ID: 993939166

View in Genome Browser
Species Human (GRCh38)
Location 5:94038390-94038412
Sequence TACTGTTAGCTTAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993939166_993939170 -8 Left 993939166 5:94038390-94038412 CCCACCTCCTTAAGCTAACAGTA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 993939170 5:94038405-94038427 TAACAGTATTTTTCTAAATTTGG 0: 1
1: 0
2: 1
3: 56
4: 630
993939166_993939172 17 Left 993939166 5:94038390-94038412 CCCACCTCCTTAAGCTAACAGTA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 993939172 5:94038430-94038452 AAATTATCCAAACTTATTAAGGG 0: 1
1: 0
2: 1
3: 34
4: 468
993939166_993939171 16 Left 993939166 5:94038390-94038412 CCCACCTCCTTAAGCTAACAGTA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 993939171 5:94038429-94038451 GAAATTATCCAAACTTATTAAGG 0: 1
1: 0
2: 0
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993939166 Original CRISPR TACTGTTAGCTTAAGGAGGT GGG (reversed) Intronic
905585567 1:39114879-39114901 AACTGTTACCTAAAGGATGTGGG + Intronic
912080818 1:105933543-105933565 TACTGTTTGCTTAATCAGATTGG - Intergenic
913260399 1:116992372-116992394 TACTGTTGGCACAAGTAGGTTGG - Intergenic
916812599 1:168318482-168318504 TTCTGTTAACTTGAGCAGGTGGG + Intergenic
921187077 1:212679288-212679310 TACTGTTTTCTTTTGGAGGTGGG + Intergenic
922383747 1:225060459-225060481 TACTCTGAGCTAAAGGAGGAAGG - Intronic
923254686 1:232211377-232211399 TGCTGTTAGATGGAGGAGGTCGG + Intergenic
924299251 1:242620461-242620483 TAGTGTTAGCTTAAACAAGTAGG + Intergenic
1062978562 10:1702915-1702937 TACTGTTATCTTCAGATGGTAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064505755 10:16027987-16028009 TTCTGTGCTCTTAAGGAGGTCGG + Intergenic
1067653489 10:48173947-48173969 TCCTGGCAGCTTAAGCAGGTAGG - Intronic
1068533876 10:58218421-58218443 TCCTTTTTGCTTAAGGTGGTTGG - Intronic
1072181751 10:92989783-92989805 TATTGTCAGTTTAAGGAGGCAGG + Intronic
1072643149 10:97229374-97229396 TACTGCTGGCTTAATGAAGTAGG + Intronic
1072930551 10:99658853-99658875 TACTGTAAGGTCAAGGAGGGCGG + Intergenic
1073302855 10:102481456-102481478 TAGTGATAGGTGAAGGAGGTTGG - Intronic
1073858351 10:107705450-107705472 GACTATTAGCTTAAGTAGGTGGG - Intergenic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1083651027 11:64204895-64204917 TGCTGTTAGATTTAGGAGTTGGG + Intergenic
1093355093 12:18157240-18157262 TATTGTTAACTGAAGGAGTTTGG - Intronic
1095754974 12:45754744-45754766 AACTGTGAGCCTGAGGAGGTAGG + Intronic
1096564662 12:52468650-52468672 TACTTTTAACTTAGGGAGTTTGG + Exonic
1100147930 12:91699983-91700005 TACTTTGAACTGAAGGAGGTTGG - Intergenic
1101259053 12:103010576-103010598 TACTGGTATTTTCAGGAGGTAGG + Intergenic
1106457617 13:29940946-29940968 AGCTGTTAGCTTAAGGACATTGG - Intergenic
1113896169 13:113765945-113765967 TTCTGTTATCTAATGGAGGTTGG + Intronic
1114262538 14:21048426-21048448 GCCTCTTAGCTTAGGGAGGTGGG + Intronic
1115565702 14:34623409-34623431 GAATGTTAGCCTAAGGAGTTTGG + Intronic
1115675203 14:35665906-35665928 TATTATCTGCTTAAGGAGGTGGG + Intronic
1117647726 14:57869592-57869614 TACTTTTAGCCCAAGGAGATAGG - Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118944443 14:70371310-70371332 TTTTGTTTGCTTTAGGAGGTAGG - Exonic
