ID: 993921220

View in Genome Browser
Species Human (GRCh38)
Location 5:93805526-93805548
Sequence CTGAGCAGTAATAAAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993921217_993921220 1 Left 993921217 5:93805502-93805524 CCAGTGTAAGGTCCTGAGTATGA 0: 1
1: 0
2: 0
3: 7
4: 133
Right 993921220 5:93805526-93805548 CTGAGCAGTAATAAAACAGCAGG 0: 1
1: 0
2: 0
3: 27
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993921220 Original CRISPR CTGAGCAGTAATAAAACAGC AGG Intronic
908193854 1:61729582-61729604 CTGGGCAATAATAAAACACTGGG + Intergenic
908968829 1:69800183-69800205 CTGAGCAGAAAGAACAAAGCTGG - Intronic
909297174 1:73965657-73965679 CTAAGCAGAAATAACAAAGCTGG - Intergenic
913290291 1:117265630-117265652 CTGCTCAGTGATAGAACAGCAGG - Intergenic
916606238 1:166345162-166345184 GTGACCAGTAATAAGACAGCAGG - Intergenic
917245917 1:173000154-173000176 CTGAGCAAAAATAATACAACTGG - Intergenic
917446595 1:175110808-175110830 CTGAGCAAAAATAACAAAGCTGG - Intronic
917856808 1:179107903-179107925 CTGAGCAGTAGTCAAGCAGCTGG + Exonic
919177901 1:194042611-194042633 CTGAGTAATAATAAAATAGATGG - Intergenic
920786039 1:209042191-209042213 CTGACCAGTAATAATGCAGACGG + Intergenic
921145171 1:212348265-212348287 ATGAGCAGTCATACAACACCAGG + Intronic
921815113 1:219554850-219554872 CTGTGCAGTGCTAAAACAACTGG - Intergenic
923364617 1:233247145-233247167 CTGAGCACGAATTAAACAGATGG + Intronic
1063178151 10:3570798-3570820 CTGAGCACTGATACCACAGCGGG + Intergenic
1064938330 10:20705199-20705221 CTTTCCAGTAATAAAACATCCGG + Intergenic
1066035838 10:31482785-31482807 ATAAGCAGTAATAAAACAAAAGG + Intronic
1066539011 10:36423969-36423991 CTGATAAGTAGTAAATCAGCGGG - Intergenic
1067330195 10:45308527-45308549 TTGATCAGTAACAAAACAACAGG - Intronic
1069262765 10:66419589-66419611 CTGAGCAAAAATAATAAAGCTGG + Intronic
1069420149 10:68239702-68239724 CAGAGCAGAAACAAAGCAGCAGG - Intergenic
1069749044 10:70734082-70734104 CTGAGCAGACATCACACAGCTGG + Intronic
1070190430 10:74107010-74107032 CTGAACACTAAAAGAACAGCTGG + Intronic
1071698057 10:87899266-87899288 CTAAGCAGAAAGAAAAAAGCTGG - Intronic
1071845538 10:89517700-89517722 TTGGGCAGTAACAACACAGCTGG + Intronic
1072121278 10:92407432-92407454 CTGAGTAATAATAAAACTGTAGG - Intergenic
1073857059 10:107688929-107688951 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1074208689 10:111308066-111308088 CTGAGGAGTAAGAAAACAGTAGG - Intergenic
1077202051 11:1313812-1313834 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1078889145 11:15538388-15538410 CTGAACAGCAAAAAAACAACTGG + Intergenic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1080276141 11:30505191-30505213 CTGAGCAGCAATAAAATCTCTGG - Intronic
1081221229 11:40465014-40465036 CTAAGCAGAAAGAACACAGCTGG + Intronic
1084734197 11:71093971-71093993 CGGAGCAGTAAGACAGCAGCAGG + Intronic
1084986692 11:72880322-72880344 CTGAGCAAAAATAATAAAGCTGG + Intronic
1085034952 11:73294027-73294049 CTGAGGAGAAAGAAAACTGCTGG - Intronic
1085817202 11:79751947-79751969 CTGAGCAAAAAGAACACAGCTGG + Intergenic
