ID: 993943136

View in Genome Browser
Species Human (GRCh38)
Location 5:94086008-94086030
Sequence TGCCTTCTGTTCTTTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993943136 Original CRISPR TGCCTTCTGTTCTTTCCCAG TGG (reversed) Intronic
901116626 1:6850699-6850721 TGCAGTCATTTCTTTCCCAGAGG + Intronic
902714265 1:18261664-18261686 GTCCTTCTGTTCTGGCCCAGAGG - Intronic
903113331 1:21157137-21157159 TGCTTTCTATTTTATCCCAGTGG + Intronic
903600683 1:24536682-24536704 TGCGTTCTGTTCCTTCCTGGTGG - Exonic
904877396 1:33666779-33666801 TGCCTTCTCTGCTTTCTCTGTGG + Intronic
905042635 1:34972959-34972981 TCCTTTCTTTTCTTTCCTAGAGG + Intergenic
905117651 1:35656323-35656345 TGCCTTCTCATCATTCCCTGAGG - Intergenic
906809984 1:48816869-48816891 TATCTTCTGTGCTTTCACAGTGG - Intronic
906893935 1:49750423-49750445 AGGCTTCTGTTCTGTCCCATTGG + Intronic
908959978 1:69685016-69685038 TGGCTTCTGTGCCTTCCCAGAGG + Intronic
909181220 1:72426339-72426361 TGGCTTCTGTTCTTTTCCATTGG + Intergenic
911125702 1:94339340-94339362 TGCCTTCTGGTGTTCCCCAAAGG + Intergenic
911131422 1:94392230-94392252 TGACATGTGTTCGTTCCCAGTGG + Intergenic
911550372 1:99271668-99271690 TGCCATTTGTGCTTGCCCAGAGG - Intronic
911699698 1:100938067-100938089 GGCTGTCTGTTCTATCCCAGTGG + Intronic
912570607 1:110618460-110618482 TTCCCTCAGTTCTTTCCCTGTGG + Intronic
912572530 1:110634972-110634994 TGCCTTCTGGTCCTTCCCCGGGG - Intergenic
912912094 1:113772475-113772497 TGCCCACTTTTCCTTCCCAGAGG - Intronic
914249712 1:145911733-145911755 TGCCTTCTTTTTTCTCACAGAGG - Exonic
914690446 1:150021257-150021279 TGACGTCTGTTTTTTTCCAGTGG + Intergenic
914701421 1:150137455-150137477 TGCCTTCTGTCCTGTCATAGGGG + Intronic
915777187 1:158502496-158502518 TGCCTTCTGTTCATGCCCTAGGG - Intergenic
917750281 1:178046973-178046995 TTCTTTCTTTTTTTTCCCAGAGG - Intergenic
917944485 1:179954955-179954977 CGCCTTGTCTTCCTTCCCAGCGG + Exonic
919177283 1:194034263-194034285 TGCATTCTGTTCATGCTCAGGGG - Intergenic
921056883 1:211549176-211549198 TGCCTTCTGCACATTCCCTGAGG + Intergenic
921330557 1:214031433-214031455 AGCCTTTTGTTTTTTCCCTGTGG + Intronic
921957535 1:220999840-220999862 TGCCATCTGTACTTTCTCTGGGG - Intergenic
922083569 1:222323555-222323577 TGCCTCTTCTTCTTCCCCAGGGG + Intergenic
922397820 1:225220964-225220986 AGGCTTCTGTTCTGTCCCATTGG - Intronic
923191748 1:231626809-231626831 TGCCTCCTGCTCCTTCCCCGAGG - Exonic
923263287 1:232287927-232287949 TGTTTTCTGTTATTGCCCAGTGG + Intergenic
923637035 1:235708714-235708736 TGCTTTTTGTGCTTTACCAGGGG + Intronic
