ID: 993941227

View in Genome Browser
Species Human (GRCh38)
Location 5:94061412-94061434
Sequence TTGAACAAGAATAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993941227_993941229 7 Left 993941227 5:94061412-94061434 CCATCCTCACTATTCTTGTTCAA 0: 1
1: 0
2: 1
3: 53
4: 570
Right 993941229 5:94061442-94061464 CTGAAAGTCCTAGTCAACACAGG 0: 1
1: 0
2: 1
3: 4
4: 98
993941227_993941231 27 Left 993941227 5:94061412-94061434 CCATCCTCACTATTCTTGTTCAA 0: 1
1: 0
2: 1
3: 53
4: 570
Right 993941231 5:94061462-94061484 AGGCCACAAAGAAAAATAAAAGG 0: 1
1: 2
2: 10
3: 161
4: 1864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993941227 Original CRISPR TTGAACAAGAATAGTGAGGA TGG (reversed) Intronic
900788096 1:4662305-4662327 ATTTACAGGAATAGTGAGGATGG - Intronic
900917562 1:5649468-5649490 TTGAGCAAGATTACTGGGGAAGG + Intergenic
903388609 1:22946775-22946797 TTGAATAAGAATGGTGAGAGTGG - Intergenic
904573504 1:31485794-31485816 TTGAAAAAGAAAAGGGAGAAGGG + Intergenic
904787518 1:32993879-32993901 TTGAACAGGAAAAGTGAAAAGGG + Intergenic
905987233 1:42297307-42297329 TTGAACAAGAGTGGTGAGAGTGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
907705375 1:56828020-56828042 TTGAACAAGAGGACTGGGGATGG + Intergenic
908145681 1:61239743-61239765 TTGAACAATAATATTTAAGAAGG + Intronic
908614316 1:65900991-65901013 TTGAATAAGAGTAGTGAGAGTGG + Intronic
908818899 1:68062288-68062310 TTGAATAAGAATGGTAAGAAAGG - Intergenic
908929210 1:69296847-69296869 TTGAACAGGAGTAGTGAGAGAGG + Intergenic
909053710 1:70797985-70798007 TTGAACAAGAATGGTGAGAGAGG + Intergenic
910140743 1:84024862-84024884 TTGGACAATAATATAGAGGATGG - Intergenic
910254428 1:85233584-85233606 TTGAATAGGAATGGTGAGAATGG + Intergenic
910983082 1:92977932-92977954 AGGAGCAAGAATAGGGAGGATGG - Intergenic
912609304 1:111027389-111027411 TTGAACAGGAGTGGTGAGAAAGG - Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
913028152 1:114867795-114867817 TTGAAAAAGAATGGTGAGAGGGG + Intronic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
916163278 1:161940909-161940931 TACAACAAGAATAAAGAGGAAGG - Intronic
916641561 1:166734057-166734079 TTGAATAGGAATGGTGAGAATGG - Intergenic
916662859 1:166938034-166938056 TTCAGAAAGATTAGTGAGGAGGG - Intronic
916909552 1:169331426-169331448 TTGAACAACAGTAGTGATAATGG - Intronic
917568207 1:176233931-176233953 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
917701568 1:177587085-177587107 ATGAAGAGGAATTGTGAGGATGG - Intergenic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
918231988 1:182543088-182543110 TTGAATAAGAGTAGTGAGAGTGG + Intronic
918386312 1:184011525-184011547 TTAAATCAGAGTAGTGAGGATGG - Intronic
918739462 1:188108640-188108662 TGAAACAAGAAGACTGAGGATGG - Intergenic
918809992 1:189104257-189104279 TTGAACAGGAATGGTCAGAATGG - Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
918997250 1:191778025-191778047 TTGAACAGAAATAGTGAAAATGG - Intergenic
921404178 1:214760958-214760980 TTGAACAGGAATGGTGAGAGAGG + Intergenic
921822054 1:219628552-219628574 TTGAAGCAGAATAGAGAGCAAGG + Intergenic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
923696127 1:236254274-236254296 GGGAACAAGAAAAGGGAGGAAGG - Intronic
923844941 1:237719525-237719547 AGGAACAAGAGCAGTGAGGAGGG + Intronic
923909806 1:238428755-238428777 TTGAATAAGAGTGGTGAGAATGG + Intergenic
923980919 1:239322476-239322498 CTGCACAAGAAAAGTGAGGGAGG - Intergenic
924952822 1:248900695-248900717 TTGAATAGGAATAGTGAGAGAGG - Intergenic
1063301146 10:4849927-4849949 TTGTACAATCACAGTGAGGAAGG + Intergenic
1064311515 10:14216196-14216218 TTAATTAGGAATAGTGAGGATGG - Intronic
1065308089 10:24387507-24387529 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1067205588 10:44209314-44209336 TTGAACAAGCATAGAGGTGAAGG - Intergenic
1068176142 10:53461640-53461662 TTGAATAAGAGTGGTGAGAATGG + Intergenic
1068381432 10:56258693-56258715 TTGAATAGGAGTAGTGAGAATGG + Intergenic
1068391943 10:56409117-56409139 TTGGACAAGATTAGAGAGAAAGG + Intergenic
1069142725 10:64847600-64847622 TTGAACGAGAATAATTTGGATGG + Intergenic
1069239297 10:66119036-66119058 TTTAAAAAGAATAGTGTGGCTGG - Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070322213 10:75362862-75362884 TTGAACAAGACCAGGTAGGAAGG - Intergenic
1070871695 10:79760019-79760041 TTGAACCAGCATCGTCAGGAAGG + Intergenic
1071316314 10:84402744-84402766 TTGAATAAGAGTGGTGAGAATGG - Intronic
1071323392 10:84487778-84487800 TTGAATAGGAATGGTGAGAAAGG + Intronic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1071414602 10:85429318-85429340 TAGAAAAAGAGTAGTGGGGAGGG + Intergenic
1071425926 10:85551140-85551162 TTGAATAGGGATAGTGAGAAAGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071638618 10:87282182-87282204 TTGAACCAGCATCGTCAGGAAGG + Intergenic
1071656624 10:87455770-87455792 TTGAACCAGCATCGTCAGGAAGG - Intergenic
1072946799 10:99817525-99817547 TTGAAGAGAAAAAGTGAGGATGG + Intronic
1072990090 10:100184986-100185008 TTGAACAGCAACAGTAAGGAGGG + Intronic
1073340034 10:102737368-102737390 TTGAACTAGAGTACTGAGGAAGG - Intronic
1073379885 10:103070066-103070088 CTGCACAAGGATAGTGAGAAGGG - Intronic
