ID: 993908347

View in Genome Browser
Species Human (GRCh38)
Location 5:93649416-93649438
Sequence GCTAGCCTGCACATGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993908347_993908354 17 Left 993908347 5:93649416-93649438 CCTTCCTGCATGTGCAGGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 993908354 5:93649456-93649478 GCTGCAATTTTATTGGCTTAAGG 0: 1
1: 0
2: 1
3: 15
4: 168
993908347_993908349 -5 Left 993908347 5:93649416-93649438 CCTTCCTGCATGTGCAGGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 993908349 5:93649434-93649456 CTAGCCAGAACCCAAGCAGAAGG 0: 1
1: 0
2: 0
3: 37
4: 208
993908347_993908356 30 Left 993908347 5:93649416-93649438 CCTTCCTGCATGTGCAGGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 993908356 5:93649469-93649491 TGGCTTAAGGTGTCAAAGGATGG No data
993908347_993908353 10 Left 993908347 5:93649416-93649438 CCTTCCTGCATGTGCAGGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 993908353 5:93649449-93649471 GCAGAAGGCTGCAATTTTATTGG 0: 1
1: 1
2: 1
3: 8
4: 141
993908347_993908355 26 Left 993908347 5:93649416-93649438 CCTTCCTGCATGTGCAGGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 993908355 5:93649465-93649487 TTATTGGCTTAAGGTGTCAAAGG 0: 1
1: 0
2: 3
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993908347 Original CRISPR GCTAGCCTGCACATGCAGGA AGG (reversed) Intronic
900470928 1:2854592-2854614 GCCAGCGTGCACAGGTAGGATGG + Intergenic
902007628 1:13244994-13245016 GCTACTCTGCACATGGAGGTGGG - Intergenic
902221204 1:14967017-14967039 ACTAGTCTGCACATGGAGGTGGG + Intronic
905208686 1:36358267-36358289 TCTCTCCTGCACACGCAGGATGG - Exonic
905690258 1:39937570-39937592 CCAAGCCTGCACATTCAGGAGGG + Intergenic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
922467588 1:225854682-225854704 TCTAGCCTGCACCTCCAGGCTGG - Intronic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1069792711 10:71033523-71033545 GCAAGCATCCACATGCAGAAAGG - Intergenic
1070381632 10:75885289-75885311 GCTGGCTGGCACATTCAGGAAGG - Intronic
1073245322 10:102086324-102086346 CCTACCCTGCACACCCAGGAAGG + Intergenic
1075198691 10:120383158-120383180 ACTGGCCTGCACTAGCAGGATGG + Intergenic
1077475906 11:2790375-2790397 GTGAGACTGCACCTGCAGGATGG - Intronic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1081750270 11:45505598-45505620 GGTTGTCTCCACATGCAGGAAGG - Intergenic
1083202933 11:61131321-61131343 GCTAGCCTGCCCATGCACTGTGG - Exonic
1092219433 12:6702732-6702754 GCTAGCGTGTGCATGCAGGGGGG + Intergenic
1092911973 12:13153505-13153527 GCGGGCCTGCAGAAGCAGGAGGG + Intergenic
1095941767 12:47732136-47732158 GAGAGCCTGCACATGCAGGCTGG - Intergenic
1097230386 12:57507499-57507521 GCCAGCCGCCCCATGCAGGAGGG - Intronic
1099967850 12:89469697-89469719 GACAGCCTCCACATGAAGGAAGG + Intronic
1103587032 12:121963612-121963634 GCCATCCTGCACATGCACGTGGG + Intronic
1104573227 12:129943722-129943744 ATTAGCCTGCACATCCAAGATGG - Intergenic
1106576893 13:30983084-30983106 GATAGACTCCACATGCAGGCTGG - Intergenic
1112135270 13:96571272-96571294 ATTTGCATGCACATGCAGGATGG - Intronic
1118839657 14:69500969-69500991 GGCAGCCTGCAGATCCAGGATGG + Intronic
