ID: 993914947

View in Genome Browser
Species Human (GRCh38)
Location 5:93732905-93732927
Sequence ATAAATGTATGTACAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993914947_993914949 13 Left 993914947 5:93732905-93732927 CCAATACCTGTACATACATTTAT 0: 1
1: 0
2: 3
3: 26
4: 348
Right 993914949 5:93732941-93732963 TGTAATATATCTTCTAAAAATGG 0: 1
1: 2
2: 6
3: 52
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993914947 Original CRISPR ATAAATGTATGTACAGGTAT TGG (reversed) Intronic
900978209 1:6030645-6030667 GTATATGTATGTACGTGTATGGG + Intronic
901573388 1:10180134-10180156 TTAAATATATGTACAGGAAGCGG - Exonic
901723815 1:11223448-11223470 AGAAATGTATGTACATGTGTCGG + Intronic
907493352 1:54825358-54825380 ATATATGCATCTACAGGTAAAGG - Intronic
907560061 1:55380055-55380077 ATAAATGAATGCACAGGTTTTGG + Intergenic
908908508 1:69044831-69044853 ATATATGTATGGAGATGTATGGG + Intergenic
909198228 1:72654202-72654224 ATACATTTATTTACAGATATTGG + Intergenic
909747789 1:79120446-79120468 ATAAATTTTTGGACAGATATAGG + Intergenic
909937027 1:81563791-81563813 ATACATGTTTGTACAGGAAGAGG - Intronic
910849808 1:91639055-91639077 ATAAATGTATGTACATTATTGGG + Intergenic
911335597 1:96576457-96576479 ATAAATGTAGAAACAGGTATAGG + Intergenic
912653412 1:111462521-111462543 ATAAATCCTTGTACAAGTATGGG - Exonic
916100722 1:161390952-161390974 ATTAATATATATACATGTATGGG - Intergenic
916979502 1:170117908-170117930 ATAAATATAAGTACATGTCTAGG + Intergenic
918650189 1:186953020-186953042 AAAAATCTATGTACATGTTTTGG + Intronic
922394134 1:225178572-225178594 ATAAATGGGGGTACAGGCATCGG - Intronic
922944802 1:229503976-229503998 ATAAATGTATATATATATATTGG - Intronic
923356234 1:233158496-233158518 ATAGATACAGGTACAGGTATAGG + Intronic
923422749 1:233835175-233835197 ATAAATGTATAGGCAGATATAGG - Intergenic
923461295 1:234211661-234211683 ATAAATGGGGGTACAGGCATTGG - Intronic
924430626 1:243993717-243993739 ATAAATGAAAGCACAGGTCTTGG - Intergenic
1065673996 10:28154813-28154835 ATAAATGTATGTAGAAATTTGGG - Intronic
1065752694 10:28901800-28901822 ATATATGTATATATATGTATTGG - Intergenic
1066215989 10:33288151-33288173 TCAAATGTATGTCCAGGTATTGG + Intronic
1066276318 10:33871962-33871984 TTAAATGTAACTACAGATATTGG + Intergenic
1069030240 10:63588577-63588599 ATAAATGTATGTTGATGGATTGG - Intronic
1070713693 10:78702225-78702247 GTATATGTATGTACATGTGTGGG - Intergenic
1070743497 10:78918141-78918163 ATATATGTATACACATGTATAGG - Intergenic
1071131597 10:82399896-82399918 ATAAATTTATCTACAGAAATAGG + Intronic
1071182253 10:83000607-83000629 TTAGATGTATGTACATATATGGG + Intergenic
1071791039 10:88954233-88954255 ATATATGTATGTATATGTGTGGG - Intronic
1072531348 10:96322355-96322377 AAAAATGTATGTCCAAATATTGG - Intronic
1073878663 10:107953777-107953799 AGAAATGTATGCCCAGGAATTGG - Intergenic
1074212109 10:111344775-111344797 AAAAATGCATTTACAGGTAAAGG - Intergenic
1075985003 10:126777492-126777514 ATGAATGAATGAACAGGGATGGG + Intergenic
1076227043 10:128786353-128786375 ATAAATGCATGCACATGTACTGG + Intergenic
1077846925 11:6035386-6035408 ATAAAAATATTTACATGTATTGG - Intergenic
1077994957 11:7445245-7445267 ATACATGTATGTACAAGAAAAGG + Intronic
1079157696 11:17963716-17963738 ATAAATTAATGTACATATATCGG - Intronic
1079433246 11:20417835-20417857 ACAAAGATGTGTACAGGTATGGG - Intronic
1079879123 11:25901852-25901874 ATATATGTACATACATGTATAGG - Intergenic