923838401 1:237640605-237640627 TGGCTTCTTTTCCTTCCTAGTGG - Intronic
924226206 1:241923629-241923651 TGCCTTCTCTGGATTCCCAGAGG - Intergenic
924707829 1:246512931-246512953 TCCCCTCGGCTCTTTCCCAGAGG - Intergenic
1063455471 10:6179528-6179550 ACCCTTCTGTTCATTCCCGGGGG - Intronic
1063562202 10:7139106-7139128 TGCCTTTTTTTGTTTCCCATTGG - Intergenic
1063710621 10:8474244-8474266 TCCCTACTGTTCTTTCCTGGAGG + Intergenic
1064064641 10:12170906-12170928 TTCCTTCTGTTTATTTCCAGGGG - Exonic
1065671854 10:28127911-28127933 TGTCTTCTGTTCCTTCCCATTGG - Intronic
1068390401 10:56388538-56388560 TCCATTCTTTTCTTTCCCAGGGG + Intergenic
1068742134 10:60485531-60485553 TGCCTCCTGCCCTCTCCCAGAGG - Intronic
1069749936 10:70738822-70738844 TGCCCTCTGCTCTGCCCCAGTGG + Exonic
1070386728 10:75932139-75932161 TGTCTTTTGTTTTTTCCCTGTGG + Intronic
1070852508 10:79577929-79577951 TGCCTTTGCTTCTTTCTCAGAGG - Intergenic
1071252831 10:83838405-83838427 TGCCTTCTGGCCCTTCCCAGTGG + Intergenic
1071363614 10:84876780-84876802 TTGGTTCTGTTCTTTTCCAGTGG + Intergenic
1071496264 10:86169571-86169593 TGCCCTGTGTGCTTTCCCTGAGG - Intronic
1072054616 10:91741756-91741778 TCCCTTCTTTTCCTTCCCAATGG + Intergenic
1072690032 10:97566652-97566674 TGCCTGGGGTTCTTTCTCAGCGG + Intronic
1073089719 10:100924923-100924945 AGCCTCCTGCTCTTTCCAAGGGG + Exonic
1074952705 10:118355297-118355319 GCCCTTCTCTTCTTTCCTAGGGG - Intergenic
1075469714 10:122678827-122678849 TGCCTTTTCTTCTGACCCAGAGG + Intergenic
1075752939 10:124788783-124788805 AGGCTTCTGTTCTTTCCTAAGGG - Intronic
1076130071 10:128008078-128008100 TGCCTCCTGTGCCTCCCCAGTGG - Intronic
1076508972 10:130998873-130998895 TGTCTCCGGTTCATTCCCAGTGG + Intergenic
1077280034 11:1739995-1740017 TGCCATCTGTTCTTACACAGCGG - Intronic
1077742843 11:4866743-4866765 GGTTTTCTGTTCTTTCCCATTGG - Intronic
1078307567 11:10205549-10205571 TGCCTTCTGTTGTTAACCTGGGG - Intronic
1078539164 11:12199656-12199678 TGACTTCTGCTCCTCCCCAGGGG - Intronic
1079210028 11:18453066-18453088 TACCTTCTGATCTTTCCCATTGG - Intergenic
1079289897 11:19178594-19178616 TGCCTTCTAGACTTTCCCACTGG - Intergenic
1080822018 11:35816384-35816406 TCCATTCTGTTCCTTCCCAGGGG - Exonic
1081170588 11:39865837-39865859 TGCCTTCTGTTGTTTCTCATGGG + Intergenic
1081800916 11:45858774-45858796 TGCATCCCGTTCTTTCCCAAAGG - Exonic
1082088258 11:48067685-48067707 TGCCTTCTTGTTTTTCTCAGAGG + Intronic
1082272017 11:50182773-50182795 TGGCTTCTGATGTTTTCCAGAGG - Intergenic
1083636041 11:64121472-64121494 TCCTTTCTGGGCTTTCCCAGAGG + Intronic
1084902625 11:72321230-72321252 TGCCTTCTCTTCTTCTCTAGTGG - Intronic
