ID: 993935852

View in Genome Browser
Species Human (GRCh38)
Location 5:94001458-94001480
Sequence CATCATTTGTAGTTGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993935851_993935852 2 Left 993935851 5:94001433-94001455 CCGTCTGTTTCATTATGCATATT 0: 1
1: 0
2: 1
3: 44
4: 461
Right 993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG 0: 1
1: 0
2: 1
3: 15
4: 108
993935850_993935852 16 Left 993935850 5:94001419-94001441 CCTTTCTCTCTCTTCCGTCTGTT 0: 1
1: 0
2: 17
3: 251
4: 1449
Right 993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG 0: 1
1: 0
2: 1
3: 15
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993935852 Original CRISPR CATCATTTGTAGTTGCCCCA TGG Intronic
906829638 1:49017828-49017850 CAATATTTGAAGTTTCCCCAGGG - Intronic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
908903409 1:68981724-68981746 TATAATTTGATGTTGCCCCAAGG + Intergenic
909670017 1:78177680-78177702 CATCATTTGCAGTGGCTCCTGGG + Intergenic
909892405 1:81024075-81024097 AATCTTTTATAGTTGCCTCAAGG + Intergenic
911042264 1:93600238-93600260 CACCATTTCCTGTTGCCCCAGGG + Intronic
911965189 1:104360010-104360032 CTTCATTCTTAGCTGCCCCATGG - Intergenic
917880396 1:179329995-179330017 CACCATTTGTAATTGCCCGTTGG + Intronic
923922646 1:238585813-238585835 CATCTTTTGGAGTTGTCCCCAGG + Intergenic
1064684665 10:17847718-17847740 CATCTTCTGTGGCTGCCCCAGGG + Intronic
1068864180 10:61877782-61877804 CATCATGTGTGGATGCCACAGGG + Intergenic
1069260896 10:66395295-66395317 CATCATTTGTAATTGCTTCAAGG + Intronic
1074231837 10:111545322-111545344 CATAGTGTATAGTTGCCCCATGG + Intergenic
1076288433 10:129324411-129324433 CATCATTTGAAAATGCTCCAAGG - Intergenic
1081390817 11:42526643-42526665 TATCATGTGTATTTGCTCCAGGG - Intergenic
1087142744 11:94781437-94781459 CATCTTTTGGACTTTCCCCATGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089642558 11:119857317-119857339 CATCATTTGTGGCTGCGCCCTGG - Intergenic
1089957718 11:122587452-122587474 CATCATTTCCATGTGCCCCATGG + Intergenic
1090468443 11:126956456-126956478 CCTCATTTGGAGTTTCCCCCTGG - Intronic
1091258098 11:134209270-134209292 AATCCTTTGAAGTTGCCCTAAGG + Intronic
1091328888 11:134714752-134714774 CATCCTTGGTGGCTGCCCCAAGG - Intergenic
1093401407 12:18751456-18751478 CATCATTTGAAGTTTCTACATGG - Intergenic
1095581311 12:43803319-43803341 TCCCAATTGTAGTTGCCCCAGGG + Intronic
1095973012 12:47917523-47917545 CCTCATTTGTACTTGCCTCAAGG - Intronic
1096331317 12:50715622-50715644 CATCATTAGCAACTGCCCCAGGG + Intronic
1100284833 12:93155398-93155420 TATCATTTGCTATTGCCCCACGG + Intergenic
1100794963 12:98172132-98172154 CATCATTTTTCCTTGACCCATGG - Intergenic
1101886055 12:108663394-108663416 CATTATTTGTAATAGCCCAAAGG + Intronic
1104815063 12:131640838-131640860 CAGCATTTGCAGATTCCCCAGGG - Intergenic
1106128356 13:26919824-26919846 AATCATTTGGAGCTGCCCCGGGG + Intergenic
1107546603 13:41439207-41439229 CATCATTTGTAAGCTCCCCAGGG + Intergenic
1110648880 13:77919702-77919724 CATCAGTAGTAGTTGCCCGAGGG + Exonic
1111492999 13:89008942-89008964 CATCTTTTGAAAGTGCCCCATGG - Intergenic
1112013809 13:95314678-95314700 CCCCATTTCTAGTTGCCCTAAGG - Intergenic
