ID: 993941465

View in Genome Browser
Species Human (GRCh38)
Location 5:94063387-94063409
Sequence TTCACGATTTTGTTGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993941465_993941467 -5 Left 993941465 5:94063387-94063409 CCTACCATCAACAAAATCGTGAA 0: 1
1: 0
2: 0
3: 7
4: 153
Right 993941467 5:94063405-94063427 GTGAACTGCTCAGAACTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993941465 Original CRISPR TTCACGATTTTGTTGATGGT AGG (reversed) Intronic
901303472 1:8216287-8216309 TGGAGGATTTTGATGATGGTGGG + Intergenic
902394576 1:16125536-16125558 TTCCTAACTTTGTTGATGGTGGG - Intronic
908503223 1:64765996-64766018 TTAACTTTTTTGTTGAGGGTGGG + Intronic
908576137 1:65461881-65461903 TTCACGATTAGGCTGATGTTTGG - Intronic
910185100 1:84530308-84530330 TTCAGGATTTACTTAATGGTGGG + Intergenic
910698876 1:90050652-90050674 TTCACGATTTTTCTCAGGGTTGG - Intergenic
910955517 1:92699373-92699395 TAGACTATTCTGTTGATGGTAGG - Intronic
912010963 1:104962056-104962078 TTCACTATTTTCTTGATAGATGG + Intergenic
915197209 1:154198467-154198489 TTCACCATTTTGGCCATGGTTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
918694527 1:187527885-187527907 GTCACGATTGTTTTGCTGGTGGG - Intergenic
919671590 1:200343215-200343237 TATACGTTTTTGTTGATGTTGGG - Intergenic
921309417 1:213827927-213827949 TTCATCATTTTGTGGATGGCAGG - Intergenic
921985125 1:221304596-221304618 TTCACCATGTTGGGGATGGTGGG + Intergenic
924223241 1:241899582-241899604 TTCACCATTTTGTTGATGAAGGG - Intergenic
924601542 1:245494106-245494128 TTCACCATGTTGGTGATGGCTGG - Intronic
924813610 1:247424296-247424318 CTCACGATCTTGTGGATGGGTGG - Exonic
1076274960 10:129190915-129190937 TTCCCCATTGTGTTGATGGCAGG - Intergenic
1078453744 11:11459152-11459174 TGCACTATTCTGTTGATGGAGGG + Intronic
1078671044 11:13365599-13365621 TTCATGCTCCTGTTGATGGTGGG + Intronic
1078919175 11:15811430-15811452 TTTACCATTATCTTGATGGTGGG - Intergenic
1079629529 11:22657157-22657179 TAAAAGATTCTGTTGATGGTGGG + Intronic
1081533883 11:43983633-43983655 CTCATGATTCTGTTGATGGAAGG - Intergenic
1087864572 11:103208000-103208022 TTCAGGATTTTGATGTTGGAAGG + Intronic
1088089802 11:106023986-106024008 TTTTGGATTTTGTTCATGGTGGG + Intergenic
1088838405 11:113600412-113600434 TTCAATATTTTGTTATTGGTTGG - Intergenic
1088883315 11:113988451-113988473 TTCACCATTTTTTATATGGTTGG + Intronic
1092082827 12:5732226-5732248 TTCAATATTTAGATGATGGTAGG + Intronic
1093991459 12:25593247-25593269 TGCACTATTTTTGTGATGGTTGG - Intronic
1095857031 12:46871554-46871576 TTAACTTTTTTGTTGATGTTAGG + Intergenic
1096120055 12:49082810-49082832 CTCACTATGTTGTTTATGGTTGG - Intergenic
1097373273 12:58809993-58810015 TTAAAGATTCTTTTGATGGTGGG - Intronic
1100253552 12:92858211-92858233 ATCAGGATTTTGTTGAAGGTGGG - Intronic
1101764750 12:107687233-107687255 TCCAGGGTTTGGTTGATGGTAGG + Intronic
1103879598 12:124155843-124155865 TTCAGGCTGCTGTTGATGGTGGG + Intronic