1074271629 10:111959323-111959345 TTGAACAAAAACAGAGAGGGTGG + Intergenic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075076200 10:119352276-119352298 TGGAACAAGAATATTGTGGCTGG - Intronic
1079306109 11:19324280-19324302 TTGAACAGGAATGGTGAGAGAGG - Intergenic
1079974161 11:27072025-27072047 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1080318288 11:30975324-30975346 TTGAATAAGAATGGTGAGAGTGG - Intronic
1081218872 11:40436038-40436060 TTGAACAAGAAAATTAAAGAAGG - Intronic
1081535207 11:43991398-43991420 TAGAATGAGAACAGTGAGGATGG + Intergenic
1081948036 11:47016260-47016282 TTGAACAAAAATGGTGAGAATGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1084702826 11:70798612-70798634 TTGAACAAGACGAGTGGGGCTGG + Intronic
1085210732 11:74775319-74775341 TTGTCCAAAAATAGAGAGGAGGG - Intronic
1085630542 11:78112295-78112317 TTGAATAGGAATGGTGAGAAGGG + Intronic
1085879367 11:80447621-80447643 TGGAATATGAATTGTGAGGAAGG - Intergenic
1085901545 11:80705977-80705999 TTGAATAAGCATAGTGAGAGTGG - Intergenic
1086082462 11:82919133-82919155 TTGAAGAAGAATGGTGAGAGTGG + Intronic
1086089587 11:82992261-82992283 GTGAACAAAAATAGTGTGGGGGG - Intronic
1086127951 11:83369006-83369028 TTGAAAGAGAAGAGTGAGAATGG - Intergenic
1086260483 11:84933899-84933921 TTGAACAAGAGTGATGAGAAAGG + Intronic
1086574486 11:88323373-88323395 TTGAATAAGAATGGTGAGAGAGG - Intronic
1086582786 11:88418473-88418495 TCAAACAAGCATGGTGAGGATGG + Intergenic
1086614109 11:88794177-88794199 CTGAAGCAGAATAGTGGGGACGG - Intronic
1086950387 11:92884863-92884885 GGGAACAAGAACAGAGAGGATGG + Intronic
1087004593 11:93457038-93457060 TTGAATAAGAAGGGTGAGAATGG - Intergenic
1087215774 11:95492062-95492084 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1087440215 11:98174360-98174382 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1088037701 11:105337145-105337167 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1090564835 11:127978069-127978091 TTGACCAGGAGTAGTGAGGAGGG + Intergenic
1090895699 11:130972789-130972811 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1092528942 12:9328351-9328373 TTAAACAAGATTAGTAAGTAGGG + Intergenic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1092755255 12:11757336-11757358 TAGAACCAGCATAGTGAGAAGGG + Intronic
1093386377 12:18560242-18560264 ATGAACAAGAAAAGTGACCATGG + Intronic
1093482570 12:19619787-19619809 TTGAAGGAGAATAGAGAGAAAGG - Intronic
1095320004 12:40815687-40815709 TTGAATAGGAATGGTGAGAAAGG + Intronic
1095488907 12:42712377-42712399 TTGAACAAGAGTGGTGAGAAAGG - Intergenic
1095807568 12:46337086-46337108 TTGAACAACAGTAGTGAAGATGG + Intergenic
1095993962 12:48062436-48062458 GTGACCAAGAATAATAAGGAAGG - Intronic
1096925519 12:55140319-55140341 TTGAATAGGAATGGTGAGCATGG - Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097934538 12:65230790-65230812 TTAAATAAGAATGGTGAGAATGG + Intronic
1098168459 12:67721129-67721151 TAGAGTAAGAATTGTGAGGAGGG - Intergenic
1098469724 12:70829331-70829353 TTGAGGAAGAATAGTAAGGAAGG + Intronic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1099470873 12:83046424-83046446 TTGAACTAAAATAGAGAGCAAGG - Intronic
1100368159 12:93940844-93940866 TTGAATAAGATGAGTGAGTAGGG + Intergenic
1100815357 12:98381646-98381668 TTGAATAAGAGTAGTGAGAGAGG - Intergenic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1103022334 12:117544868-117544890 TTGAATAAGAATGGTGAGAGTGG + Intronic
1103252567 12:119512983-119513005 ATGAACAAGAATTGGGAAGAAGG - Intronic
1103691258 12:122775907-122775929 ATAAACAAGAATAATGAGGTTGG - Intronic
1104334731 12:127883412-127883434 TTGAACAAGTAAAGTGGGGAAGG - Intergenic
1104374243 12:128250004-128250026 TCCAACAAGAAGAGAGAGGAAGG - Intergenic
1105563011 13:21513279-21513301 TTGAACAAGAGTAGCAAGAATGG + Intronic
1105962645 13:25356052-25356074 TTGATCAAGAAAAATGAGAACGG - Intergenic
1106675312 13:31952435-31952457 TTGGACAAGTTTACTGAGGATGG + Intergenic
1107571400 13:41662770-41662792 TTGAATAGGAATGGTGAGCATGG + Intronic
1107817612 13:44258105-44258127 AAGTACAAGAATAGTGAGGCTGG + Intergenic
1107989443 13:45804670-45804692 TTGAATAGGAATAGTGAGAGTGG - Intronic
1108103204 13:46980142-46980164 TTAAATAGAAATAGTGAGGATGG - Intergenic
1108130604 13:47295763-47295785 TTGAATAGGAATAGTGAGAGAGG - Intergenic
1108287265 13:48920799-48920821 TAGAACAAAAATACAGAGGAAGG + Intergenic
1108670523 13:52683143-52683165 TTGAATAAGAGTAGTGAGAGTGG + Intronic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1108906990 13:55488131-55488153 TTGAACAGGAGTGGTGAGAATGG + Intergenic
1109157623 13:58930403-58930425 TTCAAGAAGATTAGTGAGGCTGG - Intergenic
1109366884 13:61367391-61367413 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1109559469 13:64027962-64027984 TGGGACAAGAACTGTGAGGAGGG + Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1111036419 13:82680431-82680453 TTGAATAGGAGTAGTGAGAATGG + Intergenic
1111329263 13:86742927-86742949 TTGAGTAATAACAGTGAGGATGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112864285 13:103873979-103874001 TTGAATAAGAATAGTGACAGTGG + Intergenic
1113072766 13:106437823-106437845 TTGAACTAGTAAAGTCAGGAAGG + Intergenic
1113085395 13:106565034-106565056 TTACACAGGAGTAGTGAGGATGG - Intronic
