ID: 993902068

View in Genome Browser
Species Human (GRCh38)
Location 5:93591324-93591346
Sequence CACAACCCCCTAGTTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993902065_993902068 -9 Left 993902065 5:93591310-93591332 CCTAGCTTTGTCACCACAACCCC 0: 1
1: 0
2: 1
3: 9
4: 216
Right 993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 69
993902062_993902068 1 Left 993902062 5:93591300-93591322 CCCCTGGTCACCTAGCTTTGTCA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 69
993902063_993902068 0 Left 993902063 5:93591301-93591323 CCCTGGTCACCTAGCTTTGTCAC 0: 1
1: 0
2: 2
3: 6
4: 145
Right 993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 69
993902064_993902068 -1 Left 993902064 5:93591302-93591324 CCTGGTCACCTAGCTTTGTCACC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 69
993902061_993902068 2 Left 993902061 5:93591299-93591321 CCCCCTGGTCACCTAGCTTTGTC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993902068 Original CRISPR CACAACCCCCTAGTTGATCT GGG Intronic
901458334 1:9376681-9376703 CAGAAGTCCCTAGTTGAACTGGG - Intergenic
903991615 1:27274802-27274824 CACAACTTCCAAGGTGATCTTGG - Intronic
904395599 1:30219398-30219420 CACAACCACCTTGCTGACCTTGG - Intergenic
909039107 1:70628843-70628865 CAGAGACCCCTAGTTGGTCTGGG + Intergenic
914293739 1:146298956-146298978 CACAACCCCCTATATTATTTTGG + Intergenic
914554783 1:148749739-148749761 CACAACCCCCTATATTATTTTGG + Intergenic
916106846 1:161439451-161439473 TACAACCCCTCAGTTGATCATGG + Intergenic
916805399 1:168255142-168255164 AACAAACCCCTAGATCATCTAGG + Intergenic
924518356 1:244784732-244784754 CACAACCCCTCAGATGATCAAGG + Intergenic
1068037882 10:51783671-51783693 CCCAGCCCCCTAGTAGGTCTTGG - Intronic
1068808963 10:61234117-61234139 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1069292742 10:66802934-66802956 CACAACCCCTCAGATGATCAAGG - Intronic
1071898462 10:90091407-90091429 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1073854929 10:107662965-107662987 CACAAGCCCCTATTTTAACTGGG - Intergenic
1075979239 10:126722665-126722687 CACCACCCCCTAGTGCAGCTGGG - Intergenic
1082633962 11:55574010-55574032 GACAAGCCCCAAGTTTATCTTGG - Intergenic
1085182637 11:74548630-74548652 CACACCCTCCCAGTTGATCTAGG + Intronic
1085792044 11:79504644-79504666 CACAGCCCTCTAATTGGTCTAGG + Intergenic
1091222323 11:133936760-133936782 CACAACCCCCGAGTTCCTCCAGG + Intronic
1093686742 12:22064691-22064713 CACTGCCCCCTAGTTTATTTGGG - Intronic
1094474427 12:30830427-30830449 CACGACCTCCTAATGGATCTAGG + Intergenic
1098856899 12:75663260-75663282 CACAATGCCCTAGTAGATCATGG - Intergenic
1100311554 12:93399620-93399642 CACAACCCCCTATATTATTTTGG + Exonic
1102364046 12:112316081-112316103 CACAAACCCCTATGTGATCTGGG + Intronic
1115271345 14:31556984-31557006 CACATCCCCCAAGCTGATTTGGG + Intronic
1124147379 15:27140162-27140184 CACAACCCCCTATTTGTGTTTGG - Intronic
1125405724 15:39351114-39351136 CACAACCCCCAAGTTCAGCAGGG + Intergenic
1129169909 15:73801370-73801392 CACAACCACCTATGTGACCTGGG - Intergenic