1105519469 13:21118802-21118824 TTCAAGATTTTGTGGGTGGCTGG + Intergenic
1106283669 13:28300085-28300107 TTCATGATCCTGTTGATGTTAGG + Intergenic
1108011742 13:46021710-46021732 TTCACCATTTTTTTCATGGCAGG - Intronic
1108278225 13:48833433-48833455 GTCACAATTTTGCTGATGGAGGG - Intergenic
1109594506 13:64532296-64532318 TCTACAATTTTGTTTATGGTTGG + Intergenic
1109658114 13:65421013-65421035 TTCAGTATTATGTTGATTGTGGG + Intergenic
1110160611 13:72373819-72373841 TTCTCCATTTTGTTGTTGTTTGG + Intergenic
1110227281 13:73132837-73132859 TTCACTATTTTCTTGATTGTAGG + Intergenic
1111862329 13:93723740-93723762 TTCACAATTTTTTTGAGTGTGGG + Intronic
1112005752 13:95252273-95252295 TTCACCATTTCGTTGATAGAAGG - Intronic
1113309442 13:109116560-109116582 TTCAGGAAGTTCTTGATGGTCGG - Intronic
1115317777 14:32043994-32044016 TTCATCGTTTTGTTGATGGGAGG + Intergenic
1116692482 14:48127641-48127663 TTCACCATTTTATTAATTGTGGG + Intergenic
1116985015 14:51209437-51209459 TTCAGGTTTCTGTTGGTGGTTGG + Intergenic
1119108905 14:71952474-71952496 TTCTAGATTTTCTTGAGGGTTGG + Intronic
1119363759 14:74073719-74073741 TTCACCATGTTGTCCATGGTTGG - Intronic
1120231185 14:81843399-81843421 TTCACCATGTTGGTCATGGTGGG + Intergenic
1120794321 14:88615677-88615699 TTCACTATTTTGATGATTCTGGG + Exonic
1120990275 14:90369770-90369792 TTGATGATTTTGGTGGTGGTGGG + Intergenic
1125085862 15:35728476-35728498 TTCAGGTTTTTGTTTATGCTTGG - Intergenic
1125252582 15:37722788-37722810 TTAACCTTTTTGCTGATGGTGGG + Intergenic
1131644165 15:94324091-94324113 TTCATGATTTGGTTGATGCATGG + Intronic
1135980408 16:27142699-27142721 TTCACCATCTTGTTTTTGGTGGG + Intergenic
1137402367 16:48163938-48163960 TTCACCATTTTGGTTTTGGTGGG + Intergenic
1137924824 16:52530531-52530553 TTCACCATGTTGGTCATGGTTGG + Intronic
1138691509 16:58773159-58773181 TTCATGCTTTCGTTGATGCTTGG + Intergenic
1138787346 16:59863369-59863391 TTCACCATCTTGGTTATGGTGGG - Intergenic
1139363229 16:66416449-66416471 ATCATGATTTTGTTGTTGTTAGG - Intergenic
1141940013 16:87269336-87269358 TTAAAGATTTTTTTGATGGCAGG - Intronic
1153232517 18:2952803-2952825 TTAACCATTTTCTTGCTGGTAGG - Intronic
1156068993 18:33181827-33181849 TTCCCTATTTTGTTGTTGTTAGG - Intronic
1156918664 18:42491853-42491875 TTCATGAGCTAGTTGATGGTAGG + Intergenic
1158410479 18:57200750-57200772 TTCTCGCTTTTGGTGATTGTAGG - Intergenic
1159466903 18:68795537-68795559 TTCCTAATTTTGGTGATGGTTGG + Intronic
1164287898 19:23838055-23838077 TTCACTATTATGTTGGTTGTGGG + Intergenic
1168493846 19:56834211-56834233 TTCACTATCCTGTAGATGGTTGG - Intronic
925957395 2:8980692-8980714 TTAACGATCTTTTTGATTGTAGG - Intronic
926472934 2:13284145-13284167 TTCAAGGTTTAGTTGATGATGGG - Intergenic
926949939 2:18230637-18230659 TTCACCTTTTTCTTGTTGGTAGG - Intronic
931051103 2:58415660-58415682 TTCACTATTTAGTTGCAGGTGGG + Intergenic
932514516 2:72331684-72331706 TTCACGATATTATTAATAGTAGG + Intronic
933657701 2:84903301-84903323 TTCCCCACTCTGTTGATGGTGGG + Intronic