1080174744 11:29349102-29349124 AAAAATGTTGGTACAAGTATAGG + Intergenic
1081078281 11:38703874-38703896 ATAAAGGTATGTAGAAGCATGGG - Intergenic
1082660727 11:55907710-55907732 ATTAATGTATTTACAGTTTTTGG + Intergenic
1082753528 11:57048292-57048314 ATATATATATGTATAGATATTGG - Intergenic
1084767262 11:71320824-71320846 AGAAATGTATGTACAGGATCGGG - Intergenic
1085137366 11:74104498-74104520 AAATGTGTATGTACATGTATGGG + Intronic
1088583016 11:111333582-111333604 ATACATGTATGTAAACGTATAGG + Intergenic
1091580212 12:1782276-1782298 ATATATGTAAGCACAGCTATGGG - Intronic
1093313413 12:17619286-17619308 ATATATGTATGGCCAGGTAATGG - Intergenic
1093354146 12:18142917-18142939 AGAATTGTATGAACAAGTATAGG - Intronic
1094327192 12:29253467-29253489 ATATATCTATGTATATGTATTGG + Intronic
1095579262 12:43777572-43777594 ATAAATATATATTCAGCTATAGG - Intronic
1097540790 12:60939478-60939500 ATATATGTATGTATATATATGGG - Intergenic
1097926182 12:65129940-65129962 ATAAATATAGGTATTGGTATAGG + Intergenic
1099446528 12:82759287-82759309 ACAAAAGCATGTGCAGGTATTGG - Intronic
1099725591 12:86423562-86423584 ATAAATGTATGTGTGTGTATAGG + Intronic
1100020558 12:90064259-90064281 ATAAATGGATGTATATGTGTAGG + Intergenic
1100654904 12:96632792-96632814 TTGAATGTATGTATTGGTATAGG + Intronic
1101343300 12:103862052-103862074 GGAAATGGATGAACAGGTATAGG + Intergenic
1102367546 12:112352043-112352065 ATAAATGCATATGCAGTTATAGG + Intronic
1102732789 12:115127862-115127884 ATAAATGTAAGTACAAAGATAGG - Intergenic
1102811859 12:115831248-115831270 ATAAATAGATGTACATGCATTGG + Intergenic
1103225688 12:119285339-119285361 ATAAATGGAGGTACAGTTCTTGG - Intergenic
1103325654 12:120118159-120118181 ATATATGTTTGTACAGGCAAAGG - Intergenic
1105035196 12:132914722-132914744 ATTAATCTGTGTACAGGTTTTGG + Intronic
1105666674 13:22566406-22566428 ATATATGTGTCTACAGTTATGGG + Intergenic
1106252195 13:27990719-27990741 ATAGGTATATGTATAGGTATAGG + Intergenic
1106252218 13:27990869-27990891 ATAGGTATATGTATAGGTATAGG + Intergenic
1106252221 13:27990899-27990921 ATAGGTATATGTATAGGTATAGG + Intergenic
1106252227 13:27990959-27990981 ATATGTATATGTATAGGTATAGG + Intergenic
1106252235 13:27991043-27991065 ATATGTATATGTATAGGTATAGG + Intergenic
1106252237 13:27991061-27991083 ATAGGTATATGTATAGGTATAGG + Intergenic
1106252250 13:27991199-27991221 ATATGTATATGTATAGGTATAGG + Intergenic
1106252252 13:27991223-27991245 ATATGTATATGTATAGGTATAGG + Intergenic
1106252258 13:27991283-27991305 ATATATATAGGTATAGGTATAGG + Intergenic
1106252262 13:27991319-27991341 ATAGGTGTAGGTATAGGTATAGG + Intergenic
1106340428 13:28821523-28821545 ATAAATGTGAGTACTGGTTTTGG - Intronic
1107732613 13:43363824-43363846 ATAAATATATGTCCAGAAATGGG + Intronic
1107819553 13:44273902-44273924 AGCAATGAATGTGCAGGTATGGG - Intergenic
1109577377 13:64278912-64278934 ATAAATCCATGTACTGATATAGG - Intergenic
1110163725 13:72411319-72411341 ATATATGTTTGTATAGGAATAGG + Intergenic
1110911350 13:80969107-80969129 ATACATATATGTATATGTATAGG - Intergenic
1111184329 13:84711648-84711670 ATAAATGGATGTGTAGATATGGG + Intergenic
1111189089 13:84785610-84785632 ATATGTGTATATACATGTATAGG + Intergenic
1111976500 13:94971716-94971738 ATAGATGTCTGTCCTGGTATAGG + Intergenic
1112522197 13:100106380-100106402 ATAAATGTATGTAACTGTCTGGG + Intronic
1114604302 14:23984161-23984183 AAAAATGCATGTAAATGTATAGG + Intronic