1087236841 11:95729340-95729362 TTAAGCAGTAATAAAATAGTAGG - Intergenic
1087566138 11:99860738-99860760 CTGAGCAAAAATAACAAAGCTGG - Intronic
1088385807 11:109254149-109254171 CTGAGCAAAAAGAACACAGCAGG - Intergenic
1088437241 11:109828078-109828100 CTGAGCAGAAATGAAACTTCAGG + Intergenic
1092559731 12:9599766-9599788 CAGAGCAGGAATAAAACAACAGG - Exonic
1093257592 12:16889534-16889556 CTGAGCAAAAATAATAAAGCTGG + Intergenic
1099034351 12:77566618-77566640 CTATGCCGTAATGAAACAGCTGG + Intergenic
1101103144 12:101414380-101414402 GTGAGAAGTATTAAAACATCAGG - Intergenic
1103018303 12:117513376-117513398 CTGAGCAGTGATCAAGCAACTGG + Intronic
1106779861 13:33048337-33048359 CTGAGAAGTAAGAACAAAGCAGG - Intronic
1107669953 13:42734968-42734990 CAGGGCCATAATAAAACAGCAGG + Intergenic
1109282672 13:60375114-60375136 CTGGGCAAGAATAAAAAAGCTGG + Intergenic
1109404589 13:61879985-61880007 CTGAGCACTAATAGAATAGATGG + Intergenic
1109529868 13:63628010-63628032 TTGTGAAGTAAAAAAACAGCGGG - Intergenic
1109777833 13:67066200-67066222 CTTAACAGTCATTAAACAGCAGG + Intronic
1111030813 13:82595800-82595822 CTGAGCAAAAATAAGAAAGCTGG + Intergenic
1111490919 13:88974042-88974064 CTGAGCAATAAGAACACAACTGG + Intergenic
1111846273 13:93513202-93513224 CTGAGCTGTAATAAAAAAGGTGG - Intronic
1111990786 13:95114841-95114863 CTGAGCATTGAGAAAAAAGCAGG + Intronic
1115092044 14:29588909-29588931 CTGAGCAGAAACAACTCAGCAGG + Intronic
1115926652 14:38443145-38443167 CTGTGCAGTCATAAAAAAGAAGG - Intergenic
1116543221 14:46126795-46126817 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
1116703016 14:48263949-48263971 CTGAGGAGTAGTAGAATAGCAGG + Intergenic
1117080434 14:52146289-52146311 CTAAGCAAAAATAACACAGCTGG - Intergenic
1120588072 14:86340582-86340604 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1121998569 14:98626765-98626787 CTGAGCAGTCATAACAAATCGGG - Intergenic
1124875649 15:33590345-33590367 CTGAGCAAAAATAACAAAGCTGG - Intronic
1125262083 15:37837835-37837857 ATCAGGAGTAATAAGACAGCAGG + Intergenic
1126807403 15:52365227-52365249 CTGGGAAGTAATAGGACAGCAGG - Intronic
1127047347 15:55041136-55041158 CTGAGCAAAAATAAGAAAGCTGG - Intergenic
1127397986 15:58558368-58558390 GTGAGAAGTAAGAAAACAGCTGG - Intronic
1127461500 15:59203339-59203361 CGGAGCAGTAACAAATCACCAGG + Intronic
1128197248 15:65770082-65770104 GTGAGCAGAAATAGAGCAGCAGG - Intronic
1129543808 15:76373990-76374012 CTGGGCAGGAATAAAAGAGATGG - Intronic
1129927714 15:79380913-79380935 CTGAGCTGTAAAAAAACTGCAGG - Intronic
1133544686 16:6794408-6794430 CTGAGCAATAGAAAAGCAGCAGG - Intronic
1133909408 16:10051374-10051396 GTGAGTAGTAATAAAACATTGGG + Intronic
1136777515 16:32879681-32879703 CTGAGTAGTAGTCAAACAGCTGG + Intergenic
1136893108 16:33981833-33981855 CTGAGTAGTAGTCAAACAGCTGG - Intergenic
1138463007 16:57164061-57164083 CTGAGCTGTAACAAAACACATGG + Exonic
1203079929 16_KI270728v1_random:1141790-1141812 CTGAGTAGTAGTCAAACAGCTGG + Intergenic
1143050730 17:4123480-4123502 CAGAGCAGAAATAAGACAGAAGG + Intronic
1144040237 17:11404002-11404024 ATGTGCAGGAATAAGACAGCAGG - Intronic