935925747 2:108066662-108066684 TTCCTGAGTTTGTTGATGGCAGG - Intergenic
936886023 2:117310696-117310718 TGCAAGGTTTTATTGATGGTTGG + Intergenic
937924089 2:127154319-127154341 TTCAAGTTTTTGGAGATGGTGGG + Intergenic
938747790 2:134296421-134296443 TTCAAGTTTTTATTGATGGAAGG + Intronic
939675282 2:145064696-145064718 TTTAGGAATTTGTTGCTGGTTGG - Intergenic
939804039 2:146750473-146750495 TTCACGATTTAGATCAAGGTAGG + Intergenic
941181733 2:162267500-162267522 TTCACCATTTATTTGATAGTCGG + Exonic
941187328 2:162333184-162333206 TATACCATTTTGTTGAAGGTGGG + Intronic
941786398 2:169504473-169504495 TTCACGATCTTGTTGCTTTTTGG - Exonic
941907028 2:170726480-170726502 TTCACCATTTTGGCCATGGTTGG - Intergenic
942679260 2:178459701-178459723 TTTACAGTTTTATTGATGGTTGG + Intronic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
944792696 2:203148743-203148765 TTCACGTGTTTATTGTTGGTTGG + Intronic
946927163 2:224637222-224637244 TGCAGGATTTTGCTGAAGGTAGG + Intergenic
1170620697 20:17993471-17993493 TTCACTCTTTTGTTGAGGGGTGG - Intronic
1171100081 20:22374709-22374731 TTCACAAATTTGTTGTTGTTGGG - Intergenic
1175950740 20:62581815-62581837 TCCACACTTTTCTTGATGGTGGG + Intergenic
1177419066 21:20832051-20832073 TGCACTATATTGTTGATGATAGG + Intergenic
1177427948 21:20949718-20949740 TTCACTATTTTGTTAATGAAGGG + Intergenic
1178952232 21:36994513-36994535 TGCACGGTTTTTTTGTTGGTTGG - Intergenic
1179084156 21:38202934-38202956 TCCACTATTTTGGTGCTGGTTGG + Intronic
950289488 3:11771971-11771993 TTCACTATTTGGGTGATGATGGG - Intergenic
950293143 3:11803983-11804005 TTCACTATTTGGGTGATGATGGG + Intronic
951259776 3:20494527-20494549 TTCTGGATTGTCTTGATGGTTGG + Intergenic
952000470 3:28780043-28780065 TTCACAGTTTTGTTCATGCTTGG + Intergenic
954187526 3:48929774-48929796 TTGTGGATTTTGTTGATTGTTGG + Intronic
958485175 3:94696658-94696680 TTCTCGGTTTAGCTGATGGTTGG - Intergenic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
965652137 3:170945717-170945739 TTCAGTATGATGTTGATGGTGGG + Intergenic
967024944 3:185556535-185556557 TTAACGATTTTCCTGCTGGTGGG + Intergenic
967386631 3:188918061-188918083 TTTAAGATTTGGTTGATGGAAGG + Intergenic
970735433 4:19161339-19161361 TTCAGGATTAGGTGGATGGTGGG + Intergenic
972652627 4:41033518-41033540 TTGAGGATTTTTTTCATGGTAGG + Intronic
973595428 4:52483893-52483915 TTTAGGATTTTGATGATGCTTGG - Intergenic
974225976 4:59045414-59045436 TTCAGGATTTTTTTTGTGGTGGG - Intergenic
975797027 4:78017483-78017505 TTTACCATTTTGTTGTTGTTTGG - Intergenic
975931240 4:79525691-79525713 TTAACTATTTTGTTGTGGGTAGG + Intergenic
979107890 4:116710777-116710799 ATCAAGATTTTGGTGATGGAAGG - Intergenic
980382420 4:132040793-132040815 TTCAAGATTTTATTGAGTGTTGG + Intergenic
985885890 5:2677708-2677730 TTCATGATGTTGGTGATGGCTGG + Intergenic
985885925 5:2678016-2678038 TTCATGATGTTGGTGATGGTTGG + Intergenic
986650979 5:9963140-9963162 GTCACCATGTTGATGATGGTAGG - Intergenic