1116550011 14:46225408-46225430 ATAAGTGAATGTAAAGGTGTGGG - Intergenic
1116643338 14:47494286-47494308 AGAAATGTTTGTGCAGGGATTGG + Intronic
1116782263 14:49249870-49249892 ACAAATAAATATACAGGTATTGG - Intergenic
1117250216 14:53929260-53929282 ATACATGTATATATAGATATAGG - Intergenic
1118140892 14:63081020-63081042 ATAAATGTGTATACATATATAGG + Intronic
1118179888 14:63481976-63481998 ATATATGTATTTAAAGGTACTGG - Intronic
1120680203 14:87471936-87471958 ACAAATGTATGTTCAAGCATAGG - Intergenic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1121818662 14:96947847-96947869 ATAAATCTATGTACATATTTTGG + Intergenic
1124450547 15:29785350-29785372 ATAATTATATGTAAAGGAATGGG - Intronic
1125851804 15:42911232-42911254 AGGAATGTATGTACGGGAATGGG - Intronic
1126445546 15:48739687-48739709 AGAAGTGTATGTGTAGGTATTGG - Intronic
1126614626 15:50564403-50564425 ATAAACATATTTATAGGTATGGG + Intronic
1126761007 15:51970141-51970163 ATAAATTCATGTACATGTTTGGG - Intronic
1126896494 15:53263150-53263172 ATAAATGTGTAGATAGGTATGGG + Intergenic
1127950601 15:63801808-63801830 AAAAATGTATGTACATGAAGAGG - Intronic
1128315882 15:66659095-66659117 ATGAGTGTATGTACATGTGTGGG + Intronic
1128378104 15:67091534-67091556 AGAAATGAAAGTACAGGGATTGG + Intronic
1128570939 15:68732418-68732440 TTAAATGTATGTAAAGGTTTAGG + Intergenic
1129095082 15:73197968-73197990 ATAAAAGCATGGACAGGCATGGG - Intronic
1129529028 15:76246982-76247004 ATAAAAGTATGTAGATATATAGG - Intronic
1129762257 15:78136650-78136672 TTAAATGTATGAACAGGTCCAGG - Intronic
1130584203 15:85167785-85167807 ATATATGAATTTACAGATATGGG + Intergenic
1130762060 15:86831448-86831470 TACAATGTGTGTACAGGTATTGG + Intronic
1131723201 15:95194396-95194418 AGAAAAATATGCACAGGTATTGG - Intergenic
1133926825 16:10200038-10200060 ATAAATGAAAGTAAAGGCATGGG - Intergenic
1135181006 16:20274493-20274515 ATAGATGCATGCACAGGTTTTGG + Intergenic
1135894885 16:26390509-26390531 ATAGATGAATGATCAGGTATGGG - Intergenic
1137925511 16:52537146-52537168 ATATATGTGTGTATAGGTAGAGG - Intronic
1137947270 16:52746008-52746030 ATATATGTGGGTACAGGTTTTGG - Intergenic
1138897971 16:61231846-61231868 ATAAATGTATATACAGTTATAGG + Intergenic
1139813567 16:69645651-69645673 AAAACTGTATGTGCAGTTATTGG - Intronic
1140017595 16:71203048-71203070 AAAAATGAATTTAAAGGTATTGG + Intronic
1140299963 16:73747655-73747677 ATAGATATAAGTATAGGTATAGG + Intergenic
1142728318 17:1832357-1832379 ATAAGTGAATGAACAGGAATTGG - Intronic
1147293705 17:39463578-39463600 ATGAATAAATGTACAGGTTTGGG - Intronic
1147961114 17:44168152-44168174 AAAAATGAAAGGACAGGTATTGG + Intergenic
1148295504 17:46498909-46498931 ATATATGTATATACATGTAGAGG + Intergenic
1149339593 17:55671978-55672000 ATAAATGGGGGTACAGGCATTGG + Intergenic
1149652849 17:58288082-58288104 ATGAATGAATGTACTGGGATAGG - Intergenic
1151090661 17:71436541-71436563 ATGAATGTATGTACATCTTTAGG + Intergenic
1154043912 18:10886307-10886329 ATATATGTATGTATAGGGTTTGG - Intronic
1155869970 18:31015170-31015192 ATAAATGTATATAAATGTATTGG + Intronic
1156151334 18:34246890-34246912 ACAAATGTATGCACAGTCATTGG - Intergenic
1156367685 18:36445065-36445087 ATCTATGTATGTCCAGGTAGAGG + Intronic
1157072438 18:44423654-44423676 ATAAATGTATTTACAAGGAAGGG + Intergenic
1157430783 18:47623768-47623790 CTAAATGTATGTACACCTAACGG + Intergenic
1157538496 18:48480465-48480487 ATTAATGTATTTACAGCTAATGG + Intergenic
1157894456 18:51450868-51450890 ATACATATATGTACATATATAGG - Intergenic
