ID: 993914119

View in Genome Browser
Species Human (GRCh38)
Location 5:93720924-93720946
Sequence CAGAATATACACATGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993914119_993914122 -6 Left 993914119 5:93720924-93720946 CCCACCTTCATGTGTATATTCTG 0: 1
1: 0
2: 2
3: 14
4: 183
Right 993914122 5:93720941-93720963 ATTCTGCTTCTGAAATAAAATGG 0: 1
1: 0
2: 3
3: 39
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993914119 Original CRISPR CAGAATATACACATGAAGGT GGG (reversed) Intronic
901551981 1:10002265-10002287 GAGCATATACACCTGAAGGTAGG - Intronic
903801026 1:25968315-25968337 CTGATTATACACAGGAAGGTGGG + Intronic
904352341 1:29916886-29916908 CAAAATCAATACATGAAGGTGGG - Intergenic
904749790 1:32734475-32734497 TAGAATATACATATGTAGGCCGG + Intergenic
905612861 1:39370169-39370191 CAGATTGAACACCTGAAGGTAGG + Exonic
908317484 1:62947388-62947410 CAGAAAATAAAAATGAAGGGTGG - Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
915793483 1:158701320-158701342 AAGAATATACATATGAAGAGAGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917068648 1:171125183-171125205 ATAAATATATACATGAAGGTGGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
922513650 1:226190106-226190128 TAGAATATACCTAGGAAGGTAGG + Intergenic
1063168505 10:3485151-3485173 CAAAATATACCCTGGAAGGTTGG - Intergenic
1064569744 10:16680282-16680304 CAGAATGTACACGTGAAGCCTGG + Intronic
1067540239 10:47145516-47145538 CAGCATACACACATGTGGGTTGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1072933884 10:99693327-99693349 CAGAATATCCACAGGACTGTTGG + Intronic
1074036337 10:109742794-109742816 CAGAGTGTACATATGCAGGTTGG + Intergenic
1074329950 10:112496266-112496288 AAGTATTTACATATGAAGGTTGG + Intronic
1077003652 11:338933-338955 CAGAATATACAAACAAAGGAAGG - Intergenic
1078606742 11:12783922-12783944 CAGCATATACACAGGAAGGGGGG + Intronic
1079982587 11:27166899-27166921 CAGACTATTCACATGATGGCTGG + Intergenic
1080758955 11:35229304-35229326 CAGAATGTGGACATGAAGATTGG + Exonic
1082899524 11:58230529-58230551 CAGAACATATACTTTAAGGTTGG + Intergenic
1084884037 11:72191773-72191795 CAGAATATACACTTGATTATTGG + Intronic
1084993627 11:72954075-72954097 CAGAGAATAGACATAAAGGTAGG + Intronic
1085437564 11:76522098-76522120 CAGAATTTACAACTGAAGGTTGG + Intronic
1085991564 11:81852978-81853000 AAGAAAATGCACATGAAGCTGGG + Intergenic
1086743359 11:90395549-90395571 CAGAGTATACACATGAAGGGTGG - Intergenic
1090760534 11:129833338-129833360 CAACATATACACTTGGAGGTGGG - Intronic
1093196043 12:16130510-16130532 CATTAAATACACATGAGGGTTGG - Intergenic
1093534688 12:20209643-20209665 CAGTATATACCCATGAAGCAAGG - Intergenic
1093869268 12:24267297-24267319 CAAAATATAAACATGATGTTTGG - Intergenic
1094050071 12:26209703-26209725 CAAAACAAACACATGAAGGAAGG - Intronic
1094114067 12:26891098-26891120 TAGGATATACAATTGAAGGTTGG + Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099329901 12:81270961-81270983 CAGAATATAAACTTTAAGGCAGG - Intronic
1099840626 12:87960780-87960802 CAGATTATACACAGCAAGGCAGG - Intergenic
1100576231 12:95893775-95893797 TAGAAAATACACAAGAAGGTGGG - Intronic
1100758808 12:97782663-97782685 CATGATAAACACATGAAGGCTGG + Intergenic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1102909720 12:116703636-116703658 CAGAATAAAGACATGGGGGTGGG + Intergenic
1102944954 12:116978606-116978628 CACAATAAACACCTGAAGCTTGG - Intronic
