ID: 993907222 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:93636490-93636512 |
| Sequence | CTGTGTCTTCACAGGGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2727 | |||
| Summary | {0: 1, 1: 1, 2: 112, 3: 666, 4: 1947} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993907222_993907225 | 11 | Left | 993907222 | 5:93636490-93636512 | CCTTCTTCCCTGTGAAGACACAG | 0: 1 1: 1 2: 112 3: 666 4: 1947 |
||
| Right | 993907225 | 5:93636524-93636546 | CTGTCTATGAAAAAGAAAGCAGG | 0: 1 1: 2 2: 17 3: 137 4: 761 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993907222 | Original CRISPR | CTGTGTCTTCACAGGGAAGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||