGCGGCAGCGG + Exonic
955186548 3:56719783-56719805 CAGGCTGCCCGAGCCAGCGGTGG + Intergenic
955687413 3:61561493-61561515 CAGGGGGCGCGCGGTGGCGGCGG - Intergenic
955769246 3:62372549-62372571 CGGGCGGGCGGCGGCGGAGGCGG - Exonic
955911577 3:63863966-63863988 CGCGGGTCCCGCGGCGGCGGCGG - Intergenic
961665862 3:128492834-128492856 CAGGCGGGCCGGGCCGGGGGCGG + Intronic
961674272 3:128555381-128555403 CAGGGTGCGCGCGGCGGCCGCGG + Intergenic
961674400 3:128555836-128555858 CAGGAAGCCCGCAGCGGCTGCGG + Intergenic
962809816 3:138950391-138950413 CAGGCAGCCGGCGGCGGCGCGGG - Exonic
964118562 3:153160722-153160744 CAGGCTGAGCTCGGCGGCGGCGG - Intergenic
964570788 3:158105834-158105856 CGGGCGGCCGGCGGAGGCGGCGG - Exonic
965590623 3:170357584-170357606 CGGGCGGCCGGAGACGGCGGCGG + Intergenic
966182196 3:177197554-177197576 CGCGAGGCCCGCGGCGGCGGCGG + Intergenic
966182296 3:177197856-177197878 AGGCCGGCCCGCGGCGGTGGGGG - Intergenic
967137685 3:186526374-186526396 CTGGCTGCCCGCAGCGGTGGGGG + Intergenic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
967858256 3:194134273-194134295 CACGTGGCACCCGGCGGCGGCGG + Intergenic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
968133632 3:196207470-196207492 CAGGAGGCCCGCGGCGGACACGG + Exonic
968724901 4:2242267-2242289 CAGGATGCCCGCAGCGGCCGGGG - Intergenic
968946932 4:3669772-3669794 GAGGCGGCCCACGCCGGCGGGGG + Intergenic
968965150 4:3765929-3765951 CAGGGCGGCGGCGGCGGCGGCGG + Intergenic
968965310 4:3766449-3766471 CAGCCGGCCCTCGGCCGTGGTGG - Exonic
969285754 4:6200802-6200824 CAGGCTGCCCGGCGCGGCTGGGG - Intergenic
969326916 4:6449523-6449545 CAGGGGCCAGGCGGCGGCGGGGG - Intronic
969360276 4:6658850-6658872 CAGCCCGCGCGCGGAGGCGGAGG + Intergenic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
971406030 4:26321253-26321275 AGGGCGGGCGGCGGCGGCGGCGG + Intronic
971757439 4:30721345-30721367 CAGGCGGCCGGCCCCGGAGGAGG + Exonic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
973945318 4:55949080-55949102 CAGAGGGCCAGCTGCGGCGGTGG + Intronic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
975986118 4:80202702-80202724 CAGGACGCTGGCGGCGGCGGCGG + Exonic
976226329 4:82798061-82798083 CAGGCAGACCGCGGCGGGGTGGG + Intronic
976276557 4:83284575-83284597 CAGTTTGTCCGCGGCGGCGGTGG - Exonic
977176960 4:93829596-93829618 CAGGAGGCTGGAGGCGGCGGTGG - Exonic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
980130303 4:128811409-128811431 CTGGCGGCCGAGGGCGGCGGGGG + Intronic
981270745 4:142845724-142845746 CAGGCCGGCGGCGGCGGCGGCGG + Intronic
982745995 4:159104025-159104047 CAGCCAAACCGCGGCGGCGGCGG - Intergenic
983608068 4:169612642-169612664 AAGGCGGCACGCAGCGGAGGCGG + Intronic
984778663 4:183505116-183505138 CTGAGGGCCCGCGGCGGCCGCGG + Exonic
984857542 4:184207885-184207907 AAGGCGGCCCTCGCAGGCGGTGG - Intronic
985896182 5:2751174-2751196 CGGGAAGCCGGCGGCGGCGGCGG + Exonic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