1144077074 17:11729135-11729157 CTGAGCAGTAGGAAAACTGGTGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149987598 17:61359400-61359422 CTGGGCAGTGGTAGAACAGCGGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150940123 17:69683783-69683805 CTAAGCAGAAATAACAAAGCTGG - Intergenic
1152147139 17:78575175-78575197 CGGAGCAGGAACAAAACAGTTGG + Intronic
1153722386 18:7919236-7919258 CTGAGCAAAAAGAAAAAAGCTGG - Intronic
1156174781 18:34530998-34531020 CTGTGCAGTCATAGAATAGCTGG + Intronic
1156288928 18:35728068-35728090 CTAAGCAAAAATAACACAGCTGG + Intergenic
1159217275 18:65409703-65409725 ATGAGCAGTTATATAAAAGCTGG - Intergenic
1160011851 18:75112030-75112052 CTAAGCAGTAATAATAAATCTGG + Intergenic
1160413510 18:78690323-78690345 CAGACCAGGAACAAAACAGCAGG + Intergenic
1162120632 19:8464819-8464841 CTGCGCAGTAAAACAACATCTGG - Intronic
1167260175 19:48453868-48453890 CTGAGCAGCAATAAAGGACCAGG + Exonic
925715221 2:6778830-6778852 GTGAACACAAATAAAACAGCTGG - Intergenic
926807540 2:16724940-16724962 CTGAGCATCAATAATGCAGCAGG + Intergenic
927587812 2:24324468-24324490 CTAAGCAGTAAACAAACAGATGG - Intronic
928709966 2:33993060-33993082 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
928878502 2:36069674-36069696 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
929578037 2:43064895-43064917 CAGAGCAGGAATAAAGCAGCAGG - Intergenic
931411510 2:62036839-62036861 ATGAGCAGTAATCAAAAAGCAGG - Intronic
932160266 2:69453399-69453421 CTGAGAAATAATAGAACAGTGGG - Intergenic
933318989 2:80748266-80748288 TTGAACAGTAATAAAACAGATGG + Intergenic
933447630 2:82402450-82402472 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
934043790 2:88153951-88153973 CTTAGCAAAAATAAAAAAGCTGG + Intergenic
937464385 2:122118123-122118145 CTGAGCATTAAGAACAAAGCTGG - Intergenic
938099323 2:128487473-128487495 GTGAGCATAAACAAAACAGCTGG + Intergenic
938575722 2:132602093-132602115 CTGAGCAAAAATAACAGAGCAGG + Intronic
939153181 2:138496317-138496339 CTGAGCAGAGATAAAAGAGGAGG + Intergenic
939353859 2:141075690-141075712 CTGAGCTGAAATAACACAGATGG + Intronic
939482384 2:142765710-142765732 CTGAGGAAAAATAAAAAAGCTGG + Intergenic
939503794 2:143018578-143018600 CTAAGCAGAAATAACAAAGCTGG - Intronic
939650125 2:144749749-144749771 CTGAGAATTAAAAAAACAGAGGG + Intergenic
941556393 2:166988133-166988155 ATGAGCAGTAATAAGACATGTGG + Intronic
944209366 2:197190602-197190624 CTGGGGAAAAATAAAACAGCAGG - Intronic
945347442 2:208734761-208734783 CTGAGCAAGAAGAAAAAAGCTGG - Intronic
945576255 2:211533321-211533343 CTGAGCAGGGATACAACAGGAGG - Intronic
945824502 2:214704334-214704356 CTGAGCAAAAATTAAAAAGCTGG + Intergenic
947090269 2:226502388-226502410 CTGAGCAATAAGAACAAAGCTGG + Intergenic
947370056 2:229436281-229436303 CTGTGCAGTCATGAAAAAGCAGG - Intronic
948227043 2:236319211-236319233 CTCAGCAGTAATTGAACAGCAGG + Intergenic
948981007 2:241494738-241494760 CTGGGCAGTAATAAATTAGACGG - Exonic
1170983742 20:21239313-21239335 CTGAGAAGCAGTAAAACAGTAGG - Intronic
1175446780 20:59026123-59026145 ATCAGCAATAATAAAATAGCAGG + Exonic