1086038527 11:82445756-82445778 TGCTTTCTGATCTTTTCCAAAGG + Intergenic
1087274158 11:96143791-96143813 AGGCTTCTGTTCTTTCAGAGGGG - Intronic
1088998163 11:115021873-115021895 TGCCATCAGTTCTTTTTCAGGGG - Intergenic
1089355628 11:117850581-117850603 TGCCATCTGTTTTTTCCCTATGG + Intronic
1089847034 11:121466536-121466558 TGACTTCTTTTCTTTCCCCTGGG + Intronic
1090029716 11:123196109-123196131 TGCCTTATGTTCTTTCTGAAAGG - Intergenic
1090447522 11:126776763-126776785 TCCCTGCTGCTCTTTCCCATGGG + Intronic
1090873309 11:130767141-130767163 TGCCTTCTGTGCATCCCAAGAGG - Intergenic
1091262402 11:134245111-134245133 AGCCTCCTGTTCTGTCCCAAGGG - Intronic
1091959211 12:4676960-4676982 AGCCCTCTGTTCTGTCCCATTGG - Intronic
1092060144 12:5543224-5543246 TCACTTTTGTTGTTTCCCAGAGG + Intronic
1092242756 12:6845577-6845599 TGCCCTCAGTTCTTCCCCAATGG + Exonic
1095225672 12:39674413-39674435 TACCTGCTGTTCTGTCCAAGTGG - Intronic
1095357218 12:41289686-41289708 TGGCCTCTGTTCTGCCCCAGTGG + Intronic
1098154569 12:67584100-67584122 TGTCTTCCTTTCTTTCCCAGTGG - Intergenic
1098350251 12:69551966-69551988 TGACTTTTTTTCTTTCTCAGTGG + Intronic
1101496617 12:105260535-105260557 TGGCTTCTGTGCTGTACCAGTGG + Intronic
1102385230 12:112503555-112503577 TTTTTTCTTTTCTTTCCCAGTGG + Intronic
1102711556 12:114932532-114932554 ACCCTTATGTTCTTCCCCAGGGG - Intergenic
1102768057 12:115450673-115450695 TCCCTTCTCTTCTTCCCCTGTGG - Intergenic
1103713243 12:122928680-122928702 TGCCACCTGTTCTTTTCCATCGG - Intronic
1105510301 13:21046328-21046350 TTCTTTCTTTTCTTTCCAAGCGG - Intronic
1105719670 13:23101187-23101209 TGGCTTCAGTTCTTTCCAACAGG + Intergenic
1106522535 13:30510449-30510471 TCCTTTCTTTTTTTTCCCAGAGG - Intronic
1106792446 13:33169267-33169289 TGCCTTTTGTACCTTCCCAGAGG - Intronic
1106866849 13:33973990-33974012 TGTATTTTGTTCTTTCCCATAGG + Intergenic
1107095548 13:36531234-36531256 AGCATTTTGTCCTTTCCCAGTGG - Intergenic
1108560010 13:51633883-51633905 AGCTTTCAGTTCTTTCCCATTGG + Intronic
1108735011 13:53274368-53274390 TACCTTCTCTTTTTTCCCCGTGG - Intergenic
1109163348 13:59003615-59003637 TGCTGTCTGTTTCTTCCCAGAGG + Intergenic
1109216312 13:59593387-59593409 TGATTTCTGTTCTTTTCCATTGG - Intergenic
1109378392 13:61525886-61525908 TGGTTTCTGTTTTTTCTCAGAGG - Intergenic
1109723850 13:66314222-66314244 TGCCTTCGCTCCTTTCCCAGTGG + Intronic
1109879114 13:68448177-68448199 TGCCTTCTTTTCTTTTCTATAGG - Intergenic
1111460729 13:88538438-88538460 TACCTTCTCTTTTTTCCCTGTGG - Intergenic
1111555234 13:89872282-89872304 TCCCTGCTGTTTTTTCTCAGTGG - Intergenic
