ID: 993940549

View in Genome Browser
Species Human (GRCh38)
Location 5:94052818-94052840
Sequence ACCAGGGAGTTGAACGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993940549 Original CRISPR ACCAGGGAGTTGAACGCTCA AGG Intronic
902825868 1:18973914-18973936 ACCCTGGAGTTGATCGATCAGGG + Intergenic
906458913 1:46022514-46022536 ACCAGGGACTTGGAAGCCCATGG - Intronic
910425929 1:87120088-87120110 ACAAGTGTGTTGAACCCTCAGGG - Intronic
912780672 1:112544156-112544178 GCCAGGAAGTTGACCGCTTAGGG + Intronic
915545166 1:156592874-156592896 ACCAGGGAGATGAAAGGGCAAGG - Intronic
915893901 1:159796180-159796202 CCCTGGGAGTTGGACACTCATGG - Intergenic
1064033812 10:11899750-11899772 AACAGGGAGGTGAAGACTCAGGG + Intergenic
1069770096 10:70893187-70893209 ACCAGGGAGGTGAGCTCACAGGG + Intergenic
1073052902 10:100680905-100680927 TCCAGGGTGCTGAACGCGCACGG - Intergenic
1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG + Intergenic
1073470544 10:103719410-103719432 ACCAAGGAGCTGAAGGCTCAGGG - Intronic
1078673368 11:13385424-13385446 TCCAGGCAGTTGAATGCTCTTGG + Intronic
1090268233 11:125368226-125368248 ACCAGGGAGATGACCCCTAATGG + Intronic
1092287656 12:7138197-7138219 ACCTGGGAGTAGAATGGTCAGGG - Intronic
1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG + Intergenic
1098493693 12:71111213-71111235 AATAGGAAGTTGAAGGCTCACGG + Intronic
1100007189 12:89908687-89908709 TCCAGGTAGTTGAACCCGCACGG + Intergenic
1102799461 12:115718791-115718813 AGCAAGGAGGTTAACGCTCAGGG - Intergenic
1103005611 12:117417966-117417988 ACCAGGGAGTTGAATAACCAGGG - Intronic
1107258316 13:38458089-38458111 AACAGGGATATGAAAGCTCAAGG - Intergenic
1108273495 13:48785446-48785468 ATCAGGGACTTGAACATTCATGG - Intergenic
1109784430 13:67155937-67155959 ATCAGGGAGGTGAACGTTCCAGG - Intronic
1112090184 13:96075041-96075063 ATCAGGGATTTGAATGTTCATGG - Intergenic
1113406392 13:110044711-110044733 ACCAGGGAGTCTAACTCACACGG + Intergenic
1118815988 14:69314372-69314394 GCCAGGGCTTTGAACTCTCATGG - Intronic
1119646520 14:76352564-76352586 ACCTGGGATTTGAAGGCCCAGGG - Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126218682 15:46186672-46186694 ACCAGGTATTTGAAAGCTCATGG - Intergenic
1127608327 15:60612478-60612500 ACCAGGGAATTGTTCGCTAAAGG - Intronic
1128442625 15:67726753-67726775 ATCAGGGACTTTAACGCTAATGG - Intronic
1130744023 15:86631218-86631240 CCCAGGGACTTGAAAGCTTAAGG - Intronic
1132154527 15:99486345-99486367 GCCAGGGATTTGCACGCTCGGGG - Intergenic
1132346845 15:101113780-101113802 CCCAGGGAGTTGAGACCTCAGGG - Intergenic
1132426920 15:101725083-101725105 TCCAGGAAGTTTCACGCTCATGG - Intergenic
1134047009 16:11108410-11108432 ACCAGGGAGTTAAACCCTCAGGG + Intronic
1136078804 16:27838322-27838344 AACAGGGAGATGAAGGCTCATGG - Intronic
1141289282 16:82702800-82702822 ACCAGGGAGCTGAACCCTGGGGG - Intronic
1143887051 17:10072529-10072551 ACCTGGAACTTGAATGCTCATGG - Intronic