1175485707 20:59344587-59344609 CTGAGCAGCAAGAGAACATCTGG + Intergenic
1176262885 20:64192190-64192212 CAGAGCAGTGATGAAAGAGCTGG - Intronic
1177927488 21:27236283-27236305 CTGAACAGTAATAAACCAGGTGG - Intergenic
1177946205 21:27472494-27472516 CTGATCTGTAAGAAAACAGCAGG + Intergenic
1179836432 21:44037292-44037314 CAGAGCACAAATAAAATAGCAGG - Intronic
1182027111 22:27128797-27128819 CTGAGCAGCAGCAGAACAGCAGG - Intergenic
1182458196 22:30465983-30466005 ATGAGCACAAATAAAACAGCTGG + Intronic
1183279933 22:36926582-36926604 CTGAGCAGTAATGACAGAGATGG + Intronic
949396437 3:3619113-3619135 CTGAGCACTAATAATATACCAGG - Intergenic
951380350 3:21976695-21976717 CTGAGAAATAATAAACCAGCTGG + Intronic
953220277 3:40964163-40964185 CTGAGCAAAAAGAAAAAAGCTGG - Intergenic
953356719 3:42262539-42262561 CTGAACAGTACAAACACAGCTGG - Intronic
953550653 3:43899961-43899983 CTGAGCTGAAATAATACAGAAGG - Intergenic
954478498 3:50772988-50773010 TTGAGCAAAAAGAAAACAGCTGG + Intronic
955868604 3:63412733-63412755 CTGAGCAGTATTAAAAGATAAGG + Intronic
960282589 3:115795080-115795102 CTGAGGATTAGTAGAACAGCAGG + Intergenic
961084101 3:124051824-124051846 CTGAGCAAAAATAACACAACAGG + Intergenic
962018707 3:131473111-131473133 CTGAGTAAGAATAAAAAAGCTGG + Intronic
962074000 3:132061485-132061507 CTAAGCAAAAATAAAAAAGCTGG - Intronic
964068173 3:152601579-152601601 CTGAGAAGTAGTAGAATAGCAGG - Intergenic
964446832 3:156768057-156768079 CTGGGCAATAATAGAACAGTGGG + Intergenic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
965713695 3:171580544-171580566 CTGAGGAGTAGTAGAATAGCAGG - Intergenic
965956149 3:174372555-174372577 CTGAGCAAAAAGAAAAAAGCTGG + Intergenic
968256140 3:197274154-197274176 CTGAGCAGAAATAATAAAACTGG + Intronic
969419115 4:7080749-7080771 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
970319382 4:14860741-14860763 ATGAGCAGAAATAAAATGGCTGG + Intergenic
970622967 4:17845334-17845356 ATGAGCAGTTGTAAAACAGGTGG - Intronic
970733658 4:19139946-19139968 TTGAGCAGGAAGAAAAAAGCTGG + Intergenic
975532028 4:75409871-75409893 CTGAGCAAAAAGAAAAAAGCTGG - Intergenic
977342512 4:95776580-95776602 CTGAGCAAAAAGAAAAAAGCAGG + Intergenic
977859875 4:101944118-101944140 CTGAGGAGTATTAAATCAGTTGG - Intronic
978047293 4:104146100-104146122 CTGAGCAAAAATAACAAAGCTGG - Intergenic
978601948 4:110437837-110437859 CTGAAAAGGAATAAAACAGAGGG + Intronic
979050541 4:115925252-115925274 CTGAGCAAAAATAACAAAGCGGG + Intergenic
981564476 4:146084369-146084391 CTGAGCAAAAATAACACATCTGG - Intergenic
982306149 4:153933403-153933425 CTGGGCTGAAATAAGACAGCAGG + Intergenic
982425948 4:155260516-155260538 CTGAGCAAGAAGAATACAGCTGG - Intergenic
982686080 4:158490534-158490556 CTAAGCAGTAAGAAGAAAGCTGG - Intronic
982834023 4:160100164-160100186 GGGAGCAGTAATGAAACAACAGG - Intergenic
982868603 4:160548864-160548886 CAGAGCAGTAATAAGAAAGCTGG - Intergenic
983029143 4:162777072-162777094 GTAAACAGTAATAATACAGCAGG - Intergenic
983381290 4:166997593-166997615 CTGAGCAGTAATTCAAGATCTGG + Intronic