1113208470 13:107945595-107945617 TTGAACAGGAATGGTGAGAGAGG - Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114913188 14:27226755-27226777 ATGAATAAGGATAGTGAGCATGG - Intergenic
1114958539 14:27853015-27853037 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1115156390 14:30344221-30344243 TTGAACAGGAGTGGTGAGAATGG + Intergenic
1115254404 14:31383942-31383964 TTGAATAGGAATGGTGAGAAGGG - Intronic
1115926771 14:38444698-38444720 TTGAACAAAAGTAGTGAGAGAGG + Intergenic
1116348628 14:43829601-43829623 TTGAATATGAATGGTGAAGAAGG + Intergenic
1116648604 14:47561764-47561786 TTGAACAGGAGTGGTGAGGGAGG + Intronic
1117080615 14:52148429-52148451 TTGAATAGGAATGGTGAGAATGG + Intergenic
1117184126 14:53222459-53222481 TTGAATAAGAGTAGTGTGCATGG + Intergenic
1118467562 14:66044833-66044855 TAGAGCAAGAATAGTGAAGGAGG + Intergenic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1119581450 14:75785810-75785832 TTGAAAAAGAAGAGTGAAGTTGG - Intronic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1120122926 14:80703931-80703953 TTAAAGAAAAATAGGGAGGAAGG - Intronic
1120186257 14:81396419-81396441 TGGCATAAGAATAGTGAAGAAGG - Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121892806 14:97612249-97612271 TTGAACAAGAACAGTAAAAATGG + Intergenic
1121943430 14:98095109-98095131 TGGAACAAGAAAAGCCAGGAGGG + Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1124668192 15:31612250-31612272 TTGAAGAAGAGTAGTGAGAGTGG - Intronic
1125200175 15:37095979-37096001 TTGAACAAGAATTGGGGAGAGGG - Intronic
1126502199 15:49358190-49358212 TTGAATAGGAGTGGTGAGGAGGG - Intronic
1127146171 15:56026356-56026378 TTGAATAAGAATAGTGATGGTGG + Intergenic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1129299660 15:74618329-74618351 CTGAACAGGGATAGTGAGGTGGG + Intronic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1129630636 15:77256169-77256191 TAAAACAAAAATAGGGAGGAAGG + Intronic
1130033544 15:80337377-80337399 TTTTACCAGAACAGTGAGGATGG + Intergenic
1131482878 15:92797012-92797034 TGGAACAAGGATAGTGATGCTGG - Intronic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1131956218 15:97739129-97739151 TTGAGCAGGAAGAGTGAGGGTGG + Intergenic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133087735 16:3378187-3378209 TTTATCAAGGATGGTGAGGAAGG - Intronic
1133644549 16:7751860-7751882 ATAAACAAGAAAACTGAGGAAGG + Intergenic
1133832722 16:9338996-9339018 TTGAATAACAGTAGGGAGGAAGG + Intergenic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134611240 16:15610189-15610211 TTGAACAAAAATAAACAGGAGGG + Intronic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1136730864 16:32411134-32411156 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1137897169 16:52226509-52226531 TAGAACAAGAAAATAGAGGAAGG - Intergenic
1138755020 16:59473750-59473772 TTGAATAAGAATGGTGAGAGTGG - Intergenic
1139220433 16:65176277-65176299 CTGAACATGGATAGTGATGATGG + Intergenic
1139228711 16:65259253-65259275 TTGAACAAGAACAGAGAGACAGG + Intergenic
1139342924 16:66281566-66281588 TTGAACAGGAATAGTGAGAGTGG - Intergenic
1140163736 16:72527332-72527354 TTGAATAGGAGTGGTGAGGAGGG + Intergenic
1141583179 16:85014560-85014582 CAGAACAAGAACAGCGAGGAAGG + Intergenic
1202995533 16_KI270728v1_random:106135-106157 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1203022220 16_KI270728v1_random:418477-418499 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143457199 17:7075975-7075997 CTCAACAACAATGGTGAGGAAGG - Exonic
1144126431 17:12207082-12207104 TTGAACAAGAGGAGTGTGTAGGG - Intergenic
1144137434 17:12311015-12311037 TTGAATAGGAATAGTGAGAGTGG + Intergenic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1149163080 17:53718481-53718503 TTGAACAGGAGTGGTGAGAAAGG + Intergenic
1149362269 17:55908244-55908266 TTGAACAGGAGTAGTGAGAGTGG + Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149664169 17:58354261-58354283 GAGAATAAGAATAGTGGGGAGGG - Exonic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1151998188 17:77625402-77625424 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
1153021092 18:629837-629859 TTTATCAAGAATAGTCAGGCAGG + Intronic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1154967006 18:21369041-21369063 TTTAAAAAGTATAGTGAGAAAGG - Intronic
1155562754 18:27097348-27097370 TTGAATAGGCATAGTGAGAATGG - Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1155741856 18:29298732-29298754 ATGAACAGGAATAGTGAAAAAGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156885896 18:42135533-42135555 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1157055651 18:44225568-44225590 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1157074727 18:44452901-44452923 TTGAAGAACAATAGTGAGTCAGG - Intergenic
1157455706 18:47827231-47827253 TTTAACAAGAATGCTAAGGATGG - Exonic
1159249314 18:65853259-65853281 CTGAACTAGAAGTGTGAGGATGG - Intronic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159748986 18:72277102-72277124 TTTAAGAAGAGTAGTGAGGGAGG - Intergenic
1159912615 18:74160847-74160869 TTGATCAACAATAGTTATGAAGG - Intergenic
1160320555 18:77889581-77889603 ATGACTAAGATTAGTGAGGAAGG - Intergenic
