ID: 993916776

View in Genome Browser
Species Human (GRCh38)
Location 5:93753751-93753773
Sequence TCTAAGCTATAGTAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993916769_993916776 28 Left 993916769 5:93753700-93753722 CCTAGATTTATATCAAGTGTTCT 0: 1
1: 0
2: 1
3: 34
4: 244
Right 993916776 5:93753751-93753773 TCTAAGCTATAGTAGGGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993916776 Original CRISPR TCTAAGCTATAGTAGGGGCA AGG Intronic
904079141 1:27861091-27861113 TGTAAGCTCCACTAGGGGCAGGG + Intergenic
904644425 1:31955189-31955211 TCTAAGCTGAAGTGGGGGAAAGG + Intergenic
905900482 1:41578790-41578812 CCTAAGCTATAGAAGGGAGATGG + Intronic
909481634 1:76133064-76133086 AATATGCTATAGTAGGGGGATGG + Intronic
910286643 1:85563088-85563110 TCTAAGCTGTAGCACAGGCAGGG + Intronic
913452224 1:119000168-119000190 TTTGAGCTTGAGTAGGGGCATGG - Intergenic
914193158 1:145428274-145428296 TCTAGGATCTAGTGGGGGCATGG - Intergenic
914194892 1:145442055-145442077 TCTGAGCCATAGCTGGGGCAAGG - Intergenic
914476166 1:148024622-148024644 TCTGAGCCATAGCTGGGGCAAGG - Intergenic
915854789 1:159371512-159371534 TCTAGGGTTTGGTAGGGGCAGGG - Intergenic
923303159 1:232662180-232662202 TATAATTTATATTAGGGGCAGGG + Intergenic
924481504 1:244439496-244439518 TCCCAGCCACAGTAGGGGCAGGG - Intronic
1066365877 10:34776594-34776616 TTTAAGCTATATTTGGGGCCAGG + Intronic
1076788462 10:132763929-132763951 TCAAAGGCAGAGTAGGGGCATGG - Intronic
1078997802 11:16721726-16721748 TCCAGGCTATACTAGAGGCATGG - Intronic
1079978457 11:27123117-27123139 TCTCAGCAATAATAGGGGAATGG - Intronic
1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG + Intergenic
1087070899 11:94079483-94079505 TATAAGGAATAGTAGGCGCAAGG + Intronic
1093448666 12:19290116-19290138 TTTAATCTTTAGTAGAGGCAGGG + Intronic
1093850083 12:24025955-24025977 TCTAACCTATTGTAGGGGTGTGG - Intergenic
1111468734 13:88648619-88648641 TCTAAAATATAGTAGGGCCATGG - Intergenic
1113738996 13:112698014-112698036 TCTTAACTTTAGCAGGGGCAGGG - Intronic
1117476346 14:56098873-56098895 TCTAGGCTATACTAGGGAAAGGG + Intergenic
1119377320 14:74205223-74205245 TCTAAGATATAGTAAGTGCTTGG + Intergenic
1122440799 14:101730673-101730695 TCCAAGCTACAGTATGGACAAGG + Intronic
1202929888 14_KI270725v1_random:27367-27389 TCAAAGGCAGAGTAGGGGCAGGG - Intergenic
1125081508 15:35678795-35678817 TCTTAGTTATAATAGGGGCCAGG + Intergenic
1125926336 15:43566398-43566420 TATAGGCTATAGTAGGAGAAGGG - Intronic
1125939480 15:43665948-43665970 TATAGGCTATAGTAGGAGAAGGG - Intronic
1126120298 15:45245685-45245707 TCAAAGCTAGAGGTGGGGCATGG - Intergenic
1128815088 15:70602383-70602405 TCTGAGCTATAGTGGGGCAAGGG - Intergenic
1131314339 15:91319649-91319671 TCTAAGAGAGAGTGGGGGCAGGG - Intergenic
1146799903 17:35809877-35809899 TCTACGCCATCGTAGGGGCGGGG + Intronic
1152371152 17:79889342-79889364 TCCAGGCTAGAGCAGGGGCAGGG - Intergenic
1159070078 18:63613360-63613382 TCCAAGATATAGTGGGGGTATGG + Intergenic
1161566549 19:5005861-5005883 TCTAAGTGATATGAGGGGCAGGG + Intronic
1164576724 19:29409429-29409451 ACTAATCCATTGTAGGGGCATGG + Intergenic
1165571097 19:36775700-36775722 TCTACGCCATTGTAGGGGCGGGG - Exonic
927490157 2:23516070-23516092 TCTAAGCTCTAGGAGGGAGAGGG - Intronic
928059359 2:28095288-28095310 TATAGGCTAGTGTAGGGGCATGG - Intronic
930491841 2:52083636-52083658 TCTAAACTCTAGTGGGGGGAAGG - Intergenic