1159430539 18:68346983-68347005 ATATAAGTATGTATAAGTATAGG + Intergenic
1163608066 19:18286631-18286653 ATAAATGGAAGGACAGGAATGGG - Intergenic
1163952363 19:20601505-20601527 ACATATGTATGTATAGGTAAAGG - Intronic
1166649288 19:44559197-44559219 ATAAATGTATATACATTTATAGG + Intergenic
1166649289 19:44559248-44559270 ATAAATGTATATACATTTATAGG + Intergenic
1166649290 19:44559299-44559321 ATAAATGTATATACATTTATAGG + Intergenic
925720135 2:6819528-6819550 ATACATGTATGCACACATATAGG + Intergenic
928569557 2:32590590-32590612 ATAATTGAATGTTGAGGTATGGG + Intronic
928901671 2:36324629-36324651 AAAAATGTATGTAAAGTTTTGGG - Intergenic
930020531 2:46999247-46999269 ATAAATGGATGAATAGGTAGGGG - Intronic
930768399 2:55108270-55108292 ATAGATATATGGACAGCTATAGG + Intronic
931183263 2:59924999-59925021 ATAAATGTATGAAAATGTTTGGG + Intergenic
932054490 2:68430991-68431013 ATGAATGTCTGTAAATGTATAGG - Intergenic
933393438 2:81701831-81701853 ATATATGAATATACAGCTATGGG - Intergenic
935478788 2:103559702-103559724 ATAAATATATGTACATGCATGGG + Intergenic
935658433 2:105444480-105444502 ATAAATGTATTTACACTTACTGG - Intergenic
936792429 2:116165365-116165387 ATACATGGAGGTACAGGTATTGG - Intergenic
937418196 2:121733929-121733951 AACAATCTTTGTACAGGTATAGG - Intronic
937459482 2:122073503-122073525 AAATATATATGTACATGTATTGG + Intergenic
937764973 2:125650550-125650572 ATATATGTATGTATATATATAGG - Intergenic
939108210 2:137974769-137974791 ATAAATGTATATACAATTATTGG - Intronic
939146852 2:138425890-138425912 ATTAAAGTAAGGACAGGTATAGG - Intergenic
939215811 2:139236914-139236936 ATAAAGGTATGAACAGGTTAAGG + Intergenic
939524984 2:143282088-143282110 ACAAATTTATTTACAAGTATAGG - Intronic
939677684 2:145092933-145092955 ATATATATATATATAGGTATAGG - Intergenic
940646885 2:156400902-156400924 CAAAATGTATGTACAAGTAATGG - Intergenic
940666040 2:156610905-156610927 CTAAATGTGTGTATAGATATTGG + Intronic
941939328 2:171016921-171016943 ATAAATCTTTCTACAAGTATTGG + Intronic
943229247 2:185225104-185225126 ACAAATGTATGTATAAATATAGG + Intergenic
943490736 2:188552872-188552894 ATATATGTATATACATATATAGG - Intronic
944106466 2:196084216-196084238 ATAAATGGGGGTACAGGTATTGG - Intergenic
944133419 2:196371223-196371245 ATATATTAATGTACACGTATAGG + Intronic
945650056 2:212546096-212546118 ATAAAAGTATTTTCAGGTTTTGG - Intergenic
947655373 2:231822182-231822204 ATAAACGTGTGTGCAGGTTTTGG + Intergenic
948302312 2:236916687-236916709 ATAAAAGTATTTGCAGGTCTTGG - Intergenic
1169749621 20:8978379-8978401 ATAAATGTGTATATATGTATGGG - Intergenic
1170313823 20:15021448-15021470 ATATATGTATATACATATATAGG + Intronic
1170943695 20:20870510-20870532 ATAACTGTATTTCAAGGTATTGG + Intergenic
1175169110 20:57067540-57067562 ATATATGTATGAAGAGGAATTGG + Intergenic
1175255555 20:57644565-57644587 ATAAATATATGTATAAATATGGG + Intergenic
1175666566 20:60865962-60865984 ATAAATGTTTGTACAACAATAGG + Intergenic
1175710628 20:61217669-61217691 ATAGGTGTAGGTACAGGTGTGGG + Intergenic
1175710727 20:61218577-61218599 ATAGATGTTGGTACAGGTGTAGG + Intergenic
1176372738 21:6072153-6072175 ATCAATGTGTGTACATGTATCGG - Intergenic
1177421052 21:20857671-20857693 ATATATGCATATACACGTATAGG + Intergenic
1177958667 21:27634042-27634064 ATATATATATGTACTGGTGTAGG + Intergenic
1179750739 21:43466090-43466112 ATCAATGTGTGTACATGTATCGG + Intergenic