983735926 4:171060155-171060177 CTGAGCAGTAATTACCCAGCTGG - Intergenic
984612823 4:181859631-181859653 CTGAGTAGTCTTAAAATAGCGGG - Intergenic
985052521 4:186006491-186006513 CTGAGCAAAAAGAACACAGCTGG - Intergenic
985379467 4:189377142-189377164 CTGAGCAGAAACACAACAGATGG + Intergenic
987136755 5:14906936-14906958 CAGAGCAGGAGTAAGACAGCGGG - Intergenic
987785357 5:22492252-22492274 ATAACCAGTAAGAAAACAGCAGG + Intronic
988520573 5:31941701-31941723 CTCAGCAGTATGAAAACAGCAGG - Intronic
991233378 5:64363528-64363550 CTAAGCAATAAGAACACAGCTGG - Intronic
992043996 5:72866455-72866477 CTCAGTAATAAAAAAACAGCTGG + Intronic
993361828 5:86986970-86986992 CTGAGCTTAAATAAAACAGAGGG + Intergenic
993400187 5:87439747-87439769 CTGAGCAAAAATAACAGAGCTGG - Intergenic
993921220 5:93805526-93805548 CTGAGCAGTAATAAAACAGCAGG + Intronic
994568027 5:101478548-101478570 CTTAGTAGGAAAAAAACAGCAGG + Intergenic
996949657 5:129110396-129110418 CTGAGCAGAGAAAGAACAGCAGG - Intronic
999293254 5:150441439-150441461 GAGGGCAGTGATAAAACAGCAGG + Intergenic
1005313294 6:24580216-24580238 GTGAGCAGTAATTACAGAGCAGG + Intronic
1005668609 6:28081882-28081904 ATGAGAAGTGATAAAACACCTGG + Intronic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006282156 6:33062142-33062164 CTGAGCTGTAATAAATTGGCTGG - Intergenic
1009664803 6:66661704-66661726 TTGGGCTGTAAAAAAACAGCTGG - Intergenic
1010296342 6:74201627-74201649 CTGAGAAGAAAGAACACAGCTGG - Intergenic
1010412291 6:75574242-75574264 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1011159760 6:84375953-84375975 CTGAGCAGAAAAAACAAAGCTGG - Intergenic
1012712514 6:102625731-102625753 CTGAGCAAAAATAAAACAATGGG - Intergenic
1015285643 6:131483725-131483747 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1016201325 6:141413212-141413234 CTGGGCATTGATAAAACTGCAGG + Intergenic
1017442897 6:154480240-154480262 ATGAGCATTAATGAAACAGCAGG - Intronic
1018300719 6:162399732-162399754 CAGAGCAGAAATACAAGAGCTGG + Intronic
1020256491 7:6505324-6505346 CTGTGCAGTGATCAAACACCAGG - Intronic
1022869567 7:34461887-34461909 CTAAGCAGAAAGAAAAAAGCTGG + Intergenic
1022869997 7:34467173-34467195 CTGAGCAGTACAAATAAAGCTGG - Intergenic
1023698609 7:42872194-42872216 CTGAGGAGTAGTAGAATAGCAGG + Intergenic
1024376761 7:48648390-48648412 CTGAGCTGAAATAATGCAGCAGG - Intergenic
1027455321 7:78384035-78384057 CTGAGCAAAAATAACAAAGCTGG - Intronic
1027747454 7:82095213-82095235 CTGAACTGTAATAAAAAAGAAGG - Intronic
1029250435 7:99232606-99232628 GTGGGCAGAAATAGAACAGCTGG - Intergenic
1030624851 7:111832922-111832944 GTTAGCAGTAATAAAACAAATGG - Intronic
1030946198 7:115724422-115724444 CTGATAAGACATAAAACAGCAGG + Intergenic
1035181989 7:157096322-157096344 CTGAGCAGGCGTAGAACAGCAGG - Intergenic
1035343478 7:158180933-158180955 CAGAGCAGTCAGAAAACAGAAGG - Intronic
1035384987 7:158465672-158465694 CTGTGCAGTGGTTAAACAGCTGG - Intronic
1035727788 8:1835248-1835270 CTGAGCAGTAAGTGAAGAGCGGG + Intronic
1037130382 8:15401738-15401760 CTGAGCAGGAATGAAAGAGTAGG - Intergenic