1135516976 16:23144299-23144321 CACCACCACCTAGTTGAAGTTGG - Intronic
1142289796 16:89188251-89188273 CAGAACACCCTCGTTGGTCTTGG - Exonic
1151656348 17:75498000-75498022 CACTACCTCCTCTTTGATCTGGG - Intronic
1161684966 19:5698076-5698098 CCCCACCCCCTAGTCAATCTGGG + Intronic
1167836912 19:52080461-52080483 CACAACTCCCAAGATCATCTAGG + Intronic
934232808 2:90201026-90201048 TTGAACCCCCGAGTTGATCTGGG + Intergenic
937579922 2:123472766-123472788 CAGAATCCCCAAGTTTATCTTGG + Intergenic
942304419 2:174591839-174591861 CAAGATGCCCTAGTTGATCTGGG - Intronic
942417551 2:175774858-175774880 CACAACTCTCTACTTGAACTGGG + Intergenic
946073556 2:217054765-217054787 CATTAACCCCTAGTGGATCTTGG - Intergenic
946130906 2:217606069-217606091 CACAACCTGCTAGTGGGTCTTGG - Intronic
948486400 2:238283971-238283993 CACCACCTCCTATGTGATCTCGG + Intronic
1168893560 20:1309123-1309145 CACAACCCCCTCTCTGACCTGGG + Exonic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1176013076 20:62910935-62910957 CACAACCCCCTGATCGTTCTCGG + Exonic
1183345240 22:37303838-37303860 CACAAGGCCCTACTTGAGCTGGG + Intronic
1184910769 22:47532434-47532456 CACCACCCCCGAGGTGATGTCGG - Intergenic
949152674 3:789402-789424 CCCAACCCCCTTGTTGTTCAAGG - Intergenic
959366262 3:105461756-105461778 TACCACCTCCTATTTGATCTTGG + Intronic
975151232 4:71023338-71023360 CAGAACCCCTTAGAAGATCTTGG + Intronic
984514377 4:180720057-180720079 CACAAAGCTCTAGTTGATCATGG - Intergenic
986818008 5:11433856-11433878 CACAACCACCTATTTGAATTTGG - Intronic
992718355 5:79533596-79533618 CACAACCAACTATTTGATCAAGG + Intergenic
993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG + Intronic
994063524 5:95508522-95508544 CACAAGCCACTTGTTTATCTAGG - Intronic
1011042747 6:83048509-83048531 CAAAACCCCCTACATGATCAGGG + Intronic
1012392806 6:98762322-98762344 TCCAACCCCCTACTTCATCTCGG + Intergenic
1016184795 6:141184632-141184654 GCCAACCACCTATTTGATCTTGG - Intergenic
1025006892 7:55362570-55362592 CACTATCCCCTAGGTGATGTTGG - Intergenic
1028653860 7:93180026-93180048 CACACACCCCTCCTTGATCTAGG + Intergenic
1028847084 7:95493687-95493709 CCCAACCCCCCAGTTCTTCTTGG + Intronic
1039216445 8:35277213-35277235 CCCAACCCCCAGTTTGATCTGGG + Intronic
1040396871 8:47008944-47008966 CTCAACCCCTTAGTTGCACTTGG - Intergenic
1046585942 8:116148915-116148937 CATAAGCCCCTAGTTTAACTGGG + Intergenic
1046711154 8:117513016-117513038 CACAATCACCTCTTTGATCTTGG + Intergenic
1047094868 8:121614057-121614079 CACAACACCTTAGTTCCTCTAGG - Exonic
1055406199 9:75976234-75976256 CCCAACCCCCTACTTCATGTTGG + Intronic
1056712645 9:89003118-89003140 CACAAGCTCCTGGGTGATCTTGG - Exonic
1186885170 X:13905803-13905825 TAAAAACCCCTATTTGATCTTGG + Intronic
1193367977 X:80657868-80657890 CACAAGACCCTAGATGATTTGGG - Intergenic
1198711606 X:139510116-139510138 GACAACCACCTAATTGAGCTGGG + Intergenic
1198741338 X:139846551-139846573 CACAACCACCCAGTTGCTATAGG + Intronic
1199869555 X:151885933-151885955 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1201319901 Y:12686942-12686964 CAGAAGCCCCAAGTTTATCTTGG + Intergenic