985996442 5:3599844-3599866 CAGGCCGCCCGCTGCAGCGCCGG - Exonic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986451420 5:7869280-7869302 GAGGCGGCCCGGGGCGGGGGTGG + Intronic
986858798 5:11903700-11903722 CGGCCGGCAGGCGGCGGCGGCGG - Intronic
988547689 5:32173934-32173956 CGGGCGGCGGGCGGCGGCGCCGG - Exonic
988577837 5:32444245-32444267 CAGCGGGGCGGCGGCGGCGGCGG - Exonic
990557738 5:56952179-56952201 CGGGCGGACCGCGGCGGTGGCGG - Intronic
990825423 5:59893348-59893370 CGGGCAGCCCCGGGCGGCGGCGG + Exonic
990919220 5:60944734-60944756 CAGGCGGGGGGCGGCGGGGGTGG - Intronic
990955024 5:61332321-61332343 CGGCCGGGCGGCGGCGGCGGCGG + Exonic
991676555 5:69094283-69094305 CTGGCCGGCCCCGGCGGCGGCGG + Exonic
991967479 5:72107392-72107414 GAGGCGGCGCGCGGCGCCAGAGG + Exonic
992365411 5:76084560-76084582 TAGGCGGCGCGCGGGGGCGGGGG + Intronic
992716250 5:79514043-79514065 CGGCCGGCCGGCGGAGGCGGAGG - Exonic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
995224953 5:109690751-109690773 TGGGCGGCGTGCGGCGGCGGCGG + Intronic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
996862811 5:128084224-128084246 CGGGCGGGCCGCTGCTGCGGCGG + Exonic
997013422 5:129904709-129904731 TAGGCGGCCGGCTGCGGCCGCGG + Exonic
997236120 5:132272788-132272810 CAGACGGCCCGCGGCGGCCCCGG - Exonic
997585219 5:135039789-135039811 CGGGCGACGGGCGGCGGCGGCGG - Intronic
997760709 5:136445199-136445221 CAGGCTGCCCGAGGCAGCAGTGG + Intergenic
999248389 5:150167294-150167316 GTGGCGGCCGGAGGCGGCGGTGG + Exonic
999731715 5:154480163-154480185 CTGGGGGCCCGCTGCTGCGGCGG + Intergenic
999748712 5:154610648-154610670 GGTCCGGCCCGCGGCGGCGGGGG - Intergenic
1000084867 5:157880101-157880123 CAGGCTGCCCGAGGCAGCAGTGG + Intergenic
1001401928 5:171451056-171451078 GAGGCGGCCGGCGGCGGGGTGGG - Intronic
1001639132 5:173232897-173232919 CGGGCAGGCGGCGGCGGCGGCGG + Exonic
1001688745 5:173616414-173616436 ATGGCGGACGGCGGCGGCGGCGG - Exonic
1002055705 5:176596950-176596972 CGGGCGGCGGGCGGCGGCGCGGG + Exonic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002352040 5:178590127-178590149 AATGCGGCGGGCGGCGGCGGCGG - Exonic
1002580938 5:180209135-180209157 CGGTCGGGCGGCGGCGGCGGCGG - Intronic
1003603807 6:7542000-7542022 GAGGTGACCAGCGGCGGCGGGGG + Exonic
1003624097 6:7727062-7727084 CAGCTGCCCCCCGGCGGCGGCGG - Exonic
1004396341 6:15248820-15248842 CAGGCGCGGCGGGGCGGCGGGGG + Intronic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1005040307 6:21595030-21595052 CATGGGGGCGGCGGCGGCGGCGG + Exonic
1005040346 6:21595192-21595214 CTGGCAGGCGGCGGCGGCGGCGG + Exonic
1005825200 6:29628079-29628101 CGGGCGGCGCGCGGCAGCGGGGG + Intronic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1007553599 6:42747626-42747648 CAGGCGGGGCGCGGGGGCAGGGG + Intronic
1007644434 6:43369459-43369481 GAGGCGGCGCGCAGCGGCCGAGG - Intronic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1012887262 6:104859880-104859902 CGGGAGGGACGCGGCGGCGGGGG - Exonic
1013033666 6:106360551-106360573 CCGGGGGCGCGCGGCGGCCGTGG - Intergenic