1181893264 22:26083570-26083592 ATATATGTATGTAGGGGCATGGG + Intergenic
949911264 3:8910198-8910220 ATCAATGTGTGTAAATGTATTGG + Intronic
951179360 3:19641075-19641097 ATATATGAATGTAGGGGTATTGG + Intergenic
951819740 3:26794838-26794860 ATAAAGGTATCTGGAGGTATGGG - Intergenic
952552335 3:34493688-34493710 TTAAATGCATGTACATTTATGGG - Intergenic
955203289 3:56872332-56872354 ATAAATGTATATAAACATATAGG + Intronic
955306275 3:57836142-57836164 ATATATGTATTTATAGGGATTGG - Intronic
956057869 3:65319716-65319738 ATGAATGTGTGTACAGGGCTTGG - Intergenic
956980520 3:74631609-74631631 ACAAATGTTTGTAGATGTATAGG - Intergenic
957909583 3:86604195-86604217 TAAAATGGAGGTACAGGTATTGG - Intergenic
958076156 3:88681626-88681648 ACAAATGTATGTATTTGTATAGG + Intergenic
959306552 3:104674137-104674159 ATAAATGTATTTACTGGCTTTGG + Intergenic
959333979 3:105040882-105040904 ATAAATGCATGCATATGTATTGG - Intergenic
959800627 3:110490693-110490715 ATATATATATGTACATATATAGG - Intergenic
960448115 3:117773087-117773109 ATATATGTATGTACACATACAGG + Intergenic
960606544 3:119511679-119511701 ATAATAGTATGTGCAGGTAATGG + Intronic
960774715 3:121236856-121236878 AAAAATGGTTGTATAGGTATTGG + Intronic
960789028 3:121406183-121406205 ATAAATGTATATAAGGGTAACGG - Intronic
960843291 3:121982263-121982285 ATCAATTTATCCACAGGTATAGG + Intergenic
961478204 3:127161794-127161816 ATAGATGTAGGTGAAGGTATAGG - Intergenic
961924643 3:130464841-130464863 ATAAATGTATGTATTGATAAAGG + Intronic
962672785 3:137726226-137726248 TAAAATGGAGGTACAGGTATTGG + Intergenic
963649118 3:147955246-147955268 TTAAATGTATATACATTTATAGG - Intergenic
963946252 3:151148825-151148847 GTAAATGTATGTGTATGTATAGG - Intronic
965506651 3:169522878-169522900 TTACAAGTGTGTACAGGTATGGG - Intronic
965570503 3:170167409-170167431 ATAAATGTATGTAAAAGGCTGGG - Intronic
965641945 3:170838093-170838115 AAATATGTGTTTACAGGTATGGG + Intronic
967697524 3:192550332-192550354 ATATATGTATGCACATATATAGG - Intronic
970313424 4:14806389-14806411 AAAAATGTCTGTACATGTTTAGG - Intergenic
971951674 4:33358496-33358518 AGAAATGTATTGACAGATATTGG + Intergenic
972887422 4:43509805-43509827 ATAAATGGTGGTACAGGTATTGG + Intergenic
973186036 4:47329764-47329786 ATATATCTATATACATGTATTGG - Intronic
974784782 4:66605418-66605440 ATATATGTATGTGCATATATAGG - Intergenic
974885829 4:67815894-67815916 ATAAATGTATGTACATGTGCAGG - Intergenic
975030585 4:69609693-69609715 ATAAGTATAGGTATAGGTATAGG - Intronic
975062739 4:70022796-70022818 ATAAATGTTTTTACAGGAGTTGG + Intergenic
975281157 4:72564518-72564540 ATATATGTATGTATGGGTATAGG + Intronic
977079008 4:92499368-92499390 ATAAATCTATGGAGAGGAATGGG - Intronic
977082860 4:92555280-92555302 CTAAATGTATGTAGGGTTATAGG + Intronic
978685776 4:111441190-111441212 ATAAATATATCTCCATGTATGGG + Intergenic
979093052 4:116511822-116511844 ATAAATGTATGTATAAATTTTGG + Intergenic
979128769 4:117012009-117012031 TTAAATGTATGCACAGAAATTGG + Intergenic
979854244 4:125611673-125611695 TAAAATGGAGGTACAGGTATTGG - Intergenic
979900624 4:126212451-126212473 ACAAATGTATGTACACAAATGGG + Intergenic
980416406 4:132495044-132495066 ATATATGTAAGTACATCTATAGG + Intergenic
980528590 4:134020804-134020826 ATAAATATAGGTATAGGTATGGG + Intergenic
981393192 4:144216569-144216591 ACAAATGGGGGTACAGGTATTGG + Intergenic
981666066 4:147228046-147228068 ATAGATGTAGCTTCAGGTATAGG - Intergenic
982664425 4:158244344-158244366 ATAAAGGTATGTACAAGAAAGGG + Exonic
