ID: 993935749

View in Genome Browser
Species Human (GRCh38)
Location 5:93999848-93999870
Sequence GCTGTAGTGAGAGTAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993935749_993935751 7 Left 993935749 5:93999848-93999870 CCTGATTTTACTCTCACTACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 993935751 5:93999878-93999900 TTTCCAAAATACCATATATTTGG 0: 1
1: 1
2: 21
3: 235
4: 1357
993935749_993935754 21 Left 993935749 5:93999848-93999870 CCTGATTTTACTCTCACTACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 993935754 5:93999892-93999914 TATATTTGGAACCATACAGTAGG 0: 1
1: 1
2: 12
3: 50
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993935749 Original CRISPR GCTGTAGTGAGAGTAAAATC AGG (reversed) Intronic
903711044 1:25324717-25324739 GCTGTTGTGAGGATAAAATCAGG - Intronic
903715903 1:25366712-25366734 ACTGTTGTGAGGATAAAATCAGG + Intronic
903797020 1:25936993-25937015 GCTGTAGGGAGAGGAAACTCAGG + Intergenic
904043679 1:27598338-27598360 GGTGAAGTGAGAGTAAAGTGAGG - Intronic
907368106 1:53979294-53979316 GCTAGGGTGAGACTAAAATCTGG + Intergenic
910715173 1:90222712-90222734 GCTGTGATGAGAATAAACTCAGG - Intergenic
911426117 1:97714930-97714952 CATGTAGTGAGAGGCAAATCTGG - Intronic
911833537 1:102585312-102585334 GCTGGAGGGAGGGAAAAATCAGG + Intergenic
913989549 1:143598106-143598128 AATGTATTGAGAGTAAGATCAGG + Intergenic
915985894 1:160464031-160464053 GCTGTTGTGAGGATAAAATGAGG + Intergenic
916455693 1:164969257-164969279 GTTGTAGTGAGTGCAAAAGCAGG + Intergenic
918585591 1:186184010-186184032 TCTCTAATGAGAATAAAATCTGG - Intronic
918769303 1:188533646-188533668 GCTGGAGTGAGAGGAAGATCAGG + Intergenic
923082080 1:230667520-230667542 GCTGTAGTGAAGGTAAAACCAGG + Intronic
923702314 1:236311663-236311685 GCCATAGGGAGAGAAAAATCAGG + Intergenic
924908883 1:248487819-248487841 GGTGTGGTGAGGGTAAAATGAGG - Intergenic
924915223 1:248560239-248560261 GGTGTGGTGAGGGTAAAATGAGG + Intergenic
1062892372 10:1073857-1073879 GAGGTGGTGAGAGTAAAATGAGG - Intronic
1063420655 10:5910477-5910499 GCTGTGGGGAAAATAAAATCTGG - Intronic
1065073308 10:22050680-22050702 GCTTTAGTGTGAGCAAAAGCAGG + Intergenic
1066617635 10:37311686-37311708 ACAGTAGTGAGAGGAAAATGAGG + Intronic
1071491030 10:86136456-86136478 GCTCTGGAGGGAGTAAAATCCGG + Intronic
1072042637 10:91623828-91623850 ACTGTTGTGAGAGTTAAATGAGG + Intergenic
1072949015 10:99836146-99836168 GCTGAAGTGAGAGTAGATTGGGG - Exonic
1074030177 10:109679412-109679434 GCTGTACTGACATTAAAATATGG + Intergenic
1074290095 10:112131846-112131868 GCTGTAGAGAGGGTCAAATGCGG - Intergenic
1078713288 11:13815864-13815886 GCTGAAGGGAAAGTGAAATCAGG + Intergenic
1081271699 11:41092730-41092752 GTTGTAGTTAGACTAAAAGCAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1084055829 11:66632031-66632053 GCTGTTGGGAGAGTCAAATGAGG + Intronic
1085918029 11:80914861-80914883 GCGGTATTCAGAGTAGAATCAGG - Intergenic
1086201993 11:84214596-84214618 GCTGTACTGAGAGTGCAATCTGG - Intronic
1086609203 11:88733857-88733879 GCAGTAGTGAGAGAAAAATAGGG + Intronic
1088280244 11:108127799-108127821 GCTGTTATGAGAATAAAATGAGG - Intronic
1088994577 11:114985476-114985498 GCTGTGGTGAGAGTCAAATAAGG - Intergenic
1089191310 11:116655366-116655388 GCTGCAGTAAGAGTTAATTCTGG - Intergenic
1091855550 12:3736483-3736505 GATGCAGTGAGAGAAAGATCTGG + Intronic
1094531026 12:31275038-31275060 GCTGTAGTAAGAGCAAAATGAGG - Intergenic
1095291017 12:40480429-40480451 GCTGGAGTGATAGTGACATCTGG + Exonic
1095291089 12:40481146-40481168 GCTGGAGTGACAGTGACATCTGG + Exonic
1095291133 12:40481593-40481615 GCTGGAGTGACAGTGACATCCGG + Exonic
1095291158 12:40481800-40481822 GCTGGAGTGACAGTTACATCTGG + Exonic
1096911424 12:54988518-54988540 GCTGTAGTGAGTATAAGTTCTGG + Intergenic
1097998579 12:65916928-65916950 GGTGGAGAGAGAATAAAATCTGG + Intronic
1100122624 12:91386401-91386423 AATAAAGTGAGAGTAAAATCAGG + Intergenic
1101988421 12:109465386-109465408 GCTATAGTAAGAGTAATACCTGG + Intronic
1104343268 12:127971911-127971933 GTTGTCTTAAGAGTAAAATCTGG + Intergenic
1104658779 12:130593543-130593565 GCTGGAGGGAGAGGAGAATCTGG + Intronic
1105211321 13:18258754-18258776 GCTGTGGTGAGAGTGAAGTAAGG + Intergenic
1110317542 13:74128461-74128483 GCTGTGGTGAGGGTTAAATGGGG - Intronic
1110644044 13:77860596-77860618 GCTGTAGTAAGACATAAATCTGG - Intergenic
1111082815 13:83334949-83334971 GATGAAGTGAGAGGAAAATTAGG - Intergenic
1114740529 14:25092344-25092366 GCTGTAGAGAAAATACAATCAGG - Intergenic
1116100323 14:40425518-40425540 ACTATAGTGAGAATAAAATGAGG + Intergenic
1116516912 14:45815518-45815540 GCACTAGTGAGAGTAATATGTGG - Intergenic
1117729783 14:58710913-58710935 GATGGAGTGAGAGTAAATTTAGG + Intergenic
1118032418 14:61831699-61831721 ACTGAAGTGAAAGAAAAATCTGG - Intergenic
1118137952 14:63048367-63048389 TCTGCACTGAGACTAAAATCAGG + Intronic
1121405056 14:93714698-93714720 GCTGTACTGAAAATAAACTCAGG + Intergenic
1128506469 15:68276627-68276649 GCTGTATGGAGAATAAACTCTGG - Intergenic
1128867033 15:71121770-71121792 GCTGTCTTGAGAGGAAAATCAGG + Intronic
1128995564 15:72291922-72291944 TCTGTGGTGAGAGTACAACCTGG + Intronic
1129063841 15:72884176-72884198 GCTGTTGTGAGGGTTAAATGAGG + Intergenic
1129143746 15:73628383-73628405 TTTGCAGTGAGAGTACAATCTGG - Intronic
1129337003 15:74858482-74858504 GCTGTTGTGAGGGTTAAATGAGG - Intronic
1130517803 15:84639620-84639642 GCTGGGGTGAGAGTCAAGTCTGG + Exonic
1133310086 16:4839724-4839746 GATGTGGAGAGAGAAAAATCAGG + Intronic
1135521877 16:23183698-23183720 ACTGTAGTGAGGATTAAATCAGG + Intronic
1136620517 16:31425415-31425437 GCTGAAGTGAGAGAGAAATGAGG + Intronic
1137689389 16:50410960-50410982 GGGGAAGTGACAGTAAAATCAGG - Intergenic
1137896513 16:52218415-52218437 GCTGAAGTGGGAATAAAATGGGG - Intergenic
1140856583 16:78983287-78983309 GCTGGCGGGAGAGTAGAATCAGG + Intronic
1141253226 16:82377939-82377961 GCTGTTGTGAGAGTTAAAAGAGG + Intergenic
1148944560 17:51248755-51248777 GCTTTATTCATAGTAAAATCTGG - Intronic
1149207570 17:54266032-54266054 GCTCTAGGCAGAGTAAGATCAGG + Intergenic
1151000624 17:70371050-70371072 GCTGTTGAGAGAGTGAAATGAGG - Intergenic
1158178110 18:54680391-54680413 GCTTTAGTGTTAGCAAAATCCGG - Intergenic
1158211170 18:55051963-55051985 GCTGTTGTGAGAATTAAATGAGG - Intergenic
1160352819 18:78199280-78199302 GCTGTAGTCAGTTTAAAATGAGG - Intergenic
1161881496 19:6957305-6957327 GCTGTTGTGAGATTTAAATAAGG - Intergenic
1163311288 19:16516381-16516403 GCTGTAGTGAGGGAGAAAGCGGG + Intronic
1167835142 19:52061992-52062014 GCTGGAGGGAGAGTAGAATATGG - Intronic
927005032 2:18839658-18839680 CCTGCAGAGAGAGTACAATCTGG + Intergenic
927435590 2:23063705-23063727 GCGTTAGTGAGAGTGAGATCTGG - Intergenic
928223238 2:29422788-29422810 TCTGTAGGAAGAGTAAAACCTGG - Intronic
929773154 2:44909709-44909731 CCTGTTGTGAGAGTACAGTCTGG - Intergenic
931277965 2:60760892-60760914 GCTGTATTGAGAGTAATCTTAGG + Intronic
932067172 2:68576975-68576997 GCTGTGGAAAGAGTAAGATCGGG + Intronic
934019958 2:87937975-87937997 ACAGCAGTGAGAGCAAAATCTGG + Intergenic
937510985 2:122594658-122594680 GCAGTAGTTAGGGTAAACTCTGG - Intergenic
937673472 2:124563813-124563835 GCTGTAGTAAGAGGAAACACAGG + Intronic
939472878 2:142646991-142647013 ACAGTAGTCAGTGTAAAATCTGG + Intergenic
940331751 2:152482703-152482725 GCAGTAGTGAGACTCAAATGAGG + Intronic
941260496 2:163291238-163291260 TCTGACCTGAGAGTAAAATCAGG + Intergenic
942650318 2:178160137-178160159 GCTGGAGTGAGAGGGAAATAGGG - Intergenic
943193407 2:184710662-184710684 GCTGCAGTGAGAAAAAAATAAGG - Intronic
944005489 2:194899598-194899620 CCCATAGTGAGAGTAAAGTCAGG - Intergenic
944193223 2:197025682-197025704 GCTGTAATGAGAATAAAATACGG + Intronic
945825067 2:214711773-214711795 GTTGTATTGAGAGTTACATCAGG - Intergenic
947106272 2:226670965-226670987 GCTTTAGTGACAGACAAATCTGG + Intergenic
947296642 2:228637989-228638011 GCTGTAATAAAAGTAAAATAAGG + Intergenic
947700448 2:232229999-232230021 GCTGAAGTGAAAAAAAAATCTGG - Intronic
