ID: 993907222

View in Genome Browser
Species Human (GRCh38)
Location 5:93636490-93636512
Sequence CTGTGTCTTCACAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2727
Summary {0: 1, 1: 1, 2: 112, 3: 666, 4: 1947}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993907222_993907225 11 Left 993907222 5:93636490-93636512 CCTTCTTCCCTGTGAAGACACAG 0: 1
1: 1
2: 112
3: 666
4: 1947
Right 993907225 5:93636524-93636546 CTGTCTATGAAAAAGAAAGCAGG 0: 1
1: 2
2: 17
3: 137
4: 761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993907222 Original CRISPR CTGTGTCTTCACAGGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr