ID: 993932315

View in Genome Browser
Species Human (GRCh38)
Location 5:93954957-93954979
Sequence AGGGAGAGCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 10, 1: 58, 2: 101, 3: 188, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993932315_993932324 25 Left 993932315 5:93954957-93954979 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 993932324 5:93955005-93955027 CACACCATGCTGCTGCTGCCAGG 0: 1
1: 6
2: 25
3: 77
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993932315 Original CRISPR AGGGAGAGCACAGTGACTGT GGG (reversed) Intronic