ID: 993919051

View in Genome Browser
Species Human (GRCh38)
Location 5:93777327-93777349
Sequence CACAGCTACAACTCACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993919051_993919053 15 Left 993919051 5:93777327-93777349 CCATCTGGTGAGTTGTAGCTGTG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 993919053 5:93777365-93777387 AGCCTCCAATATTAAAAAATAGG 0: 1
1: 0
2: 8
3: 24
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993919051 Original CRISPR CACAGCTACAACTCACCAGA TGG (reversed) Intronic
907830648 1:58061199-58061221 CAAAGCTAGAACTCACCCGTGGG - Intronic
910123877 1:83819402-83819424 CAGAGCAACCACTCACTAGAGGG + Intergenic
910967074 1:92818547-92818569 CAGTGCTTCTACTCACCAGAAGG - Intergenic
911140969 1:94502175-94502197 CACAGCTAAAAAACATCAGATGG + Intronic
920345840 1:205305183-205305205 CACACCTCTTACTCACCAGAGGG + Exonic
920510233 1:206545603-206545625 CACAGGCACAAGTCACCACATGG + Intronic
924901912 1:248410374-248410396 CACAGCTACCACACACAACATGG - Intergenic
1062809563 10:452485-452507 CACAGCAACAACTTAGCACATGG - Intronic
1065244719 10:23745577-23745599 TACAGCTAAAACTCCTCAGACGG - Intronic
1067561274 10:47306520-47306542 CACCGCTAGACCTCACCATAAGG - Intronic
1068690479 10:59908613-59908635 CACTGCTTCAAGTCAGCAGAGGG + Intergenic
1076063373 10:127430133-127430155 CACAGCTAGAACTAACTTGAGGG - Intronic
1076139477 10:128068160-128068182 CACAGCTGCACTTCACCAGCTGG + Exonic
1076292685 10:129359932-129359954 CACAGCCACGACTGACAAGAAGG + Intergenic
1078147137 11:8729916-8729938 TTCAGCTACAACACACCGGAGGG + Intronic
1080866948 11:36203917-36203939 GGCAGTTACAGCTCACCAGAGGG + Intronic
1084670628 11:70604562-70604584 CACAGCAACCACTCACCAGGAGG - Intronic
1091833423 12:3567167-3567189 CATAGCTAAAGCTCAACAGAAGG - Intronic
1098168762 12:67724222-67724244 CACAGCAGCAACTCGCCACAAGG + Intergenic
1098626596 12:72678567-72678589 AACAGCTACAGGACACCAGAAGG - Intergenic
1098661571 12:73101038-73101060 CAGAGCTACAAGTCACCTGGGGG - Intergenic
1100349135 12:93762038-93762060 CAAAGATTCAACTCAGCAGAAGG + Intronic
1106998414 13:35515445-35515467 CACAGCAAAAATTCAGCAGAAGG + Intronic
1116327093 14:43543650-43543672 TACATCTACAACTTACCAAATGG + Intergenic
1118018174 14:61682099-61682121 CACAGATACAACCCACTGGATGG + Intergenic
1118130389 14:62956416-62956438 CACAGCTACTAATCACTAGGTGG + Intronic
1119568707 14:75650933-75650955 CACAAATACAGCTGACCAGAAGG + Exonic
1120041391 14:79757151-79757173 CACAGCTGCAATTAATCAGACGG - Intronic
1120149185 14:81014142-81014164 AACAGCTACCTCTCACAAGAGGG - Intronic
1122392287 14:101398154-101398176 CAGAGCTCCAGCCCACCAGAGGG - Intergenic
1126684271 15:51233886-51233908 ATCATCTACAGCTCACCAGATGG + Intronic
1126692727 15:51300331-51300353 CTAAGCTACAACTCACGAGAGGG + Intronic
1132218883 15:100090155-100090177 CACAGTTGAAACTCCCCAGAAGG - Intronic