1144480352 17:15623557-15623579 ACCAGGGAGTAGGTCACTCAAGG + Exonic
1146689979 17:34866624-34866646 AACAGGGATTTGAAGTCTCAAGG + Intergenic
1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG + Intergenic
1166547915 19:43645058-43645080 ACCAAGGTGTTGAAGTCTCACGG - Intergenic
944110926 2:196130610-196130632 ACCAGGGAGGGGAACAGTCAGGG - Intergenic
1173906463 20:46633321-46633343 ATCAGGCAGGTGAAGGCTCAGGG + Intronic
1178704630 21:34863189-34863211 AACAGTGAGTAGAAAGCTCAGGG - Intronic
1182260685 22:29071595-29071617 ACCAGGGACTTGAAAGCGCCCGG + Intergenic
1182800917 22:33031430-33031452 ACCAGGGAGTTGAAAGGAGATGG - Intronic
951579511 3:24147412-24147434 CTCAGGGAGTAGAACGCTCCAGG + Intronic
954904386 3:54047444-54047466 ATCAGGGAGTTGAGCACCCACGG - Intergenic
956749165 3:72332596-72332618 GGCAGGGAATTGAACTCTCAGGG + Intergenic
961443480 3:126966830-126966852 CTTAGGGAGCTGAACGCTCATGG + Intergenic
962498449 3:135965877-135965899 ACGAGGGAGCTGAAGGCTCCAGG - Intronic
963301108 3:143598052-143598074 ACCAGGGACTGGAGAGCTCAGGG - Intronic
967036559 3:185652478-185652500 ACCAGGGAGTCAAAAGCTCTAGG + Intronic
967275216 3:187767811-187767833 ACCAGGAAGGTGAAGGCTGATGG + Intergenic
985081384 4:186268326-186268348 ATCAGGGACTTGAGCGTTCATGG + Intronic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
1002448779 5:179307403-179307425 ACCGGGCTGTTGAATGCTCATGG - Intronic
1003485963 6:6579898-6579920 AGCACTGAGTTGAACTCTCAAGG + Intergenic
1004289014 6:14349702-14349724 ACCAGGGTGATGAAAGCTCTTGG + Intergenic
1010838500 6:80618692-80618714 AGCCAGGAGTTGAACCCTCAAGG + Intergenic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1026807825 7:73438777-73438799 CCCAGGAAGTTGCCCGCTCAAGG + Intergenic
1027669249 7:81075499-81075521 ACCATGGAGTTGTACCCACATGG - Intergenic
1030531665 7:110718575-110718597 ACCAGGGAGTTAAAAGCACTTGG + Intronic
1032981759 7:137292189-137292211 ATCAGGGACTTGAACATTCATGG - Intronic
1041621415 8:59974408-59974430 ACCAGGGAGTAGAAATCTCGGGG - Intergenic
1043020275 8:74991475-74991497 ACAAGGGAGTTGACCACTCTGGG - Intronic
1047000747 8:120570101-120570123 ACCAGGGGGTTGAAGTCCCAGGG + Intronic
1047337987 8:123954516-123954538 ACCAGTGAGTGGAAGGCTCTAGG - Intronic
1051310532 9:15766235-15766257 ACAAGGGACTTTAACACTCACGG - Intronic
1051543886 9:18252424-18252446 ATCAGGGACTTGAACATTCAAGG - Intergenic
1057299111 9:93866232-93866254 GCAAGGGGGTTGAAGGCTCAAGG - Intergenic
1057602655 9:96472106-96472128 GCCAGAGAGTTGAAGGCGCATGG - Intronic
1062376346 9:136263547-136263569 ACAAGGGACTTGCACGATCATGG + Intergenic
1186411077 X:9344794-9344816 ACCAGGGAGTTGGAGGTTCAAGG - Intergenic
1188240201 X:27777416-27777438 ACAAGGCAGTTGAAGGCTTATGG + Intergenic
1191136317 X:57068819-57068841 TTCAGGGTGTTGAAAGCTCAAGG - Intergenic
1194925531 X:99819531-99819553 ACGAGTGAGTTGAACTGTCAAGG + Intergenic