1111618034 13:90686492-90686514 TGCCTTCTGTGCTGTCCCCAGGG - Intergenic
1111932118 13:94523358-94523380 TGCCTTCTTGCCTTTCCCTGGGG + Intergenic
1112723972 13:102280828-102280850 TGATTTCTGGTGTTTCCCAGGGG - Intronic
1113007408 13:105722693-105722715 TGCCTTCTCTTCTTTTGCTGTGG + Intergenic
1114615467 14:24065659-24065681 TGGCTGCTGTGCTGTCCCAGGGG - Exonic
1115355913 14:32447379-32447401 TTCCTTCTGTTCTTTCTAAGTGG + Intronic
1116349318 14:43839136-43839158 TGCCTTCTGTATCTTTCCAGGGG + Intergenic
1116372139 14:44149816-44149838 TGCTCTCTGCTCCTTCCCAGTGG + Intergenic
1117078210 14:52125317-52125339 TGCCTTTTGTTGTTTCCTGGAGG - Intergenic
1117334391 14:54744472-54744494 TGCCTGCTGGTCTTTACCAGTGG - Intronic
1117819276 14:59631210-59631232 AGCCTACTGCTCTGTCCCAGAGG + Intronic
1117959851 14:61152059-61152081 TCCCTCCTGTCCTTTCACAGTGG - Intergenic
1118643506 14:67816064-67816086 TGCCTTCTGTTTCTTCTCACTGG - Intronic
1122328862 14:100899566-100899588 TCCCTTTTTTTCTCTCCCAGGGG + Intergenic
1125208441 15:37182317-37182339 TCCCTTCTGTTCATTCCCAGGGG - Intergenic
1127027396 15:54822039-54822061 TGCCTTCTCTCTTTTCTCAGAGG - Intergenic
1128407916 15:67362702-67362724 TTGCTTCTCTTCTTTCCCTGGGG - Intronic
1128673927 15:69595151-69595173 TGCCCTCTGTCCTTTCCCAGGGG - Intergenic
1131886819 15:96924704-96924726 TGTCTTCTGGTGTTTCTCAGGGG - Intergenic
1132304332 15:100800637-100800659 ACCCTTCTGCGCTTTCCCAGGGG - Intergenic
1134656798 16:15953660-15953682 TTCCTTCTGGTCTTCTCCAGTGG - Intronic
1134670711 16:16052890-16052912 TTCCTTCTGCTCTGTCCCTGGGG + Intronic
1135863860 16:26082299-26082321 GGTCTTCTGTTATTTCTCAGTGG + Intronic
1135873145 16:26170623-26170645 TTGCTTCTGTTCTTGCCAAGTGG + Intergenic
1136466313 16:30446234-30446256 TGCTTTCTGTTTTTTCCCTTGGG - Intergenic
1136926111 16:34376048-34376070 TGCCTTGTGTTACTCCCCAGTGG - Intergenic
1136978463 16:35035759-35035781 TGCCTTGTGTTACTCCCCAGTGG + Intergenic
1137683169 16:50368655-50368677 GGGCTTCCGCTCTTTCCCAGTGG - Intronic
1138142696 16:54582505-54582527 TGCATTAAGTGCTTTCCCAGTGG + Intergenic
1138487846 16:57358191-57358213 TGCCTGATCTTCCTTCCCAGTGG - Intergenic
1139657381 16:68397262-68397284 TGCCTCCTCCTCTGTCCCAGAGG + Intronic
1139926082 16:70487682-70487704 TGGCCTCACTTCTTTCCCAGAGG + Intronic
1140263512 16:73400858-73400880 TACCTTGTGTTCTTCCGCAGAGG + Intergenic
1140623548 16:76765337-76765359 TGGCTTCTGTTCTCTTCCACTGG - Intergenic
1141853693 16:86666280-86666302 TTCCTTCATTTCTTTGCCAGAGG - Intergenic
1142327543 16:89426047-89426069 TGGCTTTTGTTCTTTAGCAGAGG - Intronic