1118550325 14:66942762-66942784 CTTCTTTTCTAGATGCCCCAGGG + Intronic
1123694010 15:22863771-22863793 TTGCATTAGTAGTTGCCCCAAGG + Intronic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1135037672 16:19091621-19091643 CTTGAATTGTAGTTCCCCCAGGG + Intergenic
1135942311 16:26832839-26832861 TATCTTTTGTAGTTGTCCCACGG - Intergenic
1147682363 17:42258852-42258874 AATCATTTTTAGTTCCCCCTAGG - Intronic
1149147975 17:53520757-53520779 CATCATTTTTAAGAGCCCCAGGG + Intergenic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1155255614 18:23995611-23995633 CTTTATTTGTAATAGCCCCAAGG - Intronic
1155695338 18:28678285-28678307 CATTATTTGTAAGAGCCCCATGG + Intergenic
1155978576 18:32157787-32157809 CATTATTTGCAATTGCCACATGG + Intronic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1161260417 19:3334828-3334850 CATCATTTGTGATTGGCTCAGGG + Intergenic
1161606691 19:5219009-5219031 TAGCAATTGTAGTGGCCCCATGG - Intronic
1166629056 19:44389034-44389056 CATCCTTTTTATTTTCCCCAAGG + Intronic
1166638197 19:44470646-44470668 CATCCTTTTTATTTTCCCCAAGG - Intergenic
1167821882 19:51935875-51935897 CAGGATTTGTTGTTGCCCCAGGG + Intronic
934869519 2:97849832-97849854 AATTATTTGTTCTTGCCCCAGGG - Intronic
941266097 2:163365262-163365284 TATCTGTTGTAGTTGTCCCACGG + Intergenic
942142978 2:172996526-172996548 CTTCATTTAAAGTTGCCTCAAGG - Exonic
946102572 2:217338880-217338902 CTTTATTTGTAGTTTCACCAGGG + Intronic
946720543 2:222601706-222601728 TATTATTTGTGGTTGCGCCAGGG - Intronic
1169730218 20:8778093-8778115 AATCATCTGGAGTTTCCCCAGGG + Intronic
1170443408 20:16401011-16401033 CATCAATTTTAGTTGCCTGAGGG - Intronic
1182984222 22:34701362-34701384 CATTATTTGTAGTGACCACAGGG - Intergenic
951517374 3:23576044-23576066 CATTAACTGTAGTTGCCTCAAGG + Intronic
956047111 3:65207573-65207595 CATTATTTGTATTTGGCACAAGG + Intergenic
956831084 3:73048959-73048981 CATCAGTTATAGTTACCCCTGGG + Intronic
957655059 3:83063410-83063432 CAGCATTTGTATTTGCTGCAGGG + Intergenic
957761179 3:84558997-84559019 AATTATTTTTATTTGCCCCATGG + Intergenic
958546628 3:95560798-95560820 AATCTTTTGTAGTAGCCTCAGGG - Intergenic
960543130 3:118882534-118882556 CAACATTTGTTGGTGCCACAAGG + Intergenic
960621509 3:119641368-119641390 CACTATTTGTAATTGCCCCAAGG + Intronic
963235296 3:142949850-142949872 CACCTTTTGTAATTGCCCCACGG + Intronic
969376473 4:6766762-6766784 CATCATGTGGAGATGCCCTAAGG - Intergenic
971253011 4:24988937-24988959 AATCATTCCCAGTTGCCCCAGGG + Intergenic
974476670 4:62390302-62390324 CATCACTTGTCGTTGCCAGAAGG - Intergenic
975970032 4:80022767-80022789 GTTCATTTTTATTTGCCCCAAGG + Intronic
978033532 4:103967391-103967413 CATCCTTTGTAGTTGTCTCATGG + Intergenic
978282280 4:107033686-107033708 CTTAATGTGTAGTTCCCCCAAGG - Intronic
979463888 4:121014328-121014350 AGTCATTTTTAGTTGGCCCATGG + Intergenic
981942350 4:150295887-150295909 CTTCATTTGTTGTTTTCCCATGG + Intronic
985160812 4:187042384-187042406 CATCATTTGAATTTGACTCATGG - Intergenic
989093056 5:37754754-37754776 CTTCATTTCTAGTTGCTCGAAGG + Intergenic