1164135224 19:22408396-22408418 TTCAATAAGAATGGTGAGAAAGG - Intronic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1165663536 19:37604605-37604627 TTGAAAAAAAATAGTAAGGCTGG - Intronic
1165803774 19:38568124-38568146 TGGAATAAGGATAGTGAGCAGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1168541420 19:57214271-57214293 TTGAATAGGAATAGTGAGAAAGG + Exonic
926462420 2:13148154-13148176 GAGAAAAAGCATAGTGAGGATGG - Intergenic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926845003 2:17126646-17126668 TTAAACCAGGATAGTGAGGTGGG - Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
929885196 2:45871940-45871962 TTCCACAAGTATACTGAGGACGG + Intronic
930486178 2:52014161-52014183 TTGAAGAGGAATGGTGAGAATGG + Intergenic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931497398 2:62823680-62823702 TTTAAGAAGAATAGTAATGAGGG - Intronic
931499584 2:62850376-62850398 TTGAACAAAAAAGGTGGGGATGG - Intronic
931545941 2:63387581-63387603 TTGAACAGGAATGGTGAGAGAGG - Intronic
931646674 2:64428707-64428729 TTGAATAAGAATATTGAGTGTGG + Intergenic
931779535 2:65567263-65567285 TTGCCCAGGAATAGTGAGGGGGG + Intergenic
932357301 2:71077329-71077351 TTAAGCAACAATAGAGAGGAAGG - Intronic
932426689 2:71642085-71642107 AGGAACAAGAATTGTGGGGAAGG - Intronic
932469932 2:71948121-71948143 ATGATCAAGATTAGTGAGGAAGG - Intergenic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933302447 2:80557441-80557463 TTGTACAAGAATAGAGCTGATGG - Intronic
933631011 2:84657853-84657875 TTGAATAAGAGTAGTGAGAGGGG + Intronic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
935323670 2:101914113-101914135 CTGAACAAGAGTAGTGAGAGTGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936091024 2:109501576-109501598 GTGCACAAGAAGCGTGAGGACGG + Exonic
936150153 2:110013567-110013589 TTGAGTCAGAATAGTGAGAATGG + Intergenic
936194521 2:110357803-110357825 TTGAGTCAGAATAGTGAGAATGG - Intergenic
936673845 2:114691102-114691124 TTGAATAAGAGTGGTGAGAAAGG + Intronic
936877523 2:117209875-117209897 TTGAATAGGAATAGTGAGAGAGG - Intergenic
936920196 2:117680693-117680715 TTGACTAAGATTAGTGAGGAAGG + Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937582764 2:123508156-123508178 TTGAATAGGAATAGTAAGAATGG - Intergenic
939318019 2:140577940-140577962 TTGAAAGAGATTAGAGAGGAAGG - Intronic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939893262 2:147762616-147762638 CTGAAAAAGAAAAGTGATGAGGG - Intergenic
939913699 2:148014385-148014407 TTGAACATGAATAGTGACTTGGG + Intronic
940034374 2:149298085-149298107 TTGAAGAGGAGTAGTGAGAATGG + Intergenic
940091106 2:149918383-149918405 TTGAAAATGAATAGTGGTGATGG + Intergenic
940641092 2:156345186-156345208 GTTAACAAGAAAAGTGATGAGGG + Intergenic
941057968 2:160810067-160810089 TTGAATAAGAGTAGTGAGAGAGG + Intergenic
941146218 2:161849438-161849460 TTGAATAAGAATGGTGAGAGTGG + Intronic
941371302 2:164668283-164668305 ATGATCAAGTTTAGTGAGGAAGG - Intronic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
941608848 2:167635303-167635325 TTGAACAGGAGTAGTGAGAGAGG - Intergenic
942170960 2:173289236-173289258 TTAAACAAGAATATTAAAGAAGG - Intergenic
942405932 2:175655030-175655052 TTGAATAGGAATAGTGAGAAAGG - Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943007317 2:182401629-182401651 TTGAACAGGAGTGGTGAGAAAGG - Intronic
943149217 2:184090237-184090259 CTGAAAAAGAAAAGTGAGAAAGG + Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943618298 2:190118821-190118843 TTGAATAGGAATGGTGAGAAAGG - Intronic
943823704 2:192361144-192361166 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
943923892 2:193745686-193745708 TTGAACAGGAATAGTGAGAGAGG - Intergenic
944208178 2:197179239-197179261 TTGAAAAAGAAAACTGATGAGGG - Intronic
944392771 2:199235242-199235264 TTGAACAGGAGTAGTGAGAAGGG + Intergenic
944814501 2:203361889-203361911 TTGTACTATATTAGTGAGGAAGG + Intronic
945359159 2:208875725-208875747 TTGAATAAGACTGGTGAGGGTGG + Intergenic
945430592 2:209759110-209759132 TTGAATAAGAGTGGTGAGAATGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946879972 2:224167416-224167438 TAGAACTAGAATAGTGATAATGG + Intergenic
947494417 2:230623702-230623724 TTGAACAAGAGTGGTGAGAGAGG - Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1169133336 20:3179618-3179640 TTGAAAAAGAATAGAGGGGCTGG - Intergenic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1170161466 20:13316888-13316910 TTGAAAAGGAATGGTGAGAAGGG - Intergenic
1170323761 20:15132771-15132793 TTGAAAAAGAAAAGTAATGAGGG + Intronic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171176027 20:23051113-23051135 TTAAACAAGAACAGAGAGTATGG + Intergenic
1173067977 20:39732608-39732630 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1173156474 20:40616532-40616554 TTCAACAAATATATTGAGGATGG + Intergenic
1173306283 20:41853428-41853450 TTTTACCAGAATAGTGATGAGGG - Intergenic
1173332788 20:42089071-42089093 TTAACCAAGCATAGTGAGAAAGG + Intronic
1173481460 20:43403456-43403478 TTGAACAAGAGTGGTGAGAAAGG + Intergenic
1173762831 20:45579097-45579119 TGGGCCAAGCATAGTGAGGAGGG - Intronic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174965240 20:55206169-55206191 TTGAATAGGAATGGTGAGAATGG + Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1176865727 21:14053734-14053756 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