1126569704 15:50137338-50137360 GTTAGCCGGCACATTCTGGAAGG + Intronic
1129933975 15:79433783-79433805 GCTAGCTTCCACCTGCAGGGCGG - Intronic
1130682578 15:86009600-86009622 GCTCCCCTGCACCTGCGGGAAGG + Intergenic
1132497418 16:270489-270511 GCCAGCCTGCAGGGGCAGGAGGG - Intronic
1134039454 16:11057277-11057299 GGCAGCTTGCACATGCAGCAAGG + Intronic
1134064826 16:11221317-11221339 ACAGGCCTGCACATGCAGCATGG + Intergenic
1144718700 17:17452652-17452674 GCAAGTCTGTACATGCAGGCAGG - Intergenic
1144966632 17:19080585-19080607 GCTAACCTGCAGATGCATCAGGG + Intergenic
1144981286 17:19171472-19171494 GCTAACCTGCAGATGCATCAGGG - Intergenic
1144986938 17:19206767-19206789 GCTAACCTGCAGATGCATCAGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1151747064 17:76017469-76017491 GCTCGCCTGATCATTCAGGAAGG - Intronic
1151787214 17:76280900-76280922 GTCACCCTGCACCTGCAGGATGG + Exonic
1155638606 18:27985106-27985128 GCAAACCTTCACACGCAGGATGG + Exonic
1156219716 18:35038983-35039005 TCTAGTCTGCTCATGAAGGAAGG - Intronic
1162234587 19:9297985-9298007 GATACCCTGCACAAGCAGAAAGG + Exonic
1164801691 19:31081956-31081978 GTTAGCCTGGGCATGGAGGATGG - Intergenic
1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG + Intronic
927055663 2:19363546-19363568 CCGAGCTTGCAAATGCAGGATGG - Intergenic
930047495 2:47185896-47185918 GCTAGCTAGTACATGCAGAAGGG - Intergenic
931757022 2:65383521-65383543 GCTACCTTTCACATGGAGGAGGG + Intronic
932606315 2:73168067-73168089 TCTAACCTGAACATCCAGGAAGG + Intergenic
933926114 2:87092375-87092397 TCTAACCTGAACATCCAGGAAGG - Intergenic
934755898 2:96824674-96824696 GTTAGCCTGCATGTGCAGGCTGG + Intronic
934758356 2:96839865-96839887 GCTGCCCTCCTCATGCAGGAAGG + Intronic
935013992 2:99162382-99162404 GGTAGCCTGCACATCCAGCTGGG - Exonic
946156517 2:217810163-217810185 TCCAGCCTGCACGTGCAGGAGGG + Intronic
949020586 2:241739020-241739042 GCACGCCTGCACTGGCAGGAAGG + Intronic
949032542 2:241803921-241803943 GCGAGCCTGTGCCTGCAGGACGG + Exonic
1168732954 20:103378-103400 GCTAGCCTACAAATCCATGAGGG - Intergenic
1170538462 20:17364841-17364863 GCTGGGCTGCACATCCATGATGG + Intronic
1172449287 20:35010432-35010454 TCCAGCCAGCACCTGCAGGAGGG + Intronic
1175331606 20:58168446-58168468 GCTGGTCTGCAGATACAGGATGG - Intergenic
1175545132 20:59773165-59773187 GCTCCCCTGCACCTCCAGGAGGG - Intronic
1179285016 21:39969776-39969798 CCCAGCCTTCACATTCAGGAGGG - Intergenic
1184330023 22:43821458-43821480 GCCAGGCTGCACTTGTAGGAAGG + Intergenic
1184550914 22:45203736-45203758 GCTACCATGCACAAGCAGGCTGG + Intronic
951182049 3:19669866-19669888 GAAAGCCTTCACATGGAGGATGG + Intergenic
952843311 3:37666482-37666504 GGTTGCCTGCAGATGCAAGAGGG - Intronic
954427046 3:50448916-50448938 GCTCTCCCCCACATGCAGGAGGG - Intronic
957828597 3:85485521-85485543 GGCAGACTGCGCATGCAGGATGG - Intronic
959016833 3:101144211-101144233 GCTAGCTTGAAGATGGAGGAAGG + Intergenic
967841674 3:194010032-194010054 GGAAGCCTTCACATGAAGGATGG + Intergenic
969042761 4:4313699-4313721 GCCAGCCTGCACACACAGCAGGG - Intronic
969923136 4:10559580-10559602 GCTAGCCTGGTCATGGAGGCAGG + Intronic