991281385 5:64918169-64918191 TCCAAGATGTTATTGATGGTTGG + Intronic
991531684 5:67622139-67622161 TTCTCTCTTTTGATGATGGTGGG + Intergenic
992804132 5:80320246-80320268 TTAACGGTTTTGGAGATGGTGGG - Exonic
993751312 5:91671878-91671900 TTCTCTACTTTGTTGATGGAAGG + Intergenic
993941465 5:94063387-94063409 TTCACGATTTTGTTGATGGTAGG - Intronic
996882487 5:128315508-128315530 TTCATGATTTTGTTGATGAGAGG + Intronic
997040171 5:130243707-130243729 TTAAAGATTTTTTTGATGGCAGG + Intergenic
997802764 5:136883243-136883265 CTCACGATATTGTTGAAAGTAGG + Intergenic
1000491940 5:161925118-161925140 TGCTTGATTTTGTTGATGGCAGG - Intergenic
1003293252 6:4800854-4800876 TTCAAGATTTTGTTTATCCTTGG + Intronic
1010123943 6:72411423-72411445 TTGACGATTTTATTGGGGGTAGG + Intergenic
1010425311 6:75722928-75722950 TTCAAGATTTTGGTCATGGCCGG + Intergenic
1013070518 6:106724895-106724917 TTCAGATTTTTGTTGATTGTTGG - Intergenic
1014917187 6:127165395-127165417 TTCATGATTTTGCTGTTGGCTGG - Intronic
1015750697 6:136555410-136555432 TTGAAGATTTGGTTTATGGTGGG + Intergenic
1017227257 6:152036557-152036579 TTCCTGACTTAGTTGATGGTGGG - Intronic
1020659636 7:10966575-10966597 TTCAAGGTTTTGATGGTGGTGGG - Intergenic
1020857403 7:13447514-13447536 TTAAGGATTGTTTTGATGGTAGG + Intergenic
1029314304 7:99697381-99697403 TTCACGGTTGAGTTGATGGCTGG - Intronic
1030788167 7:113688153-113688175 TGCAAGATTTTGTTGACTGTAGG + Intergenic
1031833956 7:126659234-126659256 TTCACAATTTTGGAGATTGTAGG - Intronic
1035569749 8:664462-664484 TTCACGTGTTTGTTCCTGGTGGG - Exonic
1037210625 8:16382529-16382551 TTCACTCTTTTGGTGCTGGTAGG - Intronic
1037241007 8:16777687-16777709 TTCACCAATGTGATGATGGTGGG + Intergenic
1039866594 8:41510024-41510046 TCCAGGATTTTGGTGAGGGTTGG + Exonic
1039984004 8:42432736-42432758 TTCATTATTTTGCTGATGGAGGG - Intronic
1042258889 8:66836049-66836071 TTCTGGATTTTGTTAATGGAGGG + Exonic
1042725360 8:71869156-71869178 ATAAAGCTTTTGTTGATGGTTGG - Intronic
1043535235 8:81196133-81196155 GTCACCATTTTGTTTTTGGTGGG - Intergenic
1047499695 8:125431407-125431429 TTCACGTTTTTGTGGATCGAGGG + Intronic
1049626772 8:143626905-143626927 TTCCCGATTCTGGTGATGGCCGG - Intergenic
1052374709 9:27706021-27706043 TTCAAGCTTTTGTTGGGGGTGGG + Intergenic
1052465291 9:28821995-28822017 TTCAGGTCTCTGTTGATGGTAGG - Intergenic
1057720994 9:97531868-97531890 TTCAGGGTTTTGTTGATGCTTGG - Intronic
1059085054 9:111291890-111291912 TTGAGGCTTTTGTTGAGGGTTGG - Intergenic
1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG + Intergenic
1188205469 X:27351252-27351274 TTCACAATTTTTGTGAAGGTTGG + Intergenic
1193265252 X:79461338-79461360 TTCATGATTTTTTTGATATTAGG + Intergenic
1193449526 X:81648440-81648462 TTAACGATTTTGTTGTTCATTGG - Intergenic
1194512541 X:94813797-94813819 TTCACTATAATGTTGATTGTGGG + Intergenic
1196323086 X:114367314-114367336 TTCACCATTTTATTGGTGGAAGG + Intergenic
1196637785 X:118023213-118023235 TTCAATATTATGTTGATTGTGGG + Intronic