1177000910 21:15611590-15611612 TTGAAAAGGAGTGGTGAGGAGGG - Intergenic
1177764712 21:25444133-25444155 TTGAACAGGAGTGGTGAGGGAGG - Intergenic
1178796578 21:35750478-35750500 TGGGACAGGAATACTGAGGATGG - Intronic
1180541610 22:16453998-16454020 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1180582599 22:16854802-16854824 TTGAGCCAGAATAGTGAGAATGG - Intergenic
1182471638 22:30552327-30552349 TTGATTAATAAAAGTGAGGAAGG + Intergenic
1182650233 22:31845585-31845607 TGGAGCAAGAAGAGTGAGGAAGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1184244993 22:43231341-43231363 GGGAACAAGGATAATGAGGAGGG - Intronic
949367125 3:3294456-3294478 TTGAACAGGAATAGTGAGAGTGG - Intergenic
949601543 3:5604029-5604051 TTGAAAAGGAACAGTGAGAATGG - Intergenic
949760600 3:7465990-7466012 CTGAACAAGAATTCTGTGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
951123752 3:18959843-18959865 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
951615745 3:24541684-24541706 TTGAGAGAGAATAGTGAGGTTGG - Intergenic
952867969 3:37869647-37869669 TCGAACAAGAGTAGTGAGAATGG + Intronic
955518390 3:59750683-59750705 TTGAACAACAATAGGGGGCAAGG + Intronic
956313223 3:67905190-67905212 TTGAATAGGAATAGTGAGAGAGG + Intergenic
956368201 3:68529248-68529270 TTGCACTAGAATTGTGAAGAAGG - Intronic
956457397 3:69436160-69436182 TGGGATAAGAATAGTGAGGGAGG - Intronic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
958497060 3:94858738-94858760 TTGAAAAAGAGTAGTGAGAGTGG + Intergenic
958624162 3:96603373-96603395 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
958679151 3:97304281-97304303 TTGAATAAGAGTAGTGAGAAAGG + Intronic
959956804 3:112248986-112249008 TTGAACAGGAATGGTGAAAATGG + Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960081637 3:113547594-113547616 TTGAACAAGAAGAGTGAAGTTGG + Intronic
960751823 3:120963313-120963335 TTGAATAGGAATAGTGAGAAAGG + Intronic
961801338 3:129452440-129452462 TTGAATTAGACTAGTGAGGGTGG + Intronic
961834770 3:129648325-129648347 TTGGACATGGCTAGTGAGGAAGG + Exonic
961959564 3:130840491-130840513 TTGAAAACTAATATTGAGGAAGG + Intergenic
962556824 3:136561723-136561745 TTAAATAAGAATTGTGAGGCTGG + Intronic
962744640 3:138388263-138388285 TTGAACACACATAGTGATGAGGG - Intronic
963032905 3:140996543-140996565 ATGCACAAAAATAGTGAAGAAGG - Intergenic
963993694 3:151682390-151682412 TTGAACAGGAATGGTGAGAGAGG - Intergenic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964372455 3:156014981-156015003 TGCAACAAAAATAGTGAAGATGG - Intergenic
964609434 3:158595438-158595460 TTGAACATGAATTGAGAAGAGGG + Intronic
964737252 3:159929583-159929605 TTGAGGAAGAAGTGTGAGGAGGG + Intergenic
964946540 3:162232327-162232349 TTGAACAAGAACAGTATAGAGGG - Intergenic
965085932 3:164098248-164098270 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
965382506 3:168007302-168007324 CTGAACCAGAATAGTGAGTATGG + Intergenic
965939775 3:174165236-174165258 TTGAATAGGAATGGTGAGAATGG + Intronic
966019035 3:175184024-175184046 TTGAACAATAATACTTATGATGG - Intronic
966102559 3:176289678-176289700 TTTAAAAAAAATATTGAGGATGG - Intergenic
966341127 3:178925924-178925946 TTGAATAAGAATGGTGAGAGAGG - Intergenic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969404624 4:6981971-6981993 TTGAACAGGAATAGTAAGAGCGG - Intronic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
971219269 4:24690240-24690262 TTCAACAAGTATATTGAGCACGG + Intergenic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
972317462 4:37940561-37940583 TTGAACAAGAGTGGTGAGAGAGG + Intronic
972443870 4:39124369-39124391 TTGAACAAGAATAAAGTTGAAGG + Intronic
973094739 4:46182264-46182286 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973940391 4:55903413-55903435 TTGAACAGGCAAAGTGGGGATGG + Intronic
974250730 4:59379361-59379383 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
975008342 4:69319160-69319182 TTGAACAGGAGTAGTGAGAGAGG - Intronic
975108387 4:70595482-70595504 TTGGACAAGAATAGAGGGAAAGG - Intronic
975194586 4:71509206-71509228 TTGAATAAGAATGGTGAGACAGG - Intronic
975561351 4:75710988-75711010 TTGAATAGGAATGGTGAGAAAGG - Intronic
976099377 4:81544482-81544504 TTGAACAGGAGTAGTGAGAGAGG - Intronic
976442945 4:85097274-85097296 TTGAACATGAAGAGTGAAGCTGG + Intergenic
977407474 4:96618207-96618229 TGGATAAAGAAAAGTGAGGATGG - Intergenic
977437478 4:97017777-97017799 TTGAACAAAAATAATGAGGTTGG - Intergenic
977796735 4:101174727-101174749 TTGGCCAAGAATAGTGAGATAGG + Intronic
977822878 4:101496359-101496381 CTAAAAAAGAATAGTGAGAAGGG - Intronic
978309675 4:107372446-107372468 TTGAAAAACAGTAGTGAGGCCGG - Intergenic
978624063 4:110664520-110664542 TTGAAAGAGAAGGGTGAGGATGG + Intergenic
978692733 4:111534816-111534838 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
979067951 4:116163007-116163029 TTGAATAAGAGTAGTGAGTACGG + Intergenic
979337982 4:119485645-119485667 TTGAATAAGACTAGTGAGAGAGG - Intergenic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979998334 4:127460158-127460180 TTGAACAGGAGTGGTGAGAAAGG + Intergenic
980289132 4:130823128-130823150 TTAAAAAGGAATAGTGAGGATGG + Intergenic