1107382299 13:39869666-39869688 CAGTATATACACATTTTGGTAGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111617726 13:90682662-90682684 CACAATAAACCCATGATGGTAGG + Intergenic
1113155950 13:107322144-107322166 GAGCATATACAAAAGAAGGTTGG - Intronic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1117209872 14:53484294-53484316 CAGATTTTACACATGAATTTTGG + Intergenic
1118013341 14:61632472-61632494 TGGAATATAGACATGAAGGCTGG + Intronic
1118220291 14:63849654-63849676 AAGTATAAACACATGAGGGTGGG + Intergenic
1118285900 14:64472004-64472026 CGGATTATAAGCATGAAGGTAGG - Exonic
1118565415 14:67135332-67135354 CAGAACATAGACTTCAAGGTAGG - Intronic
1122064962 14:99166477-99166499 CAGAGAATGCACATGGAGGTTGG - Intergenic
1124018784 15:25901568-25901590 CAGAGTATGTACATGAGGGTGGG - Intergenic
1124228498 15:27918430-27918452 CCAAATAAAAACATGAAGGTTGG + Intronic
1124477343 15:30045914-30045936 CAGAATATTTACATAAAGCTGGG - Intergenic
1125128167 15:36249212-36249234 AAGAATATACAGAAGAAGATAGG - Intergenic
1125195130 15:37037546-37037568 AAAAAGATACACATCAAGGTAGG + Intronic
1130226671 15:82064267-82064289 CACAATAAAAACATAAAGGTGGG - Intergenic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1138787516 16:59864755-59864777 CAGGTTTTACACAGGAAGGTAGG + Intergenic
1138806961 16:60101171-60101193 AAGAATAAACAAATGAAGATTGG - Intergenic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1143761323 17:9106084-9106106 CAGAATCTGCACATCAAAGTTGG + Intronic
1144059782 17:11572872-11572894 CACAATACTCACATGATGGTTGG + Intergenic
1145734437 17:27217323-27217345 CAGATTATAAAAATGAAGATAGG + Intergenic
1146654629 17:34627804-34627826 CAGCATTTAAACTTGAAGGTAGG - Intronic
1146820597 17:35981206-35981228 CAGAAGCTATGCATGAAGGTGGG + Intronic
1147715332 17:42503178-42503200 CAAAATACAGACATGAAAGTGGG - Intronic
1150372390 17:64651276-64651298 AAAAATATACACATAAAGCTGGG + Intronic
1152078510 17:78172555-78172577 CAGAATATTTACATAAAGCTGGG - Exonic
1153287825 18:3472617-3472639 CATATTTTACAAATGAAGGTTGG + Intergenic
1155335460 18:24760099-24760121 CAGAATATATACATGAATTAGGG - Intergenic
1156408444 18:36805369-36805391 AGGACGATACACATGAAGGTAGG - Exonic
1157779407 18:50424124-50424146 TATAAGATACACTTGAAGGTTGG - Intergenic
1158028304 18:52930259-52930281 CACAATATAAAGCTGAAGGTTGG - Intronic
1158371172 18:56806207-56806229 AAGAAAATAAAAATGAAGGTAGG - Intronic
1163380024 19:16959833-16959855 AAGAAGATACACATGCAGGCCGG - Intronic
1168118322 19:54238576-54238598 CAGATTGAACACATGAGGGTGGG + Exonic
925770446 2:7277228-7277250 CATAAAATACACATGAAGAATGG + Intergenic
926915201 2:17884599-17884621 CAGACCATACACATAAAGCTTGG + Intronic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
929619172 2:43336896-43336918 CAGAGTATACTCATCAAGGGAGG + Intronic
929968396 2:46552526-46552548 GAGAATATTCAGATGAAGGAGGG - Intronic
930675323 2:54194950-54194972 ATGAATATTCAAATGAAGGTAGG + Intronic
931585108 2:63817493-63817515 CTGAAATTACACATTAAGGTAGG + Intronic
933556906 2:83841986-83842008 CAGCATATAGACATGCAGTTGGG - Intergenic
933701656 2:85259337-85259359 AAGATAATACAAATGAAGGTTGG - Intronic
935396256 2:102612394-102612416 CTGAATATATATTTGAAGGTAGG - Intergenic
937609232 2:123840320-123840342 CAATATATGCCCATGAAGGTTGG - Intergenic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
940764759 2:157778300-157778322 CAGAATTTCCACTTGGAGGTTGG - Exonic
940930602 2:159425032-159425054 CACAATAGATACATGAAGCTTGG + Intronic
940973956 2:159922947-159922969 CTGAACATAGGCATGAAGGTGGG - Intergenic