1133899598 16:9961264-9961286 CGCAGCTACAACCCAATAGAAGG + Intronic
1137805685 16:51303271-51303293 CACTGTCACAACTCACCAGCAGG - Intergenic
1139215010 16:65119313-65119335 CACAGCCACCACTCTACAGAGGG + Intronic
1141435973 16:83999960-83999982 CACTGCAACCTCTCACCAGAGGG + Intronic
1141866083 16:86750934-86750956 CTCAGCTACAGCTCACCTGCTGG - Intergenic
1142335337 16:89485823-89485845 CTCAGCTACATGTGACCAGAGGG + Intronic
1149639608 17:58194086-58194108 CTCAGCCCCAACTCACAAGAGGG - Exonic
1150412794 17:64961004-64961026 CACAGATTCAAATCACCAGGTGG + Intergenic
1156758328 18:40556083-40556105 CACAGCTGCAAGTCATCTGATGG - Intergenic
1159186165 18:64977365-64977387 CACATTTACATCTCACCAGATGG + Intergenic
1160613479 18:80107402-80107424 CACACCCACTACTCCCCAGACGG - Intergenic
1161275963 19:3417434-3417456 CACAGTAAAAACTCAGCAGATGG + Intronic
1161311950 19:3599833-3599855 CAGAGCCCCTACTCACCAGAAGG + Exonic
1164386208 19:27772755-27772777 CACATCTACGATTGACCAGATGG + Intergenic
1165694871 19:37893312-37893334 CCCAGCTACAACTGACTAGCTGG - Exonic
932627869 2:73313361-73313383 CACAGATACAACTCAACACTGGG - Intergenic
937908860 2:127065666-127065688 CACCCCCACAACTCCCCAGATGG + Intronic
938740685 2:134228842-134228864 CACAACTACAACTCACTAGATGG - Intronic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
943996606 2:194774941-194774963 CAAAGCTACAACTCTGGAGATGG - Intergenic
946227422 2:218271437-218271459 CAAAGCCACAGCTCCCCAGAGGG + Exonic
946421807 2:219569440-219569462 CACACCCCAAACTCACCAGAAGG - Intronic
1172871640 20:38139411-38139433 CACACCTACAAATACCCAGAGGG - Exonic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1175286247 20:57838842-57838864 CACAGCCGCAGCTCACCAGATGG - Intergenic
1175331088 20:58164613-58164635 CACAGCAACGAACCACCAGACGG + Intergenic
1175345182 20:58268013-58268035 CACAGCGACAACTCAAAAAAGGG + Intergenic
1179597214 21:42451012-42451034 CACAGCCACAAATCCCAAGAAGG + Intergenic
1184058209 22:42066569-42066591 GACACCTACAAATCACCATATGG + Intronic
1184854385 22:47138473-47138495 CACAGCTTCACTTCTCCAGAAGG - Intronic
1185151282 22:49165052-49165074 CACCCCTACACCCCACCAGACGG + Intergenic
949441254 3:4083138-4083160 CACAGCTGCATCCCAGCAGATGG - Intronic
950601717 3:14041008-14041030 CACACCTACACTTCACCAAAGGG - Intronic
952966418 3:38623721-38623743 CATAGCTCCACCTCACCTGATGG + Intronic
953399439 3:42600400-42600422 CACAGCCACACCTGACGAGATGG + Intronic
953444196 3:42948732-42948754 CACAGCTAAAACAAACCAGGTGG - Intronic
955371023 3:58352119-58352141 CACAGCCACAAGTCCCCAGCAGG - Intronic
956008989 3:64810407-64810429 CACTGCTACATCACACCAGCAGG - Intergenic
957470071 3:80647934-80647956 CAGAGCTACAAGAAACCAGATGG - Intergenic
959823561 3:110766744-110766766 CTCAGCCACAACTCCCCAGTGGG - Intergenic
959951692 3:112185859-112185881 CACAGCTCCCACTCGCCAGGCGG + Intronic
963758300 3:149259034-149259056 CAGGGCTACCACACACCAGAAGG + Intergenic