982051648 4:151508325-151508347 ACTAGGCTGCACATGAAGGCAGG - Intronic
984316963 4:178140802-178140824 GTTTGCCTACACTTGCAGGATGG + Intergenic
986533435 5:8762100-8762122 GCCAGCCTGCAAATGCAGCCTGG + Intergenic
988614692 5:32764163-32764185 CCTAAACTGCACATGCACGAAGG - Intronic
989205298 5:38804079-38804101 CCCAGCTTCCACATGCAGGAAGG + Intergenic
990632214 5:57682758-57682780 ACTTGCCTGCTCATCCAGGACGG - Intergenic
991172421 5:63644219-63644241 GCCTGCCTGCAAATGCATGACGG - Intergenic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
994097025 5:95856656-95856678 GCTTCCCTGCTCCTGCAGGAAGG + Intronic
998040293 5:138947184-138947206 GCCAGCCTGGAGCTGCAGGATGG - Exonic
998549708 5:143065704-143065726 ACCAGGCTGCACTTGCAGGAAGG - Intronic
999578493 5:153007610-153007632 GCTTGTCTTCACATGAAGGAAGG - Intergenic
1002847681 6:962399-962421 GGAAGCATGCACCTGCAGGAAGG - Intergenic
1003224180 6:4189765-4189787 GCCAGCATGCCCATGCAGGTGGG + Intergenic
1013781452 6:113732913-113732935 GTTTGTCTGCACAGGCAGGATGG + Intergenic
1015330538 6:131973727-131973749 GATATCCTGCAAATGAAGGAGGG - Intergenic
1015650274 6:135449802-135449824 GCTACCCTGCACTTGAAGTATGG + Intronic
1016736516 6:147485684-147485706 GCTAGTCTGAAAAAGCAGGAGGG + Intergenic
1016907989 6:149170089-149170111 GCTTGCCAGCACATGAAGGGAGG - Intergenic
1018047473 6:159978373-159978395 CCAAGCCACCACATGCAGGAGGG - Intronic
1021367013 7:19792097-19792119 GGCAGACTGCACATGCAGGATGG - Intergenic
1024054520 7:45651376-45651398 CCTGCCTTGCACATGCAGGATGG + Intronic
1024244455 7:47458676-47458698 GCAAGCCTGCACCTGCGGGAAGG - Intronic
1027762181 7:82293415-82293437 GCAAACCTGCCCATGCAGAATGG - Intronic
1029899894 7:104028105-104028127 GCTTAACTGCAAATGCAGGATGG + Intergenic
1032679262 7:134165344-134165366 GCCAGCCTGCACATAGAGAATGG + Intronic
1033655082 7:143367803-143367825 GTTGACCTGCCCATGCAGGAGGG - Intergenic
1036419829 8:8585342-8585364 GCCTGCCTGCACTTCCAGGAGGG - Intergenic
1037602131 8:20406117-20406139 GCTTGGCTGCACTTGCAGGTGGG + Intergenic
1045194329 8:99914861-99914883 GGCAGCCTGCATCTGCAGGAAGG - Intergenic
1046183475 8:110683122-110683144 GCTGGCTTTGACATGCAGGAAGG + Intergenic
1046756534 8:117978385-117978407 GAAAGCCTGCAGATGGAGGATGG - Intronic
1047990075 8:130276981-130277003 GCTAGGCTGCACATGGACAAGGG - Intronic
1049411654 8:142476324-142476346 GCCAGCGTTCACCTGCAGGACGG - Intronic
1049801522 8:144519946-144519968 GCTAGGCCGCTCCTGCAGGAGGG - Exonic
1056369209 9:85937356-85937378 GGGAGCCTGCACAGGAAGGAGGG + Intergenic
1057239254 9:93393465-93393487 GCTTGCCTACCCTTGCAGGACGG - Intergenic
1060304269 9:122396812-122396834 TCTAGCCTGTATAAGCAGGAAGG + Intergenic
1061053323 9:128208680-128208702 GCAAGCCTCCCCAAGCAGGATGG - Intronic
1061290196 9:129646411-129646433 ACGAGTCTGGACATGCAGGAGGG + Intergenic
1187896005 X:23980240-23980262 GCAAGGCTTCACATGCAGGCAGG + Intergenic
1187985636 X:24807786-24807808 GCCAGTCAGCTCATGCAGGAAGG + Intronic
1188988777 X:36791787-36791809 GCTGGCCTGCATAGGCAGGGTGG - Intergenic
1189278218 X:39802806-39802828 GCTGGCCTTCACATTCGGGAAGG - Intergenic
1190850964 X:54241178-54241200 GCTAGTCTCCAAATGTAGGAGGG - Intronic