947106307 2:226671399-226671421 CAGAATATTAACAAGCAGGTGGG + Intergenic
948749862 2:240125329-240125351 CTGAAGATACACAAGAAAGTGGG - Intergenic
1169618748 20:7480491-7480513 CAGGATAAACACTTGAACGTAGG - Intergenic
1172672650 20:36644989-36645011 CACAAAATACACATGATGGCAGG - Intronic
1172990227 20:39030415-39030437 CAGAAGATACACATAAACATAGG + Intronic
1174432052 20:50477438-50477460 TAGAATATAAACATGATGGCTGG + Intergenic
1177022924 21:15885565-15885587 CAGCATATACACCTAAAGGGTGG + Intergenic
1177194307 21:17886518-17886540 GTGAATTTACACATGAAAGTAGG - Intergenic
1177608427 21:23413146-23413168 CAGAATTTTCACATGAAAATTGG - Intergenic
1178717303 21:34977607-34977629 CAACATATACACATGGAAGTGGG + Intronic
1178726697 21:35058801-35058823 GAGAATATAAAACTGAAGGTGGG + Intronic
1179298345 21:40083059-40083081 CAGAAGATACACAGGAAAGAGGG - Intronic
1179526523 21:41980601-41980623 TAAAAAATACACATGAATGTTGG + Intergenic
1182634967 22:31718680-31718702 CACACTATACACATGAACATGGG + Intronic
949499241 3:4663189-4663211 CAGAATATTCTCAAGCAGGTCGG + Exonic
953669015 3:44947078-44947100 CTGAATCTACAAATGATGGTAGG + Intronic
955041832 3:55324794-55324816 CAGAATAACCATATGAAGATAGG - Intergenic
955366805 3:58317707-58317729 CAGCATATGCACATCAAAGTTGG + Exonic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956738749 3:72258823-72258845 CAGAAGGTACACAGGAAGGGAGG + Intergenic
956759337 3:72424993-72425015 CAAAATATATACATGAATCTAGG + Intronic
959502324 3:107120676-107120698 CAAAGTATACACATGAAAGTTGG + Intergenic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960143626 3:114174997-114175019 GAGATTATATACATGAAGTTTGG + Intronic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
960988327 3:123294851-123294873 CAGAAAATACATATGGCGGTGGG + Intronic
961571238 3:127800521-127800543 TAGAATATACACAATAAAGTTGG + Intronic
963522787 3:146376854-146376876 GAGAATAGACAAATAAAGGTGGG + Intergenic
964326799 3:155555694-155555716 AAGAAAAGACACATGGAGGTGGG - Intronic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
970812975 4:20117449-20117471 CAAGATATACACATCAAAGTTGG + Intergenic
971697674 4:29927761-29927783 CAGATAATATACAAGAAGGTAGG + Intergenic
973085208 4:46050462-46050484 CATTATATATACATTAAGGTAGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978082299 4:104608334-104608356 CTGAGTATGCACAAGAAGGTGGG - Intergenic
979276913 4:118824581-118824603 GAGAATATACAAACGAAGGTTGG + Intronic
979586207 4:122420762-122420784 CATAATATACACATACAGGAAGG + Intronic
979681851 4:123468790-123468812 TAGAATGTACACTTGATGGTCGG + Intergenic
979936411 4:126702791-126702813 CAGAATGTCCACCTGAAGGTGGG + Intergenic
980327297 4:131363610-131363632 GAGCAGATACATATGAAGGTAGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981614353 4:146631497-146631519 GAGAATAAAAACATGCAGGTGGG + Intergenic
983537416 4:168873059-168873081 AAGAATTTTCAAATGAAGGTAGG - Intronic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
988426421 5:31070669-31070691 GAGACTATACACATGAAGGAAGG + Intergenic
988828049 5:34960091-34960113 CAGAATATACACTTGAATGAAGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991625047 5:68592536-68592558 CACAATATACCCAGGAAGCTAGG - Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992405699 5:76455565-76455587 CAGGATCTACACATGAAAGAGGG - Intronic
992858616 5:80889827-80889849 CAGAATATACACTTGAAGCTCGG - Intergenic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