1013099457 6:106974815-106974837 GAGGCGGCGGGCGGCGGCGGAGG - Intronic
1013117473 6:107114449-107114471 AGGCCGGCCCGCGGCGGCGGCGG - Intronic
1013117805 6:107115535-107115557 CTGGCTGCCCGGGGCGGGGGCGG + Intergenic
1013514853 6:110875771-110875793 CATGCTGCCCGCGGCCGCCGCGG - Intronic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1014913375 6:127118838-127118860 CGGGCGAGCGGCGGCGGCGGCGG - Exonic
1015625937 6:135181192-135181214 CAGGGCGACCGCGGAGGCGGCGG + Intergenic
1015965464 6:138692704-138692726 GCGCCGGCCCGAGGCGGCGGGGG - Intergenic
1017738218 6:157381933-157381955 CGGGCGGCCGGCGGCGGTCGTGG + Exonic
1017842259 6:158231961-158231983 CAGGTGGCCCGGGCAGGCGGCGG + Intergenic
1018400356 6:163414719-163414741 CAGTCGGAGCGCGGCGGCAGCGG + Exonic
1019348721 7:543245-543267 CAGGAGGCCCTCGGCAGGGGTGG - Intergenic
1019656790 7:2200204-2200226 CAGGCGGCCCGGGGCGGGTGTGG - Intronic
1019828330 7:3301608-3301630 TCGGCGGCCGGTGGCGGCGGCGG + Exonic
1019989563 7:4682273-4682295 CGAGCGGCCTCCGGCGGCGGCGG - Intergenic
1020006212 7:4784953-4784975 CAGGCGGCCGGCAGAGGAGGTGG - Exonic
1020096297 7:5371264-5371286 CAAGCCGTCCGCGTCGGCGGCGG + Exonic
1020204612 7:6105123-6105145 CCGGCGGGCCGCGCCGGCTGAGG - Intronic
1020204634 7:6105175-6105197 CGGGCGGCCCGCGGCTGTGTAGG - Intronic
1020430232 7:8110850-8110872 GAGGCGGCCCGAGGCGTCGGTGG - Intergenic
1022107299 7:27205551-27205573 CAGGCGGCCTGGGCCCGCGGGGG + Intergenic
1022163948 7:27740025-27740047 GAGGCGTCCCGCGGCGGAGTGGG + Intronic
1022427667 7:30284553-30284575 CTGGCGGCACGAGGGGGCGGGGG + Exonic
1023529348 7:41136718-41136740 GAGGGGGGCCGAGGCGGCGGGGG + Intergenic
1025069776 7:55887831-55887853 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069785 7:55887854-55887876 CGGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069794 7:55887879-55887901 GCGGCGGCGGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025230961 7:57203182-57203204 CAGGAGGGCCGAGGCGGAGGAGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1026471055 7:70694411-70694433 CAGGCAGCCCGCGGCGCGGCTGG + Intronic
1026522758 7:71131551-71131573 CAGCCTGCGGGCGGCGGCGGCGG + Intergenic
1026598242 7:71752308-71752330 GAGGCGGCCCAGGCCGGCGGGGG + Intergenic
1026909467 7:74083898-74083920 CCGCCGGCCCGGGGAGGCGGGGG - Intronic
1027232618 7:76281580-76281602 CGGGCAGGCGGCGGCGGCGGCGG + Exonic
1028762257 7:94509686-94509708 CCGGCGGGCGGCGGCGGCTGCGG - Intronic
1029896504 7:103989742-103989764 GGGGCGGCGCGCGGGGGCGGGGG - Intergenic
1030138703 7:106284572-106284594 CTGGGGGCGCGCGGCGGCGGCGG - Intronic
1031025203 7:116672266-116672288 CGCGCGGCCCGCGGCGGCCCGGG - Intergenic
1031051881 7:116953438-116953460 CGCCCGGGCCGCGGCGGCGGCGG + Exonic
1031886589 7:127251671-127251693 CGGGCGGCCAGGTGCGGCGGGGG - Intronic
1033033216 7:137846764-137846786 CGGGCTGGCGGCGGCGGCGGCGG + Exonic
1033299937 7:140176670-140176692 CGGGCGGCCGGCGGCGGCGGCGG + Intronic