1038378480 8:27068461-27068483 CTGAGCAGAAAGAAAAAAGCAGG + Intergenic
1038728331 8:30102177-30102199 CTCAGCAGTAGTGAAAGAGCAGG - Intronic
1039102274 8:33953418-33953440 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
1042324775 8:67517099-67517121 TAGAGCAGTAAGAAAAGAGCAGG - Intronic
1044287561 8:90426837-90426859 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1046392814 8:113599030-113599052 CCGAACAGTCATCAAACAGCTGG - Intergenic
1046488242 8:114914087-114914109 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048516765 8:135118310-135118332 CTGTGCATTAATAAAGCAACTGG - Intergenic
1049920727 9:361496-361518 CTCATCTGTAATAAAACGGCTGG - Intronic
1051089666 9:13391619-13391641 CTGAGCAAAAAGAAAAAAGCTGG + Intergenic
1051251723 9:15166051-15166073 CTAAGCAGCAATAAAACTGAAGG + Exonic
1052678505 9:31657921-31657943 TTGAGCAAAAATAACACAGCTGG - Intergenic
1053444866 9:38145043-38145065 ATGAACAGTAATAAAATAGTAGG - Intergenic
1053548610 9:39050762-39050784 CTAAGCAGAAAGAAAAAAGCTGG + Intergenic
1053812729 9:41870823-41870845 CTAAGCAGAAAGAAAAAAGCCGG + Intergenic
1054617866 9:67316616-67316638 CTAAGCAGAAAGAAAAAAGCCGG - Intergenic
1055843710 9:80535704-80535726 CTAAGCAGTAAGAACAAAGCTGG + Intergenic
1056734342 9:89193796-89193818 TTGAGCAAAAATAACACAGCTGG + Intergenic
1058395989 9:104555049-104555071 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
1058798886 9:108525507-108525529 CTGACCCGGGATAAAACAGCTGG + Intergenic
1059951727 9:119470665-119470687 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1061166888 9:128928119-128928141 ATTAGCAGAAATACAACAGCCGG + Intronic
1061550243 9:131330314-131330336 CTTAGCACTAATTAAACAGCAGG - Intergenic
1186089599 X:6031065-6031087 CTTTGCATTAATATAACAGCTGG - Intronic
1187115566 X:16346815-16346837 CTGAGCTGTAATTAAATTGCTGG - Intergenic
1188402801 X:29768533-29768555 CTGAGGAATAACAAAACAACTGG + Intronic
1190599763 X:52078453-52078475 CTCAGCAGTAATAAAGCTGCAGG + Intergenic
1190608430 X:52169414-52169436 CTCACCAGTAATAAAGCTGCAGG - Intergenic
1190820763 X:53969672-53969694 CTGAGCAGTAAGAACAAAGCTGG + Intronic
1191654743 X:63584625-63584647 ATGAGCAGTAACAAAAAAGAAGG + Intergenic
1192009780 X:67256549-67256571 CTGAGCAGAAATAACAAAACTGG + Intergenic
1193552845 X:82919940-82919962 CTAAGCAGAAATGAAAAAGCTGG - Intergenic
1193562539 X:83037132-83037154 CTGAGCAAAAAGAAAAGAGCTGG + Intergenic
1193623863 X:83792751-83792773 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1195568675 X:106375091-106375113 CTAAGCAAAAATAAAAAAGCTGG + Intergenic
1196169138 X:112568056-112568078 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1196525190 X:116722540-116722562 CTGAGGAGTAGTAGAATAGCAGG + Intergenic
1196646615 X:118124673-118124695 CTGGTCAGTAATATAACTGCTGG - Intergenic
1196905565 X:120429697-120429719 CTCAACAGTAAAACAACAGCTGG - Intronic
1197107159 X:122730429-122730451 CTAAGCAAAAATAAAAAAGCTGG + Intergenic
1200102338 X:153694361-153694383 CCGAGTAGTAGTCAAACAGCTGG - Exonic
1201367238 Y:13221112-13221134 CTAAGCAGAAATAAAAAAGCTGG - Intergenic