983461725 4:168032693-168032715 AAATACGCATGTACAGGTATTGG - Intergenic
983675522 4:170288052-170288074 ATAAAGGTATTTAAAGCTATGGG - Intergenic
983909167 4:173217194-173217216 AAAAATGCATATACATGTATAGG + Intronic
984150854 4:176128110-176128132 GAACATGTATGTACAGGTTTTGG + Intronic
984318032 4:178154662-178154684 ATAAATCTATGCACAGCTTTTGG - Intergenic
985776280 5:1844520-1844542 ATAGGTGTAGGTACAGGTGTAGG - Intergenic
985776288 5:1844594-1844616 ACAAGTGTATGTATAGGTGTCGG - Intergenic
985776299 5:1844728-1844750 ATACATGTAGGTACAGATACAGG - Intergenic
986135515 5:4974027-4974049 ATAGATATAGGTACAGGAATAGG - Intergenic
986135523 5:4974138-4974160 ATAAGTGTAGGTATAGATATTGG - Intergenic
986363610 5:7006792-7006814 ATACATGTATGTACATGTGTAGG + Intergenic
987853802 5:23391591-23391613 ATATATGTATGTATATATATAGG + Intergenic
989439075 5:41448877-41448899 AAATGTGTATGTACATGTATTGG - Intronic
990501596 5:56401858-56401880 ATAAATATATGTACATATAGAGG + Intergenic
990625783 5:57609297-57609319 ATAAACATATGTACACATATAGG - Intergenic
991515174 5:67427219-67427241 ATATATGCATGAACAGGTAGAGG + Intergenic
992132842 5:73711144-73711166 ATTAATATATGTACATTTATAGG + Intronic
993306381 5:86280175-86280197 ATAAATGTAAGCACCGGTTTAGG - Intergenic
993454891 5:88116368-88116390 ATAAATGTATGTAAATGTGAAGG + Intergenic
993914947 5:93732905-93732927 ATAAATGTATGTACAGGTATTGG - Intronic
994471108 5:100209316-100209338 ATATATTTATGTACAAATATTGG - Intergenic
994581683 5:101650597-101650619 ATTATTGTTTGTACAGGTAATGG - Intergenic
994871495 5:105355484-105355506 ATAAATGTATGTAAAGAAGTTGG - Intergenic
994909963 5:105891187-105891209 ATATATGTATATACATATATGGG + Intergenic
995013198 5:107280677-107280699 ATGGATGTATGTATAGGTATAGG + Intergenic
995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG + Intergenic
995621179 5:114027421-114027443 ATAAATATATGTATATATATAGG + Intergenic
995768336 5:115643000-115643022 GTATATGTATGTATATGTATAGG + Intergenic
996195192 5:120596963-120596985 ATAAATTTTTGTATATGTATAGG - Intronic
996662834 5:126025057-126025079 ATAGATGTATGTGCATGTATAGG - Intergenic
996922539 5:128785665-128785687 ACATATGTATATTCAGGTATAGG + Intronic
998244041 5:140479909-140479931 ATATATGTATGTATATATATAGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998731713 5:145084842-145084864 ATATATGTATTTCCAGGGATTGG - Intergenic
998968596 5:147567173-147567195 ATATATGTATGGATAAGTATTGG - Intergenic
999971277 5:156866109-156866131 ATACATGTATGAAAACGTATCGG - Intergenic
1000147475 5:158467476-158467498 ATAAGTGAATATACAGCTATTGG - Intergenic
1000551499 5:162671130-162671152 ATAAATGTACCTAAGGGTATTGG - Intergenic
1000884706 5:166737617-166737639 ATAAATGTATTTACAAGTAAAGG + Intergenic
1000945357 5:167416229-167416251 ATAAATCTATTTAAAGGAATTGG - Intronic
1001730141 5:173947532-173947554 ATAAATGTCTTTACAGGTATTGG + Intronic
1003459854 6:6319848-6319870 ATAAATATATTTACAGTCATTGG + Intronic
1003751852 6:9067628-9067650 ACAAATGTGTGTACATATATGGG - Intergenic
1004299855 6:14447477-14447499 AGAAATGTTAGGACAGGTATAGG + Intergenic
1005784838 6:29233062-29233084 ATGAATGTATATACATTTATAGG - Intergenic
1006560307 6:34905513-34905535 ATAAATGTATGTAAAGCCCTTGG - Intronic
1006929197 6:37677606-37677628 AAAAATATATTGACAGGTATGGG + Intronic
1007268569 6:40617531-40617553 ATAAAGGTAAGTACAGGAATCGG - Intergenic