1143172416 17:4937959-4937981 TGCCTTCACACCTTTCCCAGGGG + Intronic
1143341916 17:6218285-6218307 TGACTTCTTTTCTATCCTAGTGG + Intergenic
1143344750 17:6241452-6241474 TGCCTTCTGTCAGTTCCCAAAGG + Intergenic
1145761015 17:27425581-27425603 TTCCTTCGGCTCTTCCCCAGAGG + Intergenic
1145970799 17:28955392-28955414 TGCCTCCTGCCCTGTCCCAGTGG - Exonic
1147174579 17:38646059-38646081 TGCATTCTATTCTGTACCAGTGG - Intergenic
1148895589 17:50837388-50837410 TGCCTTCTGCTCTGTATCAGAGG + Intronic
1149050371 17:52297275-52297297 TGTCTTCTGTTAATTTCCAGTGG + Intergenic
1151006375 17:70442215-70442237 AACTTTCTGTTCTTTCCCACTGG - Intergenic
1151513163 17:74574541-74574563 TGCCAGCTGTCCTCTCCCAGTGG - Intergenic
1152112611 17:78365602-78365624 TGGCTTCTTTTCTTACCCACTGG + Intergenic
1153711733 18:7806934-7806956 TGCATTGTGTTCTGTGCCAGAGG + Intronic
1154365354 18:13703022-13703044 TGCCTCCTGTTTTTCCCAAGGGG - Intronic
1157390871 18:47302435-47302457 TCCCTTCTCTTCTATTCCAGAGG - Intergenic
1158407788 18:57175768-57175790 TGCCTTCTGGCCTGTCCCTGGGG + Intergenic
1158739683 18:60125916-60125938 TTTCTTCTCTTCTGTCCCAGTGG + Intergenic
1160214991 18:76920845-76920867 CCCCTTCTGTTCTTTACCATGGG - Intronic
1160584573 18:79905195-79905217 AGCCTCCTGGTTTTTCCCAGTGG - Intronic
1161215995 19:3095295-3095317 TGCCCTCTGTTCCTTCTCAAGGG + Intronic
1161641278 19:5424900-5424922 TTTCTTTTTTTCTTTCCCAGTGG - Intergenic
1161729115 19:5948117-5948139 TGCTTTCTGGCCTTTCCTAGGGG - Intronic
1162739312 19:12765123-12765145 TGGCTTCTCTTTTGTCCCAGTGG + Intronic
1164425531 19:28138242-28138264 TCCCATCTGTTCTTTCACCGTGG - Intergenic
1166066904 19:40365612-40365634 TTCCTTTTGTTCTTTACCTGTGG + Intronic
1167337789 19:48897286-48897308 CGCCTTCTGTGCCTCCCCAGGGG - Intronic
925885163 2:8389135-8389157 TTCCTTATGTGCCTTCCCAGTGG + Intergenic
927473360 2:23393457-23393479 TGCCGTCTGTCCTCTCTCAGGGG + Intronic
927702141 2:25275527-25275549 CTCCTTCTGTTCTTTGCCTGTGG + Exonic
930498234 2:52176069-52176091 AGTCTTCTGTCCTTTCACAGTGG + Intergenic
930811229 2:55543763-55543785 TGTTTACTGTTCTTACCCAGTGG + Intronic
931029836 2:58160800-58160822 TGCCGTCTGTACTTTGCCAATGG - Intronic
931455621 2:62407769-62407791 TCCCTTCTGTTCTTTCTCTTAGG + Intergenic
931916765 2:66964532-66964554 TGCCCTGTGTTCTTTGGCAGTGG + Intergenic
933528755 2:83477999-83478021 TGCCTTCCCTTCTTTACCTGGGG - Intergenic
933766045 2:85710426-85710448 TCCATTCTGTACTTGCCCAGAGG - Intergenic
934649628 2:96083536-96083558 TGCCTTCTGTGCTCAGCCAGAGG + Intergenic
935270354 2:101429017-101429039 TGTTTTCTGTTCCTTCACAGTGG - Intronic