993971910 5:94429941-94429963 CAGAATCTGCACAGGAAGGGTGG + Intronic
995100157 5:108291197-108291219 CAGAATATAATCAATAAGGTGGG - Intronic
999681732 5:154066695-154066717 TAGAATATATACAGGAAGGGAGG - Intronic
1000164419 5:158634032-158634054 GAGAATATTAACCTGAAGGTGGG - Intergenic
1000420459 5:161032797-161032819 AAGAATATTCTCATGAAGGCTGG - Intergenic
1001102971 5:168829368-168829390 AAGAATACCCACAGGAAGGTTGG - Intronic
1004712309 6:18183805-18183827 GAGAATACACACACCAAGGTAGG - Intronic
1004733253 6:18379842-18379864 CAGATTAAACACATGACCGTGGG - Intergenic
1004885612 6:20049120-20049142 CAGCCTGCACACATGAAGGTAGG - Intergenic
1005658955 6:27974298-27974320 CAAAATAAACACATGAAATTTGG - Intergenic
1005713731 6:28526753-28526775 CAGAAAATAATCATGAAGTTAGG + Intronic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1011811941 6:91142235-91142257 TTGAAAATACACATGGAGGTCGG + Intergenic
1014302613 6:119701312-119701334 CAGAACTTACACTTGGAGGTAGG + Intergenic
1017157110 6:151332375-151332397 CTGAATATACCCAAGAAGGAGGG - Intronic
1027854782 7:83496835-83496857 CAGAAAATATACAGGAAGATGGG + Intronic
1028883223 7:95903581-95903603 CAGAATATTCACATGACAGTTGG - Intronic
1029342633 7:99957334-99957356 CATAATATTCACAGGAAGGGAGG - Intergenic
1030399222 7:109027672-109027694 CCCAATATACACATAAAGCTGGG + Intergenic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031500576 7:122509804-122509826 CAGAATAAGCCCGTGAAGGTAGG - Intronic
1031522565 7:122784442-122784464 CAGAATAGAGACTTCAAGGTGGG - Intronic
1031638031 7:124125864-124125886 AAAAATATAAACATGAAGGAGGG - Intergenic
1034464576 7:151219059-151219081 CAGATTGCACACATGAAGGTAGG - Exonic
1038114769 8:24541127-24541149 CAGAATACACATCTGAAGATTGG - Intergenic
1039145872 8:34446412-34446434 CACCATATACAAATGAAGTTTGG + Intergenic
1039304761 8:36249507-36249529 CAGTTTATACACAGAAAGGTAGG + Intergenic
1039894692 8:41708437-41708459 CAGAATGCACTCCTGAAGGTAGG + Intronic
1041562693 8:59238051-59238073 CAGACTATACAGAGGAAGTTAGG + Intergenic
1041817479 8:61991352-61991374 TTGAATATACACATAAAAGTGGG + Intergenic
1045838549 8:106552386-106552408 CAGAATATTCATATAGAGGTGGG - Intronic
1046706568 8:117459940-117459962 CAGAATAGAGACAAGAAGATTGG - Intergenic
1048803139 8:138213154-138213176 CAGCATTTTCACATGAAGGCAGG - Intronic
1049130018 8:140830674-140830696 CAGTATATTCACAGGAAGGATGG + Intronic
1050186923 9:2984431-2984453 GAGAAGATAGCCATGAAGGTGGG - Intergenic
1051073635 9:13204140-13204162 AAGTATATTCACATGAAGGGAGG + Intronic
1054942896 9:70763211-70763233 AAGAATATACACATTTAGGCTGG + Intronic
1056405881 9:86274639-86274661 CAGGAAAAACACCTGAAGGTTGG - Intronic
1058184266 9:101835808-101835830 CCGGATATGCACATGAAGGCAGG - Intergenic
1060776232 9:126376807-126376829 CAGAAGATACACCTGAAACTGGG + Intronic
1061380091 9:130250755-130250777 CAAAATATAAACCTGAAGGAAGG - Intergenic
1189092469 X:38100887-38100909 CAGAATATACATATCAGTGTTGG + Intronic
1190289726 X:48984235-48984257 TAGAATACAAACATGATGGTCGG + Intronic
1192603019 X:72485031-72485053 ACGCATATACCCATGAAGGTTGG - Intronic
1196574659 X:117304008-117304030 CAGAAAATAGACATGCATGTGGG + Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1198186621 X:134259614-134259636 GGGAATATACACATGAGGCTGGG - Intergenic
1198975498 X:142331471-142331493 CAGAATTTACCAATGAAGGAAGG - Intergenic
1199608504 X:149594854-149594876 CAGAATGTGCACATGCAGATGGG - Intergenic
1199630618 X:149774506-149774528 CAGAATGTGCACATGCAGATGGG + Exonic