1033477198 7:141702228-141702250 CCGGCGGGCGGCGGCGGCGTTGG - Intergenic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1034254098 7:149714974-149714996 CACGCGACCCTCGTCGGCGGCGG - Intronic
1034469713 7:151248735-151248757 CGGGCGGGCGGCGGCGGCGTGGG - Exonic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1035496818 7:159335248-159335270 AAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1036664685 8:10730728-10730750 CGGGCGGGCCCTGGCGGCGGAGG - Intronic
1037902170 8:22694677-22694699 CAGCCGGCCCGCGGGCGAGGGGG + Intergenic
1038152655 8:24956532-24956554 TCCCCGGCCCGCGGCGGCGGTGG + Exonic
1038883661 8:31640278-31640300 CAGGAAGGCGGCGGCGGCGGCGG + Intronic
1039512819 8:38105363-38105385 CCGGCCTCCCGCGCCGGCGGTGG - Exonic
1041059497 8:54022267-54022289 AACGAAGCCCGCGGCGGCGGCGG + Exonic
1042155694 8:65841980-65842002 CAGGACTCCGGCGGCGGCGGCGG - Intronic
1043110278 8:76170822-76170844 CAGGCTGCCCGCGCCAGCAGTGG + Intergenic
1043388242 8:79768278-79768300 CGGGCGGCCGGCGACGGCGACGG + Intergenic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1043502936 8:80874243-80874265 CCGGCGGCCGGCGGCTACGGCGG + Intronic
1044335970 8:90985224-90985246 CTGGCTGACCGCGGTGGCGGCGG + Exonic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1045336110 8:101205598-101205620 CGGCGGGCGCGCGGCGGCGGCGG - Intronic
1046547445 8:115669137-115669159 CAGCCGGCTCGCCGCGGCCGGGG - Intronic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1047931132 8:129728924-129728946 CAGGAGGCCCGAGGTGGTGGCGG + Intergenic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1048980936 8:139703207-139703229 CAGCCGCCTCGCGGTGGCGGTGG - Intergenic
1049374830 8:142284382-142284404 CAGGTGGCCCGAGGCTGGGGCGG + Intronic
1049668388 8:143858950-143858972 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049668804 8:143860549-143860571 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669219 8:143862151-143862173 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669634 8:143863753-143863775 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670044 8:143865346-143865368 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049828616 8:144685821-144685843 CACTGGGCCGGCGGCGGCGGCGG - Intergenic
1049989398 9:977290-977312 ACGGCGTCCCCCGGCGGCGGGGG - Exonic
1050744151 9:8857773-8857795 CAGGGGGGCTTCGGCGGCGGCGG - Intronic
1054274362 9:63053244-63053266 CAGGCGCACAGCGGCGGCGCAGG + Intergenic
1054400462 9:64711685-64711707 CAGGCGCACAGCGGCGGCGCAGG - Intergenic
1054722588 9:68617834-68617856 CAGGCTGCCCGAGCCGGCAGTGG + Intergenic
1054762320 9:69014113-69014135 CGGGGGTCTCGCGGCGGCGGCGG + Exonic
1054835652 9:69672546-69672568 CCGCGAGCCCGCGGCGGCGGCGG + Intergenic
1055757770 9:79573232-79573254 CCGGCGGCCCGCGGCGCGAGGGG - Intronic
1057300962 9:93881811-93881833 CAGGCTGCCCGAGCCGGCAGTGG + Intergenic
1057488627 9:95506081-95506103 CAGGCGGACAGCGGCAGCGGCGG + Intronic
1057869775 9:98708886-98708908 CAGAACGGCCGCGGCGGCGGCGG + Exonic