1008837239 6:55849328-55849350 ATATATGTATGTTCATGTGTAGG - Intronic
1009717057 6:67411407-67411429 ATACATGTATTTGCAGGCATAGG + Intergenic
1009984113 6:70762277-70762299 ATAAATGAATGTACATGGCTGGG - Intronic
1010910065 6:81542851-81542873 ATAAATGTATACACTGGTAATGG - Intronic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1011119387 6:83934380-83934402 ATAGAAGTATTTACAGGTCTTGG + Intronic
1012053329 6:94371875-94371897 TTAAGTGTATGGAAAGGTATTGG + Intergenic
1012086936 6:94839154-94839176 ATAAATAAATGTGCAGTTATTGG - Intergenic
1012366087 6:98442774-98442796 ATAAATATATGTCTGGGTATAGG - Intergenic
1012593557 6:101013593-101013615 ATGAATATATATATAGGTATGGG - Intergenic
1013190255 6:107797310-107797332 AGAAATATATGTGCAGGTTTTGG + Intronic
1014155770 6:118107700-118107722 AGAAATGTATCTACACATATGGG + Intronic
1015075070 6:129147043-129147065 ACAAATGTATGTATATTTATAGG + Exonic
1015261765 6:131246109-131246131 ATATATATATGTTCAGTTATAGG + Intronic
1015605023 6:134945445-134945467 ATATATGTATGGGAAGGTATGGG + Intronic
1015834993 6:137410670-137410692 ATAAATTTATTTACATGCATGGG - Intergenic
1015978684 6:138817387-138817409 ATTAATTTATTTACAGTTATTGG - Intronic
1016829882 6:148423790-148423812 ATAAATGTTTGTTCAGTTGTAGG + Intronic
1017298657 6:152830829-152830851 ATTAATGTATAGACAGATATTGG - Intergenic
1017313916 6:153006392-153006414 ATAAATGGATATACAATTATAGG - Exonic
1017649327 6:156566514-156566536 ATAAAGGCAGGTACAGGAATGGG - Intergenic
1020829056 7:13070366-13070388 ATATATGTATATACATATATAGG + Intergenic
1020829057 7:13070390-13070412 ATATATGTATATACATATATAGG + Intergenic
1020829058 7:13070422-13070444 ATATATGTATATACATATATAGG + Intergenic
1021026889 7:15679214-15679236 ATATATGTATATACATATATAGG - Intronic
1021031444 7:15742042-15742064 ATAAATGGATATACAGTTGTAGG - Intergenic
1021484236 7:21149252-21149274 ATAAATTAATGGACATGTATAGG + Intergenic
1022627498 7:32052980-32053002 ATAAAGGTATATACAAATATAGG + Intronic
1023989534 7:45119880-45119902 ATACATGTATATACATGTGTGGG + Intergenic
1025780589 7:64598117-64598139 ATATATGTATGTATACATATGGG + Intergenic
1025961803 7:66229589-66229611 AGACATTTATGTACAGGTTTTGG + Intronic
1026648141 7:72190819-72190841 ATAAATCGATGTACAGATGTAGG - Intronic
1026924367 7:74179677-74179699 ACAAATGTATGCACTGGTAAAGG - Intronic
1027522361 7:79225168-79225190 ACAAATGTATGCACAGGTGGTGG - Intronic
1027582021 7:80009455-80009477 ATATATGTTGGTAGAGGTATAGG + Intergenic
1027705197 7:81523186-81523208 ATAAATGTATGTCCAATTGTTGG + Intergenic
1027767312 7:82361726-82361748 ACTAATGTACGTACAGTTATTGG + Intronic
1028607614 7:92672122-92672144 ATATATATATGTACAGCTTTTGG - Intronic
1028720777 7:94028441-94028463 ATAAATGTTTATTCAGGGATTGG + Intergenic
1029072833 7:97913956-97913978 ATAAATGGATGCACGGGTAGGGG + Intergenic
1030828359 7:114189206-114189228 TTAAATCTATGTACATGAATTGG - Intronic
1031930607 7:127681792-127681814 ATAAATGTATGGATTTGTATTGG + Intronic
1032954438 7:136954213-136954235 ATATATAAATGTATAGGTATAGG - Intronic
1033108296 7:138551186-138551208 AGAAATGTATGTAATGGTAATGG - Intronic
1033609417 7:142951701-142951723 ATAAATGTATTCACAGGGACTGG - Intronic
1036292715 8:7508058-7508080 ATATATATATATACATGTATAGG - Intronic
1036329846 8:7812955-7812977 ATATATATATATACATGTATAGG + Intronic
1036513385 8:9421256-9421278 ATCACTGTAAGTACAGGTAATGG - Intergenic
1036588897 8:10149709-10149731 ATAAATGCATGTACATATAGTGG + Intronic