980863372 4:138525621-138525643 TTGAAGAGGAATGGTGAGAATGG - Intergenic
980865203 4:138546291-138546313 TTGAATAGGAATAGTGAGAGAGG - Intergenic
981063472 4:140454144-140454166 TTGAATAGGAGTGGTGAGGATGG + Intronic
981141997 4:141279304-141279326 TTGAAAAAGAAAACTAAGGAAGG - Intergenic
981276266 4:142901131-142901153 TTGAACCTGAAGAGTCAGGATGG - Intergenic
981453731 4:144929637-144929659 TTGAATAAGAGTGGTGAAGAGGG + Intergenic
981634802 4:146864360-146864382 TTGAGCAGTAATAGTGAAGATGG - Intronic
982681710 4:158438914-158438936 ATGATCAAGTTTAGTGAGGAAGG + Intronic
983161257 4:164418084-164418106 TTGAATACGAATGGTGAGAATGG - Intergenic
983169274 4:164517627-164517649 TTGAATAAGAGTAGTGAGAGAGG + Intergenic
983172051 4:164547319-164547341 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
983418583 4:167489193-167489215 TTGAATAAGAATGGTGAGAGAGG + Intergenic
983579977 4:169299434-169299456 TTGAATAACAATAGTGAAGGTGG - Intergenic
983668651 4:170211215-170211237 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
983831580 4:172334761-172334783 TTGAAAAGGAATGGTGAGAATGG + Intronic
985157363 4:187003528-187003550 TTGAATAAGAATGGTGAGAGAGG - Intergenic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985290822 4:188385384-188385406 TTGAATAAGAGTAGTGAAAATGG + Intergenic
987180263 5:15360224-15360246 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
987922927 5:24307296-24307318 TTGAATAGGAATAGTGAGAGAGG + Intergenic
987957433 5:24758827-24758849 TTGAATAAGAGTAGTGAAGGTGG + Intergenic
988000935 5:25347473-25347495 TTGGCAAGGAATAGTGAGGATGG - Intergenic
988626457 5:32880673-32880695 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
988975536 5:36512132-36512154 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
989081420 5:37626159-37626181 TTGAATAAGAATACTGAGATTGG + Intronic
989274581 5:39572013-39572035 TTGAACATGAATTTTGTGGAAGG - Intergenic
989686241 5:44090457-44090479 AAGAAGAAGAATAGTGGGGAGGG - Intergenic
989758000 5:44979513-44979535 TTGAACAAGAGTGGTGAGTCTGG - Intergenic
990425871 5:55688295-55688317 TTGAATAGGAGTAGTGAGGGAGG + Intronic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990843877 5:60114710-60114732 TTTAACAAGCAAAGTGATGATGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
990984468 5:61628336-61628358 TTGAATAGGAATGGTGAGAAAGG - Intergenic
991086032 5:62649043-62649065 TTGACAAAGCCTAGTGAGGAAGG + Intergenic
992633400 5:78703000-78703022 TTGAAAAAGAAAAGTGATCAGGG + Intronic
993019022 5:82568423-82568445 TTGAACAGGAGTAGTGAGAGAGG - Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
993999977 5:94767368-94767390 TTGAACAAGAGTGGTGAACAGGG - Intronic
994357212 5:98807056-98807078 TTGAATAAGAGTAGTGAGAGTGG - Intergenic
994423004 5:99545781-99545803 TTGAATAGGAGTAGTGAGAAAGG + Intergenic
994495213 5:100503538-100503560 TTGAACAGGAGTAGTGAGAGAGG - Intergenic
994537902 5:101055291-101055313 TTGAATAAGAACAGTGAGAAAGG + Intergenic
995253928 5:110024099-110024121 TTGAATAGGAGTAGTGAGAATGG - Intergenic
995296172 5:110525183-110525205 TTGATTAAAAATAGTGAGGATGG - Intronic
995604330 5:113835082-113835104 TTATAATAGAATAGTGAGGAGGG - Intergenic
995924776 5:117358196-117358218 GTTAACAAGAATAGTGCTGAGGG + Intergenic
996211250 5:120813779-120813801 TTGAATAAGAATCGTGAGAGTGG + Intergenic
996376705 5:122816947-122816969 TGGAGCAGGAATATTGAGGATGG + Exonic
996663515 5:126031378-126031400 TTGAATAGGAATAGTGAGAGAGG - Intergenic
996851269 5:127955652-127955674 TTGAATAAGAATGGTGAGACTGG - Intergenic
996872379 5:128206044-128206066 TTGCACATGGATTGTGAGGAAGG + Intergenic
996949597 5:129109824-129109846 TTCTACAGGAATAGAGAGGAAGG - Intronic
997099152 5:130948883-130948905 TTGAATAGGAATGGTGAGAATGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
997782245 5:136671232-136671254 TTACAAAAGAATAGTGAGGTTGG - Intergenic
997876316 5:137550937-137550959 TTGAATAAGAATGGTGAGAGAGG - Intronic
998056752 5:139085174-139085196 ATGAACAAAAACAGGGAGGAAGG + Intronic
999076540 5:148801339-148801361 TTGAACAAAAGTGGTGAAGATGG - Intergenic
999599546 5:153246632-153246654 TTGAAGAGGAGTAGTGAGCATGG + Intergenic
1000548440 5:162629883-162629905 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1003569803 6:7248348-7248370 TTGAACCAGCAAACTGAGGACGG - Intronic
1003704715 6:8512400-8512422 TAGAAAAAGAAGAGTGATGAGGG - Intergenic
1004644514 6:17546784-17546806 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005734012 6:28728515-28728537 TTGATCAGGAATGGTGAGAAGGG + Intergenic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006827280 6:36944872-36944894 TTGAACTATAATGGTGAGAATGG + Intergenic
1007145923 6:39631322-39631344 TTGAAGAAAAATGGTGAGAATGG + Intronic
1007344698 6:41220466-41220488 TTGAATTAGAATGGTGAGAATGG + Intergenic
1008592552 6:53008969-53008991 TTTAACAAAAAAAGTGGGGAGGG + Intronic
1008773224 6:55005083-55005105 TTGAATAAGAGTAGTGAGAGAGG + Intergenic
1009330508 6:62413785-62413807 TTGAACAGGAGTGGTGAGAAAGG - Intergenic
1009479361 6:64137453-64137475 ATGATCAAGCATCGTGAGGAAGG - Intronic
1009876696 6:69514893-69514915 TTGAACAGGAGTAATGAGAATGG - Intergenic
1009911822 6:69939139-69939161 TTGAAAAAGATTTTTGAGGAGGG + Intronic
1009956252 6:70457655-70457677 TTGATGAAGAATAGTGATCAAGG - Intronic