1057881487 9:98796121-98796143 CAGGCGGCCAGGTGAGGCGGCGG - Exonic
1057900411 9:98943920-98943942 AAGGCGGCGCTCGGCAGCGGCGG - Exonic
1057997147 9:99828722-99828744 CTGGCTGCCCGCGGCGGCTGCGG - Exonic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1059633943 9:116154356-116154378 CAGGCACCGCCCGGCGGCGGCGG - Exonic
1060700570 9:125746859-125746881 CGGGCGGGCAGAGGCGGCGGGGG - Intergenic
1060700602 9:125746941-125746963 GCGGCGGCGGGCGGCGGCGGAGG - Intergenic
1060979726 9:127785434-127785456 CGGGCGGGCGGTGGCGGCGGCGG + Intergenic
1061144122 9:128787271-128787293 CTGGGGGGCGGCGGCGGCGGCGG + Exonic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061449167 9:130659474-130659496 CAGGCGCCCAGGGGCGGAGGAGG - Intergenic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1061840722 9:133357070-133357092 TAGGTGGTCCGCGGCGGCGCGGG + Intronic
1061853283 9:133428585-133428607 AAGGCGGCCGGCAGGGGCGGGGG - Intronic
1062022308 9:134325473-134325495 CGGGCGGCGCGCGGCGGAGGCGG + Intronic
1062410719 9:136422753-136422775 CATGCGGCCCTCGGGGGCTGGGG + Intronic
1062502689 9:136858128-136858150 CAGGCAGCCCTCGGGGGAGGGGG - Intronic
1062534480 9:137015423-137015445 CAAGCGGCCCGCCGAGCCGGGGG - Exonic
1062600293 9:137316227-137316249 AAGGCCGGCCGCGGGGGCGGGGG - Intronic
1062630777 9:137462149-137462171 CCGGCCACCCGCGGCGGCGGAGG - Intronic
1203471575 Un_GL000220v1:117368-117390 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1203479396 Un_GL000220v1:161340-161362 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1203621127 Un_KI270749v1:130450-130472 GAGGCGGACAGCGGCGGCGAGGG - Intergenic
1185635226 X:1547249-1547271 AAGGCGGCCAGGGGCTGCGGTGG + Intergenic
1186496372 X:10015302-10015324 GGGGCGGCCGGCAGCGGCGGCGG + Intergenic
1186496464 X:10015592-10015614 GCGGCGGCCGGCGGCGACGGCGG + Exonic
1186768058 X:12791458-12791480 CGAGGGGCGCGCGGCGGCGGAGG - Exonic
1187518157 X:19990959-19990981 CGAGGGGCCGGCGGCGGCGGCGG - Intergenic
1187915533 X:24149760-24149782 CGGGCGGCCGGCGACGGTGGCGG - Exonic
1189002794 X:36963746-36963768 CCCGCGGCCCGCGGCGGAGGTGG - Intergenic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1190007995 X:46758646-46758668 CAGGAGGAGCGCGGCGGCCGAGG + Intronic
1194325875 X:92515508-92515530 ATGGGAGCCCGCGGCGGCGGCGG - Intronic
1196819569 X:119692459-119692481 CGGGCGGGCGGCGGCGGCGCCGG - Intronic
1197709374 X:129654781-129654803 GAGGCGGCCAGCGGGAGCGGCGG - Exonic
1197754497 X:129984296-129984318 CAGGCGGCGCGCGGTGGGGAGGG + Intronic
1197776329 X:130120879-130120901 CACGCGGAACGCGGCGGCGGCGG + Intergenic
1198158506 X:133985346-133985368 CAGGTGGCGTCCGGCGGCGGCGG + Exonic
1198158507 X:133985349-133985371 GTGGCGTCCGGCGGCGGCGGCGG + Exonic
1199736864 X:150693536-150693558 CAGGCCGGCGGCGGCGGCGGCGG + Exonic
1200100745 X:153688278-153688300 CGGCCGGGCGGCGGCGGCGGCGG - Exonic
1200231075 X:154444191-154444213 GCGGCGGCGGGCGGCGGCGGCGG - Exonic
1200634597 Y:5634666-5634688 ATGGCAGCCCGCGGCGGCGGCGG - Intronic