1039165086 8:34669974-34669996 ATAAATGCTTGTACAGGGAAAGG + Intergenic
1039851596 8:41371192-41371214 ACAAATATATGTACAAATATCGG + Intergenic
1040589055 8:48772667-48772689 ATATATGTATGTATATATATAGG + Intergenic
1041305410 8:56452522-56452544 AAAATAGTATGCACAGGTATAGG - Intergenic
1041438086 8:57863689-57863711 TACAATGTATGTACAGGCATTGG - Intergenic
1041925735 8:63234325-63234347 ATACATGGAGGTACAGGCATTGG + Intergenic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1043342551 8:79257733-79257755 CTAAATGTGTGTATAGATATTGG - Intergenic
1044428110 8:92077391-92077413 ATAAATATATGTACACGTATAGG + Intronic
1045943663 8:107769681-107769703 ATAAATATAAAAACAGGTATAGG + Intergenic
1046163108 8:110393039-110393061 ATTAATGTAAGGACAGATATTGG + Intergenic
1046424166 8:114024552-114024574 ACAAATGTATGTATGTGTATGGG - Intergenic
1048399093 8:134046888-134046910 ATAAATGTAGGTATAGGTGCAGG + Intergenic
1049738542 8:144222840-144222862 ATACAGGTAGGTACAGGTGTGGG + Intronic
1050352675 9:4755247-4755269 AGAAATCTAAGTACAGGTAGTGG + Intergenic
1050754345 9:8981999-8982021 ATAAATGAAAGTTAAGGTATGGG + Intronic
1051511207 9:17879720-17879742 AAATATGGATGTACAGGTAGAGG + Intergenic
1051693447 9:19742547-19742569 AAAAATTTAAGAACAGGTATGGG - Intronic
1052000472 9:23272799-23272821 AGAAATGTATGAACAGATATAGG - Intergenic
1054797744 9:69318209-69318231 GGAAATGTGTGTATAGGTATTGG + Intergenic
1055220849 9:73929091-73929113 ATATGTGTATTTACAGCTATAGG - Intergenic
1055725217 9:79220478-79220500 AAGAATGCATGTACATGTATAGG + Intergenic
1057606066 9:96498577-96498599 ATAATTTTATGCACAGGTAATGG - Intronic
1059694588 9:116718963-116718985 ATATATATATGTACAGATACAGG - Intronic
1060634377 9:125188862-125188884 GTAAATGTATGTATGGGTAAAGG - Intronic
1186591694 X:10936903-10936925 ATAAACATAGGTATAGGTATAGG + Intergenic
1186628303 X:11319235-11319257 ACATATGTAAGTACAAGTATAGG - Intronic
1187599919 X:20817353-20817375 ATTGATGTATGTAGGGGTATAGG + Intergenic
1188088599 X:25934340-25934362 ATAATTGTATATACATTTATAGG + Intergenic
1188580899 X:31712182-31712204 AAAAATGTATGCACAGTTGTGGG + Intronic
1190500114 X:51067206-51067228 CTAAATGTATGTATATGCATGGG + Intergenic
1190639743 X:52472561-52472583 ATAAATATATGTATGTGTATAGG - Intergenic
1190652296 X:52578883-52578905 ATAAATATATGTATGTGTATGGG + Intergenic
1191658458 X:63626981-63627003 ATATATGTATATACATATATAGG + Intergenic
1191901433 X:66044736-66044758 ATATATGTATGTGCAGGACTTGG + Intergenic
1192042783 X:67640826-67640848 ACAAATGTATGTATGGGTAAAGG - Intronic
1192297362 X:69865301-69865323 ATATATGTATGTATATATATGGG - Intronic
1192928751 X:75782963-75782985 ATAAATGAATGCACAAGCATAGG + Intergenic
1194463148 X:94197334-94197356 ATACATGTTGGTACAGGCATTGG - Intergenic
1195432764 X:104807686-104807708 ATAAATATATGTACAAAAATAGG + Intronic
1196066559 X:111470927-111470949 ATACATGTTGATACAGGTATTGG + Intergenic
1196582458 X:117393499-117393521 ATAAATGGAGCTACAGGAATTGG + Intergenic
1197086411 X:122481735-122481757 ATAAATGGATGTATAGATGTTGG - Intergenic
1197220352 X:123906370-123906392 ATAAAAGGAGGTACAGGTTTGGG - Intronic
1197359752 X:125485891-125485913 TTAAAAGTATGTACTTGTATAGG + Intergenic
1198724870 X:139666339-139666361 GTAAATGTGTGTCCAGGTTTAGG + Intronic
1199185392 X:144910144-144910166 AACAATGGAGGTACAGGTATTGG + Intergenic
1201303442 Y:12530410-12530432 ATAAATATATGTAAAGGGAAAGG - Intergenic