947832679 2:233152909-233152931 GCTGTACTGAGAATAAACTATGG + Intronic
1169703831 20:8480245-8480267 GCTGAACAGAGAATAAAATCCGG + Intronic
1170055184 20:12194359-12194381 GTTGTAGTGACAGTAAGATCAGG - Intergenic
1172457591 20:35090226-35090248 GCTATAGTGAGGATAAAATGGGG - Intronic
1177027606 21:15939251-15939273 GCTAAAGGGAGAGGAAAATCAGG - Intergenic
1180764914 22:18340683-18340705 GCTGTGGTGAGAGTGAAGTAAGG - Intergenic
1180814116 22:18779001-18779023 GCTGTGGTGAGAGTGAAGTAAGG + Intergenic
1181200300 22:21213336-21213358 GCTGTGGTGAGAGTGAAGTAAGG + Intronic
1181337961 22:22155114-22155136 GCTGTAATGAGAATGAAATGGGG + Intergenic
1181701438 22:24623623-24623645 GCTGTGGTGAGAGTGAAGTAAGG - Intronic
1203226536 22_KI270731v1_random:81588-81610 GCTGTGGTGAGAGTGAAGTAAGG - Intergenic
1203264214 22_KI270734v1_random:4688-4710 GCTGTGGTGAGAGTGAAGTAAGG + Intergenic
952247661 3:31612693-31612715 GCTGAATTGAGAGTATTATCGGG + Intronic
953083868 3:39647803-39647825 GCTGCAGTAAAGGTAAAATCTGG + Intergenic
953993493 3:47501875-47501897 TCTGTAGAGAGAGTGAAGTCTGG - Intronic
956793263 3:72696163-72696185 GCTGCTGTGAGAGTTAAATGAGG + Intergenic
956913807 3:73849741-73849763 GCGGTAGTGAGAGTTTAATAAGG + Intergenic
957468378 3:80625274-80625296 GCTGTACTCAGAGGAAAAACAGG + Intergenic
958803953 3:98786875-98786897 GATGTAGTGAGGGGAAAATACGG + Intronic
958845471 3:99260072-99260094 GCTGGAGGGAGAGTTAAATATGG + Intergenic
960469493 3:118044503-118044525 GAGGTGGTGAGAGTAAAACCAGG - Intergenic
962255260 3:133866089-133866111 GCTGTAGTAAGAATTAAATCAGG + Intronic
962843625 3:139256595-139256617 GCTGAAGTGAGAGGGAAATGGGG - Intronic
962876008 3:139536556-139536578 GCTGTAGTGAGAAGAAAAGGTGG + Intronic
969449815 4:7266558-7266580 GCTGTGGAGAGAGTAAAGACAGG - Intronic
970499357 4:16661528-16661550 GCTGTTGTGAGAATTAAATGAGG + Intronic
971718129 4:30208062-30208084 GCTTTAGTGAGATTAAAAAAAGG - Intergenic
973878852 4:55248611-55248633 GCTGTAGTGAAAATAAAACGAGG + Intergenic
975914700 4:79310365-79310387 GTTGTTGCGAGAGTAAAATAAGG - Intronic
976902902 4:90201330-90201352 GCTGTAGTGATAGGAAAAGAAGG + Intronic
977685205 4:99839278-99839300 GCTGCACTGAGAGTAATAGCAGG + Intronic
978404665 4:108366502-108366524 CTTGTAGAGAGAGAAAAATCAGG - Intergenic
979402380 4:120264731-120264753 GTTGAAGTGACAGTTAAATCTGG - Intergenic
982010518 4:151101549-151101571 TCTGGAGTGAGGTTAAAATCTGG + Intronic
982108687 4:152033593-152033615 GCTGCAGAGAGGGTAAAATAAGG + Intergenic
983917354 4:173307154-173307176 TCTGCAATGAGAGAAAAATCAGG - Intronic
984867166 4:184291232-184291254 GCTGTAGTGAGAGTATAAATTGG - Intergenic