1120614201 14:86682026-86682048 TATTGTTATCTTCAGGAGGGTGG + Intergenic
1126182936 15:45803807-45803829 TACTTTTGGCTTGAGGAGGAAGG + Intergenic
1130927532 15:88396652-88396674 TTGTGTTAGGTTAAGGAGGGAGG + Intergenic
1132014513 15:98303845-98303867 TACTGTTATTTTTAGGAGGAGGG - Intergenic
1133187455 16:4110126-4110148 AACTGTGAGCTCACGGAGGTTGG + Intronic
1136750043 16:32626788-32626810 TACTGTAAGTTTTAGGAGGCAGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1203052171 16_KI270728v1_random:885987-886009 TACTGTAAGTTTTAGGAGGCAGG + Intergenic
1144648050 17:16988646-16988668 TAGTTTTACCCTAAGGAGGTAGG - Intergenic
1146516777 17:33495683-33495705 CCCTGTTAGCTTCAGGAGGGTGG - Intronic
1148840957 17:50496772-50496794 AATGGTTAGTTTAAGGAGGTTGG + Intergenic
1151481924 17:74374707-74374729 TATTCTTTGCTTAAGGAGGAGGG + Intergenic
1155822519 18:30396667-30396689 TATTGTAAGCTTAACTAGGTGGG - Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
928647584 2:33370986-33371008 TACTGGTAGGTGCAGGAGGTAGG + Intronic
928991057 2:37233160-37233182 TACTTTTAGCTTGAGCAGTTGGG + Intronic
929960109 2:46490056-46490078 TACAGATAGCTTCAGGAGGTAGG + Intergenic
933582990 2:84148392-84148414 TACTGTTACCTTAATGTAGTGGG + Intergenic
939153375 2:138498084-138498106 AAGTGTTAGCTTATGGAAGTTGG + Intergenic
939951983 2:148486348-148486370 TCCTGCTAGGTTAAGGAGGTAGG + Intronic
940911211 2:159211590-159211612 TTCTGTTTGCTTAAGCATGTGGG + Intronic
941552715 2:166936955-166936977 TATTGGTAGCTTAATGAGGATGG + Intronic
941781677 2:169452356-169452378 TCCTTTTATATTAAGGAGGTTGG - Intergenic
942049658 2:172127321-172127343 TACTGTGAACTTCAGGAGCTGGG + Intergenic
943900443 2:193427304-193427326 TGCTGTTAGGTTGAGGAGCTAGG - Intergenic
944522767 2:200588281-200588303 TTCTGTGTGCTTAAGGAGGTAGG + Intronic
945272722 2:207957929-207957951 TACTGATATCTTAAGGATGAAGG + Intronic
947773654 2:232690701-232690723 GACTGTAAGCTTTATGAGGTGGG + Intergenic
1173200592 20:40952011-40952033 TAATGTTAGCTTAATTAGGGAGG - Intergenic
1173945991 20:46951426-46951448 TACAGCTAGCTTAAGCAGGAAGG - Intronic
1173977138 20:47195552-47195574 TACTGTTAGCTCAAAGAAGGAGG + Intergenic
1175506467 20:59488869-59488891 TACTGTTTGCATAAAGAAGTTGG + Intergenic
1181973302 22:26710230-26710252 TACTGAGAGCTGGAGGAGGTAGG - Intergenic
949867674 3:8559872-8559894 TACTGTTTGCTTAAAGGGGCTGG + Intronic
952010936 3:28900598-28900620 CCCTGTAAGCTTAAGGAGATAGG - Intergenic
953590663 3:44249855-44249877 TGATGCTAGATTAAGGAGGTTGG + Intronic
960449608 3:117790365-117790387 TTCAGTCAGCTTAAGGAGATGGG - Intergenic
963677519 3:148331241-148331263 TACTGCTAGCTTAATAAGATGGG + Intergenic
964278410 3:155034103-155034125 TACTGTTAAGTTGAGGAGGAAGG - Intronic
964630452 3:158803911-158803933 TAATGTTAGCTTAAGGACAAAGG - Intronic
972928188 4:44038638-44038660 TATTGTAAGCTTAATTAGGTGGG + Intergenic
974572337 4:63669215-63669237 CACTGTTAGCCTAATGGGGTTGG + Intergenic
978820075 4:112956895-112956917 TAATGTAAGGTTAGGGAGGTAGG + Intronic
980937672 4:139241823-139241845 TACAGTTAGCTTAAGGAATCTGG - Intergenic