964811763 3:160672334-160672356 CAGAGAGACAACACACCAGAGGG - Intergenic
966212288 3:177465838-177465860 CCCAGCTACAAAACACCAGAAGG - Intergenic
967907979 3:194517440-194517462 CAGATCTACACTTCACCAGACGG + Intergenic
968724966 4:2242438-2242460 CGCAGCTTCAGCTCCCCAGAGGG - Intergenic
968835454 4:2961442-2961464 GAGTGCTACAACTGACCAGAGGG + Intronic
970293983 4:14608019-14608041 CACAGCTACATTTCACAACACGG + Intergenic
974864675 4:67565471-67565493 CACACATACAAATCACCACATGG + Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
979396500 4:120196032-120196054 CACAGCTACAACAAAACAGAGGG + Intergenic
980942743 4:139290029-139290051 CACATTTACAACTCAACAGATGG + Exonic
981449019 4:144874110-144874132 CAGAGCCACAACTAACCACAAGG + Intergenic
985692965 5:1323589-1323611 CTCAGCTACACCTTACCAGGGGG + Intronic
992331588 5:75722403-75722425 CACATCTACACCTCTACAGATGG + Intergenic
993223854 5:85139895-85139917 CACATTGACAAATCACCAGAAGG - Intergenic
993919051 5:93777327-93777349 CACAGCTACAACTCACCAGATGG - Intronic
998724983 5:145002150-145002172 CACAGCTCCAACAGAACAGAAGG + Intergenic
1003293801 6:4805934-4805956 GACATGTAAAACTCACCAGAGGG + Intronic
1005495555 6:26384839-26384861 CACAGCTACTGGTCCCCAGAAGG + Intronic
1008021869 6:46588095-46588117 AACATCAACAAGTCACCAGAAGG + Exonic
1010133368 6:72522106-72522128 ACCATCTACAACTCACCAAAAGG + Intergenic
1013401209 6:109798177-109798199 CACAGCTACTACTCTCTAAAAGG - Intronic
1021808113 7:24376745-24376767 CACAGCAGCCACTTACCAGAAGG - Intergenic
1024128290 7:46323369-46323391 CACAGGGAGAACTTACCAGAAGG + Intergenic
1029676015 7:102069366-102069388 CACGGCTACAACACACCATGGGG - Intronic
1037848264 8:22303908-22303930 CACAGCTATATAGCACCAGAAGG - Intronic
1038701636 8:29854740-29854762 CACAGCCAAACCACACCAGAAGG + Intergenic
1044402206 8:91785914-91785936 CAGACCTACAACTCAACAAATGG + Intergenic
1045473827 8:102536738-102536760 CACAGCATCTACTCCCCAGAGGG - Intronic
1050085619 9:1962335-1962357 CACAGCTGCCACACATCAGAAGG - Intergenic
1051596913 9:18833073-18833095 CACTGCTACAACTCTCCAAAGGG + Intronic
1052786072 9:32829706-32829728 TACATCTCCAACTTACCAGATGG + Intergenic
1055466271 9:76569869-76569891 GAAAACTACAACTCACCTGAGGG - Intergenic
1055982689 9:82020529-82020551 CTCAGTTACAACTCAGCAGATGG - Intergenic
1055993439 9:82131729-82131751 AACAAATACAACTCACCTGATGG + Intergenic
1059738477 9:117126298-117126320 CACAGCTACAATGTAGCAGAAGG + Intronic
1061859917 9:133462714-133462736 CCCAGCTGCACCTCACCAGCAGG - Intronic
1062066039 9:134526863-134526885 CACAGCTCCACCCCACCAGCTGG - Intergenic
1186123093 X:6384111-6384133 CACAGTTACAACCCATCAGGAGG - Intergenic
1191931640 X:66379925-66379947 CCCAGCCCCAACTCACAAGATGG - Intergenic
1196548915 X:116997867-116997889 CACAGTTTCAAATAACCAGAAGG + Intergenic
1200914368 Y:8558418-8558440 CACACAGACAGCTCACCAGAAGG - Intergenic