943687226 2:190831320-190831342 TCTAAACTATACTTGGGGCCGGG + Intergenic
944535956 2:200710128-200710150 TCTAAATTATAGCTGGGGCAGGG - Intergenic
945985604 2:216351029-216351051 TCTAATCCATAGGAGGGGAAAGG + Intronic
1169372115 20:5035800-5035822 TCTAAGAGATGGTGGGGGCAGGG + Intergenic
1172291683 20:33781416-33781438 CCTAGGCTATAATAAGGGCAAGG + Intronic
1176591914 21:8655977-8655999 TCAAAGGCAGAGTAGGGGCAGGG - Intergenic
1177807112 21:25885294-25885316 GCTAAGCTACAGCAGTGGCATGG + Intronic
1179065950 21:38025079-38025101 TATAAACTAAAGTGGGGGCACGG - Intronic
1180274755 22:10633078-10633100 TCAAAGGCAGAGTAGGGGCAGGG - Intergenic
1181262906 22:21611468-21611490 TCCAGGCTATAGGAAGGGCATGG + Intronic
950095292 3:10325605-10325627 TCTATGCTATGGTTGGGACAAGG + Exonic
954246970 3:49339837-49339859 TCTCGGCTAGAGTAGGGGCTGGG - Intronic
960329211 3:116337751-116337773 TCCAAGCAATAGCAGGGGCTAGG + Intronic
964738259 3:159938982-159939004 TTTAAGCAATAGAAGAGGCAAGG + Intergenic
965810053 3:172582313-172582335 GCTAAGCAGTTGTAGGGGCAGGG - Intergenic
969238666 4:5885752-5885774 GCTAAGCTCTAGAAGGGCCAGGG + Intronic
969445608 4:7243213-7243235 TCTGAGCTATAGAAATGGCAAGG + Intronic
973639898 4:52892285-52892307 TCTAAGGTCAAGTAGGGCCAAGG - Intronic
974970715 4:68823215-68823237 TGTAAACTATAGGATGGGCATGG + Intronic
978189097 4:105893081-105893103 TCTAACCAATAGAAGGGCCAGGG - Intronic
979353401 4:119673080-119673102 TGTAAGGTATAGAAGTGGCAAGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984590818 4:181615652-181615674 TCTAAGCATTAGTAGGAGCACGG - Intergenic
987680049 5:21123820-21123842 TCTAATCCATAATAGGGCCAAGG + Intergenic
987767871 5:22258284-22258306 TCAAAACTATAGGATGGGCACGG - Intronic
988660842 5:33266484-33266506 TCAACGCTATAGTTGTGGCAGGG + Intergenic
993916776 5:93753751-93753773 TCTAAGCTATAGTAGGGGCAAGG + Intronic
1000315579 5:160087263-160087285 TCCCAGCTATGGTAGGGGCAGGG + Intronic
1001509924 5:172313020-172313042 TCTAAACTATAGCTGGGGCCAGG - Intergenic
1002589733 5:180282062-180282084 TCTAAGCTATAGGAGGTGCGAGG + Intronic
1010345132 6:74801472-74801494 TCCAAGATATAATAGGGGTATGG - Intergenic
1026215100 7:68341620-68341642 TCTGTGCTAAAGTAGGGGGAAGG + Intergenic
1032789437 7:135231754-135231776 TCTATGTTATTGTAGGGGGAGGG + Intergenic
1033478047 7:141709834-141709856 TTAAAGCCATAGTTGGGGCAGGG + Intronic
1033528237 7:142238028-142238050 TCCAAGCTATAGTAGAGCCCTGG - Intergenic
1037908796 8:22731044-22731066 TCTTAGCTATAGGAAGGGAAAGG - Intronic
1048002436 8:130390032-130390054 TTTAAGTTGTAGTAGGGTCAAGG - Intronic
1048618638 8:136107150-136107172 CCCAACCTATAGTAGTGGCAAGG - Intergenic
1050065784 9:1758170-1758192 AGTAAGCTGTAGTAGGGGGATGG - Intergenic
1053302855 9:36964104-36964126 TCTATTTTTTAGTAGGGGCAGGG - Intronic
1056136946 9:83639800-83639822 TATAATTTATAGTAAGGGCATGG + Intronic
1056450500 9:86712164-86712186 TGTAAGCCACAGTAAGGGCAGGG + Intergenic
1203621954 Un_KI270749v1:134796-134818 TCAAAGGCAGAGTAGGGGCAGGG - Intergenic
1185644742 X:1608837-1608859 TCTTAGCTGGAGTAGGCGCAGGG - Intergenic
1185645149 X:1610560-1610582 TCTTAGCTGGAGTAGGGGCAGGG - Intergenic
1189427910 X:40918214-40918236 TTTAAGGTATAATAGTGGCATGG + Intergenic
1191861382 X:65668521-65668543 ATTAAGCAATAGGAGGGGCAGGG - Intronic
1196888711 X:120272066-120272088 TCTCAGCTATAGCAGGGGAGTGG + Intronic