991174174 5:63667589-63667611 CATTATTTATAGTAGCCCAAAGG + Intergenic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
995068362 5:107888761-107888783 CATTATCTGTAATAGCCCCAAGG - Intronic
995624970 5:114066445-114066467 CAGCATTTTTAATTTCCCCAAGG - Intergenic
996384290 5:122894480-122894502 CCTCATTGGTAGTGGCACCATGG + Intronic
998612023 5:143699735-143699757 CTTCTTTTGTACTTGCCCCTTGG - Intergenic
999401012 5:151264265-151264287 CATCATTTGTAATTTCCAAATGG + Intronic
999645475 5:153713046-153713068 CATCATTTCTAGCTGCCATATGG - Intronic
999888011 5:155945484-155945506 CATCATTTGTAGTTGCATGTTGG - Intronic
1000888954 5:166781710-166781732 CATCCTGTGTTATTGCCCCAGGG + Intergenic
1002337937 5:178493356-178493378 CATGCTTTGTAGTGGCCTCAGGG + Intronic
1008414376 6:51222716-51222738 CATCATTTGTAATAGCCAAAAGG - Intergenic
1011885573 6:92090735-92090757 CTTCTTCTGTAGTTTCCCCAGGG + Intergenic
1012328595 6:97956342-97956364 CATGTTTTGTAGCTGCCCCATGG + Intergenic
1013399158 6:109774324-109774346 CATGATTTTTAGTAGCCCTATGG + Intronic
1019573960 7:1727279-1727301 CATCATTTCTAGCTACCCCAGGG - Intronic
1024996729 7:55278198-55278220 CAGCATTTGGAGGAGCCCCAGGG + Intergenic
1026603037 7:71792475-71792497 CATTATTTGTAGTAGCCAAAAGG - Intronic
1029808957 7:103026761-103026783 CTTCTTTTGTGGTTGCCCCATGG - Intronic
1035529943 8:343266-343288 CATTATTTCTAGTCTCCCCAGGG - Intergenic
1037456912 8:19072932-19072954 CATCCTTTATAGTTGGGCCAAGG - Intronic
1039171707 8:34754888-34754910 CATCTTTTTTAGCTGCCACATGG - Intergenic
1039740050 8:40374628-40374650 CATCACTTGATTTTGCCCCAGGG + Intergenic
1040536613 8:48316367-48316389 CTTCATTTAGAGTTGACCCAAGG - Intergenic
1042057001 8:64774701-64774723 TATCATTTCTACTTGCCTCACGG + Intronic
1042207216 8:66341571-66341593 CACGATTTGAAGTTACCCCAGGG + Intergenic
1045919142 8:107509889-107509911 CTTCATTTGTAATAGCCCCAAGG - Intergenic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1048449226 8:134517798-134517820 CATCATTTGGATTTGTCCAATGG + Intronic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1051459565 9:17295769-17295791 CATCACTTGTACTTTCCCGAGGG + Intronic
1051798062 9:20898371-20898393 TAACTTTTGTAGTTGTCCCACGG + Intronic
1055689303 9:78811980-78812002 CAGCATTTTTAATTGCCTCAAGG - Intergenic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1056486571 9:87064142-87064164 CTTCATTTTTAGTTGAACCAAGG - Intergenic
1059956431 9:119520918-119520940 GTTCATTTGTATTTGCTCCAAGG + Intronic
1061255308 9:129451773-129451795 CAAGATTTTTTGTTGCCCCAGGG + Intergenic
1190151630 X:47954770-47954792 CAGCATTTGGATTTGCCACAAGG - Intronic
1190161060 X:48031665-48031687 CAGCATTTGGATTTGCCACAAGG + Intronic
1193663824 X:84290701-84290723 CATCATTTGAAGTGATCCCATGG + Intergenic
1198059319 X:133028735-133028757 CACTTATTGTAGTTGCCCCATGG - Intronic
1198343884 X:135740979-135741001 CATCATTCGCAGGTGCCCTAGGG + Intergenic
1200184638 X:154174441-154174463 CATCCTCTTTAGTTTCCCCAGGG - Intergenic
1200190291 X:154211579-154211601 CATCCTCTTTAGTTTCCCCAGGG - Intergenic
1200196042 X:154249381-154249403 CATCCTCTTTAGTTTCCCCAGGG - Intergenic
1200201697 X:154286499-154286521 CATCCTCTTTAGTTTCCCCAGGG - Intronic