985475115 5:74491-74513 GCTGTTGTGAGAGTTAACTGAGG + Intergenic
987304551 5:16625261-16625283 GCAGGAGTGAGAGTAAAAATAGG - Intergenic
990074850 5:51831785-51831807 GCGGAAGTGGGAGTAAATTCAGG - Intergenic
991145211 5:63294757-63294779 GCTTTACTGAGAGGAAAATTGGG + Intergenic
993084393 5:83346053-83346075 GTTTTAGTGAGAGTATCATCTGG + Intronic
993935749 5:93999848-93999870 GCTGTAGTGAGAGTAAAATCAGG - Intronic
994673788 5:102795686-102795708 GTTGGTGTGAGAGAAAAATCTGG + Intronic
995780831 5:115773678-115773700 GCTGTTGTGAGAATTAAATGAGG - Intergenic
996461009 5:123743045-123743067 CCTGAAATGAGAGTTAAATCTGG + Intergenic
996792666 5:127309440-127309462 GCTGGAGTAAGAGGAAAATGGGG - Intronic
997374682 5:133389272-133389294 GCTGCAGTGAGAGTAAACAGAGG - Intronic
997806587 5:136923988-136924010 GCTGTAGCAGGAGTAAAAGCAGG - Intergenic
999392714 5:151205811-151205833 GCTGGAGTGAGGGTAATAGCAGG - Intronic
1002620762 5:180486537-180486559 GGAGTAGTCAGAGGAAAATCAGG - Intergenic
1002796774 6:477978-478000 GATGTGGTGAGCGTAATATCTGG - Intergenic
1003422332 6:5969577-5969599 GCTGCAGTGAGAGAAAAAGCAGG + Intergenic
1004010340 6:11679916-11679938 GCTGTTGTGAGAATTAAATAAGG - Intergenic
1004990179 6:21128162-21128184 TGTGTACTGAGAGTAAAAACAGG - Intronic
1006980158 6:38141257-38141279 GCTGTAGTGAAAGGAAGAGCAGG - Intronic
1007661364 6:43488840-43488862 GCTGTAGTCAGAGCAACATGGGG + Intronic
1009456302 6:63860630-63860652 GATCTAGTGAGAATAAAATGGGG - Intronic
1009576091 6:65463043-65463065 GCTGTGGTGAGAGGGAAATACGG - Intronic
1013609393 6:111779878-111779900 GTTGTTGTGAGAATAAAATGAGG - Intronic
1022263251 7:28727886-28727908 GCTGTACTGAGGAGAAAATCAGG - Intronic
1029257349 7:99278550-99278572 GCGGCTGTGAGAGTAAAATCAGG - Intergenic
1036942319 8:13063635-13063657 TCAGTAATGAGAGTAAACTCAGG + Intergenic
1041869625 8:62618266-62618288 GCTAAAGTGAGAGTCAAATTTGG + Intronic
1049547460 8:143240012-143240034 GCTGGAGAGAGAGTGAAATGAGG + Intergenic
1053222691 9:36325314-36325336 GCTGTGATGAGAGAAAAAGCAGG - Intergenic
1054967723 9:71048819-71048841 GCTGATGTGAGAGGAATATCTGG + Intronic
1187209071 X:17211003-17211025 GCTGTAGTCAGGGAAAAAGCTGG - Intergenic
1187873286 X:23782272-23782294 GCAGTAGTCAGAGTAAAATAAGG - Intergenic
1191959100 X:66679941-66679963 GGAGTGGTGAGAGTATAATCTGG + Intergenic
1195821477 X:108949876-108949898 GTTGTAGTGAGAGCACAATATGG - Intergenic
1197353621 X:125406731-125406753 GCTGTTGTGAAGGTAAAATGAGG + Intergenic
1198595009 X:138226710-138226732 ACTGCAGTGAGAGTTAAATCAGG + Intergenic
1199124567 X:144101155-144101177 ACAGCAGTGAGAGCAAAATCTGG - Intergenic
1199461271 X:148088272-148088294 CTTTTAGTGAGAGTAAAAACAGG + Intergenic