981306293 4:143249891-143249913 TACTTTTAACCAAAGGAGGTTGG - Intergenic
982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG + Intergenic
984996906 4:185442636-185442658 TACTGCTGGCTTAAGGAATTGGG - Intronic
987635633 5:20536967-20536989 GACTGTTAGATTAGTGAGGTAGG - Intronic
987899818 5:23997306-23997328 TACTGTTAGAGTAAGTAGTTAGG + Intronic
990965034 5:61436999-61437021 TACTCTCAGTTTGAGGAGGTAGG - Intronic
991704620 5:69346320-69346342 TACTGTCAGCTTCAGGTGGGGGG + Intergenic
992002205 5:72446712-72446734 TACTGTTAGCAGAAGTATGTTGG - Intronic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
994627863 5:102243332-102243354 TTCTGTTTGCTTAAGGACCTGGG - Intronic
999712503 5:154331174-154331196 TACTGTATGCCTAAGGAGCTGGG - Intronic
1006432181 6:34003736-34003758 TACTGCTAGCATGAGCAGGTGGG - Intergenic
1007133602 6:39499691-39499713 TACTGATAGCTCAAGGGGGAAGG - Intronic
1010295499 6:74191728-74191750 TTCTGTTAGCTTTAAGGGGTTGG + Intergenic
1010756620 6:79672743-79672765 TACTCTTAAATTAAGAAGGTAGG + Intronic
1011489307 6:87874310-87874332 TACTTTGAACTGAAGGAGGTGGG - Intergenic
1016422156 6:143896713-143896735 AAATGGAAGCTTAAGGAGGTTGG + Intronic
1016568241 6:145483190-145483212 TACTTTTAACTTTAGGAGGTAGG - Intergenic
1016833447 6:148454692-148454714 CACTGTCAGCGTGAGGAGGTGGG + Intronic
1017692163 6:156977865-156977887 TACTTTAAGCTTTGGGAGGTGGG + Intronic
1018692314 6:166356923-166356945 TCCTGTTAGGTACAGGAGGTGGG - Intergenic
1020732224 7:11894671-11894693 TACTGATAACTTTAGTAGGTAGG - Intergenic
1022576017 7:31497901-31497923 TATTTTTAGCTGAAGGAGATTGG - Intergenic
1024669483 7:51579723-51579745 TTTTGTTAGCTTAAGGTGGATGG + Intergenic
1030582924 7:111382873-111382895 TACTGTTAGCTAAAGGTGCCCGG - Intronic
1030747621 7:113186700-113186722 TATTGTTAGAGTAAGGAGGGCGG - Intergenic
1032431801 7:131868161-131868183 TCCTCTTAGCTTCAGGATGTGGG + Intergenic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1034124877 7:148662509-148662531 TCCTGTGAGCTCCAGGAGGTTGG - Intergenic
1039214295 8:35251886-35251908 TACTGTTAACCAAAAGAGGTGGG + Intronic
1044452824 8:92358152-92358174 TACTGTTGGCTTAAGGAATTTGG + Intergenic
1051537570 9:18177818-18177840 TACAGCTAGCTTAAGGAAGAAGG + Intergenic
1051972576 9:22908468-22908490 TACTGTGTCCTTATGGAGGTAGG - Intergenic
1051976455 9:22955895-22955917 AACTGTTATCTTAAGCATGTTGG - Intergenic
1054147654 9:61574789-61574811 AACTGATAGCTTCAGGATGTGGG + Intergenic
1055984330 9:82040831-82040853 TAATGGTAGCTTAAGGATGGTGG - Intergenic
1056221670 9:84456007-84456029 AAATGTTAACTTAAAGAGGTGGG + Intergenic
1058796027 9:108498963-108498985 TACTCTGAGCTAAAGGAGGAAGG + Intergenic
1058941804 9:109820469-109820491 AACTGTTAGCTTAAGGCCCTTGG + Intronic
1059959642 9:119552465-119552487 TACTGCTAGCTTTAGGAGTGGGG - Intergenic
1190315522 X:49148089-49148111 TCCTCTTAGCTTAAGCAGGCTGG + Intergenic
1191631210 X:63324035-63324057 TACTGTAAGCTTAACCAAGTGGG + Intergenic
1195640484 X:107169413-107169435 CACTGTTACCTTAAGGAAATTGG - Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1201573286 Y:15436116-15436138 TACTGTTGCCTTAGGCAGGTTGG - Intergenic