1009991266 6:70845877-70845899 TTGAACAAGTACAGTGAGGCTGG - Intronic
1009995043 6:70887908-70887930 GGGAACAAGAATAGTAAGGTGGG + Intronic
1010429650 6:75764347-75764369 TTGAACAAGACTAAGGAGAAAGG - Intronic
1010544096 6:77128497-77128519 TTGAATAAGAGTAGTGAGAGTGG - Intergenic
1011224311 6:85090160-85090182 GTGAACAAGAGAAGTGAGGCTGG - Intergenic
1011393723 6:86882966-86882988 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1012454302 6:99387691-99387713 TTGAATAACAGTAGTGAGAATGG - Intronic
1012560141 6:100570319-100570341 TTAAACAGGAATGGTGAGAATGG + Intronic
1012740810 6:103014552-103014574 TTGAATAGGAATAGTGAGAGAGG + Intergenic
1012805275 6:103885479-103885501 TTGAACAAGTCCTGTGAGGATGG + Intergenic
1012948053 6:105488787-105488809 TTGAGCAAGAATAGCTTGGAAGG - Intergenic
1013246198 6:108289723-108289745 AGGAACAAGAGTATTGAGGAAGG + Intergenic
1015970507 6:138738748-138738770 TTGAACCAGGAGAGTGATGAGGG + Intergenic
1016132750 6:140497337-140497359 TTGAACAAAAAGGGTGAGTAAGG - Intergenic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017408499 6:154145093-154145115 TTGAATAAGAGTAGTGAGGGTGG - Intronic
1017660338 6:156667946-156667968 TTGAACATGAATGGTGAGAGAGG - Intergenic
1018510365 6:164518336-164518358 GGGGACAGGAATAGTGAGGAGGG + Intergenic
1018563883 6:165130907-165130929 GTGAACAACACTATTGAGGAAGG - Intergenic
1018621268 6:165731526-165731548 TAGAAAGAGAAGAGTGAGGAAGG + Intronic
1018678307 6:166242043-166242065 TTGACCAAGAGATGTGAGGAGGG - Intergenic
1020349900 7:7208262-7208284 GGGCACAAGAATAGTGATGATGG + Intronic
1020872332 7:13647347-13647369 ATGAACTAAAATATTGAGGAAGG - Intergenic
1021024960 7:15654450-15654472 TTGAATAAGAGTGGTGAGGGAGG + Intronic
1021205874 7:17780247-17780269 CTGAACAAGAATGATGAGAATGG - Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1024725849 7:52193184-52193206 TGGAACACTAATTGTGAGGAAGG - Intergenic
1024753931 7:52505528-52505550 TGAAAAAAGAATATTGAGGATGG + Intergenic
1025109776 7:56204323-56204345 TTGACTAAGAGTAGTGTGGATGG + Intergenic
1025609366 7:63064188-63064210 TTGAATAAGAGTAGTGAGAGAGG - Intergenic
1026080861 7:67218940-67218962 TTGAACGAAAGTAGTGAAGATGG + Intronic
1026233925 7:68509680-68509702 TTGAACAGAAACAGTGAAGATGG - Intergenic
1026308134 7:69160296-69160318 TTGACTAAGAGTAGTGTGGATGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027608257 7:80327227-80327249 TTGAATAAGAGTAGTGAGAGAGG - Intergenic
1027988856 7:85331756-85331778 TTGAACAGGAGTGGTGAGGGAGG + Intergenic
1028699798 7:93764121-93764143 TTGAATAAGAATGGTGAGACTGG - Intronic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1029132160 7:98339857-98339879 GTGAACAAGGATGGTGATGATGG + Intronic
1029330160 7:99846614-99846636 TTGAATAAGAATGGTGAGAGTGG + Intronic
1029993698 7:104985619-104985641 TTCAACAGGAATAGAGAGGACGG + Intergenic
1030531255 7:110713964-110713986 TTGAACAGGAGTAGTGAGAATGG + Intronic
1030696686 7:112592608-112592630 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
1030960348 7:115912571-115912593 TGGAGCAAGAAGGGTGAGGATGG - Intergenic
1031570241 7:123350222-123350244 GTGAGGAAGAGTAGTGAGGAGGG - Intergenic
1032235501 7:130118640-130118662 TTGACTAAGCTTAGTGAGGAAGG - Intronic
1032418663 7:131759632-131759654 TTTAACTACAACAGTGAGGACGG - Intergenic
1033297953 7:140158321-140158343 TTACACAAGGATAGTGATGAAGG + Intronic
1033792237 7:144804805-144804827 TTGAATAAAAATAGTAATGATGG + Intronic
1033996910 7:147361853-147361875 TAGACCCAGAATATTGAGGATGG + Intronic
1036993192 8:13623650-13623672 TTGAATAAGAAAAGTCAGGTGGG + Intergenic
1037075866 8:14717474-14717496 TTGAAGAAGAACAGTCTGGAAGG + Intronic
1037101927 8:15057244-15057266 TTGAGCAAGAATATGCAGGAAGG + Intronic
1037560256 8:20067228-20067250 TTGAAGAAGACTGGTGAGGGTGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038146579 8:24902631-24902653 TTTAGCAAAAATAGTGTGGAGGG - Intergenic
1038295340 8:26287297-26287319 TTTTACAAGAATATTGAGTAAGG + Intergenic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1040563707 8:48547106-48547128 GTGAACATGAATAGTGTTGAGGG + Intergenic
1040611456 8:48987367-48987389 TTGAAAAGCAATAGTGAGGTGGG + Intergenic
1040799392 8:51324314-51324336 TTGAATAAGAGTGGTGAGAATGG + Intronic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1042358942 8:67860453-67860475 TTGAAAATGAATAGTGAGGGAGG + Intergenic
1042803551 8:72746903-72746925 ATGAACTGGAATAGTGAGAAGGG - Intronic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1042929582 8:73999967-73999989 TTGACCAAGAGTGGTGAGAATGG + Intronic
1043033215 8:75165053-75165075 TTGACCAAGAACTGGGAGGATGG - Intergenic
1043093197 8:75930267-75930289 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1043129062 8:76438457-76438479 TTGAATAGGAGTAGTGAGAAAGG + Intergenic
1043539636 8:81245249-81245271 TTGAAAAGAAATAGTGAGGCTGG - Intergenic
1043974883 8:86573252-86573274 TAGAACAAAAATATGGAGGAAGG + Intronic
1045390938 8:101714095-101714117 TTGAACAGGAATGGTGAGAGAGG - Intronic
1045676221 8:104610735-104610757 TTGAATAGGAGTAGTGAGAAAGG + Intronic
1045686662 8:104719827-104719849 TTTAAGTAGAAGAGTGAGGAGGG + Intronic
1046721564 8:117625493-117625515 ATCAACAAAAATAGTGAAGATGG - Intergenic
1046827646 8:118709229-118709251 TAGAACAAGAATAGTTAAAAAGG + Intergenic
1047325754 8:123834459-123834481 TTGAACTAGAGTAGTGACTATGG + Intergenic
1047642014 8:126830853-126830875 TTGAATAAGAACAGAGAGGGTGG + Intergenic
1050438800 9:5637885-5637907 TTGAATAACAATAGTGAAGGTGG + Intronic
1050517230 9:6457544-6457566 TTGAACAGGAATGGTGAGAGAGG + Intronic
1051797930 9:20895908-20895930 TTGAAAAAGAATAGTGAGAGAGG + Intronic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053442706 9:38129139-38129161 TGGAATAAGAATAGTGCTGATGG + Intergenic
1053450064 9:38186197-38186219 TTGAATGACAATAGCGAGGAGGG + Intergenic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1055015336 9:71610954-71610976 TTGAAAAGGAATGGTGAGAAAGG - Intergenic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1055344751 9:75323735-75323757 TTGAATAAGAGTAGTGAGAGAGG + Intergenic
1055367557 9:75561450-75561472 TTGAATAGGAATAGTGAGAGTGG + Intergenic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1055811308 9:80151394-80151416 TTGAATAAGAATATCGAGAATGG + Intergenic
1056194007 9:84211699-84211721 TTGAACATGAGCAGAGAGGAAGG + Intergenic
1056262365 9:84861922-84861944 ATGAACAAGCATAGGGTGGATGG - Intronic
1056289759 9:85131132-85131154 TTGAACCATAATATTGAAGAAGG - Intergenic
1058080344 9:100694682-100694704 TTGAATAAGAGTAGTGAGAGAGG - Intergenic
1058162823 9:101588174-101588196 TTTAACAAGAATCATGAAGAGGG + Intronic
1059173505 9:112148595-112148617 TTCATAATGAATAGTGAGGAGGG - Intronic
1059916469 9:119108219-119108241 TTTAATAAGAATGGTGAGGTGGG - Intergenic
1060744776 9:126124109-126124131 TTGCTCGAGAACAGTGAGGAGGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1186018245 X:5224070-5224092 TTGAATAAGAGTAGTGAGAGAGG - Intergenic
1187348800 X:18492881-18492903 TTGAACAAGAATAGGAGGGGTGG - Intronic
1187756149 X:22529028-22529050 TTGAACAGGAATGGTGAGAAAGG - Intergenic
1188410246 X:29863236-29863258 TTAAACAATAATAATGATGATGG + Intronic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1189173057 X:38927667-38927689 TGGAACAAGAAAAATTAGGAGGG - Intergenic
1189188917 X:39079122-39079144 TTGAATAGGAATGGTGAGAAAGG + Intergenic
1189209564 X:39273143-39273165 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1190691751 X:52918528-52918550 TTGGACAAGAGTAGGGAGGTGGG - Intergenic
1190694232 X:52937264-52937286 TTGGACAAGAGTAGGGAGGTGGG + Intronic
1191037047 X:56037191-56037213 TTGAATAAGAGTGGTGAGAATGG + Intergenic
1191725901 X:64280651-64280673 TTGAACAGGAGTAGTGAGAGAGG - Intronic
1191775864 X:64812467-64812489 TTGAATAGGAGTAGTGAGGGAGG - Intergenic
1191888416 X:65914381-65914403 TTGAACAGGAGTGGTGAGAAAGG + Intergenic
1192167988 X:68838004-68838026 ATGACCAAGATTAGTAAGGATGG + Intronic
1192613276 X:72589531-72589553 TTGAATAGGAATAGTGAGAGAGG - Intronic
1192630637 X:72775512-72775534 TAAAAGAAGAATAGTGAGGGGGG + Intergenic
1192651073 X:72945292-72945314 TAAAAGAAGAATAGTGAGGGGGG - Intergenic
1192719101 X:73673786-73673808 TTGAATAGGAATAGTGAGAGAGG + Intronic
1192880771 X:75281302-75281324 TTGAAGAGGAATGGTGAGGGTGG + Intronic
1193039925 X:76994297-76994319 TTGAACAGGAATGGTGAGAGAGG + Intergenic
1193177006 X:78406059-78406081 TTGAACAGGAGTGGTGAGAAAGG - Intergenic
1193562514 X:83036713-83036735 TTGAACAAGAGTGGTGAGTGTGG - Intergenic
1193898515 X:87145537-87145559 TTGAACAAGAATACAGAGAGAGG - Intergenic
1194423996 X:93714244-93714266 TTGAACAAGATTTGGGAGAAAGG + Intergenic
1194485641 X:94482566-94482588 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1194547052 X:95249603-95249625 TTTAAGAAGAAATGTGAGGAAGG + Intergenic
1194703922 X:97151311-97151333 TGTAATATGAATAGTGAGGATGG + Intronic
1194797669 X:98232666-98232688 TTGAATAGGAGTAGTGAGAATGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195149523 X:102051922-102051944 TTGAAAAAGAATGGTGAGAGAGG + Intergenic
1195216180 X:102705461-102705483 TTGAATAGGATTAGTGAGAAGGG - Intergenic
1195794756 X:108632933-108632955 TTGAACAGGAGTAGTGAGAGAGG - Intronic
1196132348 X:112170784-112170806 TTGAATATGAATAGTGAGAGAGG + Intergenic
1196161671 X:112491393-112491415 TTGAACAGGAGTGGTGAGGGAGG + Intergenic
1196417983 X:115493333-115493355 TAGTACAAGAAGAGTGAGTAAGG - Intergenic
1197046060 X:122000072-122000094 TTGAACAGGAGTGGTGAGAAAGG + Intergenic
1197099234 X:122632418-122632440 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1197259110 X:124297731-124297753 TTGAATAAGAGTAGTGAGAGAGG - Intronic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197740720 X:129891285-129891307 TTGAAGATGAATGGTGGGGAGGG + Intergenic
1197906639 X:131432360-131432382 TTGAACAGGAGTAGTGAGAGAGG - Intergenic
1197989999 X:132307816-132307838 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1198068379 X:133122753-133122775 TTAAATAAGATTATTGAGGAAGG - Intergenic
1198895687 X:141452012-141452034 TTGAACAGGAATGGTGAGAGAGG - Intergenic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200895196 Y:8368388-8368410 TTGAATAAGAGTAGTGAGAGAGG + Intergenic
1201504040 Y:14678046-14678068 TTGAAAAAGACAAGTGAGGTAGG - Intronic
1201619731 Y:15943015-15943037 TTGAATAAGAGTTGTGAGGGAGG + Intergenic
1201965153 Y:19724670-19724692 TTGAATAAGAGTAGTGAGAGAGG - Intronic