935388153 2:102522960-102522982 TGCCTTCTTTTCTTTTCCCTTGG + Intronic
935510682 2:103969284-103969306 GGCTTTCTGTTCTTTCACATTGG + Intergenic
936090301 2:109497898-109497920 TGCCTTCCTTTCTTTCCTTGGGG + Intronic
936654173 2:114465343-114465365 AGCCTCCTGATTTTTCCCAGTGG + Intronic
936922133 2:117699685-117699707 TGCCTTCTGTTGTTTGGTAGAGG + Intergenic
937600773 2:123729102-123729124 TGCCTTCAGATCCTTGCCAGTGG - Intergenic
941446974 2:165613730-165613752 GGTCTTCTGTTCTGTTCCAGTGG + Intronic
941452590 2:165677673-165677695 TGCCTTCTCTTCTTTAGCATAGG + Intronic
942591758 2:177553604-177553626 TGACTTCAGTTTTTTCCAAGAGG + Intergenic
943104984 2:183533674-183533696 AAACTTCTGTTCTTTCCCTGTGG - Intergenic
944453588 2:199870526-199870548 TTCCTTCTTTTCCTTCTCAGAGG - Intergenic
945448222 2:209963328-209963350 TTCCTATGGTTCTTTCCCAGTGG - Intronic
946206250 2:218111068-218111090 TGCCTTCTCGACTTTCCCTGAGG + Intergenic
946813772 2:223554597-223554619 TGCCTGCTGTCCCTTCCCAGTGG + Intergenic
947024289 2:225719194-225719216 TGCCTTGTGTTCTCATCCAGGGG + Intergenic
947537259 2:230948051-230948073 TGACTTCAGTTCTCTCCAAGAGG + Intronic
947768944 2:232655723-232655745 TGCCTTCAGATGTTGCCCAGGGG - Intronic
947874501 2:233459394-233459416 TGCCATCTGCTCTTTTCTAGGGG + Intronic
948525717 2:238569774-238569796 TGCCTTCTGTTCTGTCCTGAGGG - Intergenic
1169571492 20:6911441-6911463 TGCCTTCTGATGCTTTCCAGTGG + Intergenic
1169626406 20:7575500-7575522 GGCTTTCTGTTCTTTTCCATTGG - Intergenic
1170036837 20:11998406-11998428 TGCCTTCTGACCTCTCTCAGGGG + Intergenic
1172493470 20:35360431-35360453 TTCCTTCTTTTCTTTCCCAAAGG + Intronic
1172882383 20:38210560-38210582 TGCATTCCCTTCTTCCCCAGGGG + Exonic
1172960220 20:38793876-38793898 TGGCATCTGTCCTTCCCCAGAGG + Intergenic
1173031968 20:39369642-39369664 TGCCTTTTTTTGTTTCCCATTGG - Intergenic
1173038646 20:39437706-39437728 GGTTTTCTGTTCTTTCCCATTGG + Intergenic
1173618097 20:44415960-44415982 TCCCTCCTGTTCCTTCCCAGGGG + Intronic
1173862326 20:46292180-46292202 TGCCTGCTGAGCTTTCCCACTGG + Intronic
1173954956 20:47024448-47024470 TTGCTTCTGATCTTTTCCAGTGG + Intronic
1174169754 20:48608714-48608736 TGACTTTTGTTCCCTCCCAGAGG + Intergenic
1174324488 20:49768365-49768387 TGCCTTTCATTCTTTCCCAATGG + Intergenic
1174959250 20:55136497-55136519 AGCATTTTTTTCTTTCCCAGTGG + Intergenic
1176170695 20:63695186-63695208 TGCCTCCTGTGCTTACCCACAGG + Exonic
1176999176 21:15590658-15590680 TGCCTACGGATTTTTCCCAGGGG - Intergenic
1177268179 21:18810644-18810666 TGCATTCTGTTCATGCCCTGAGG - Intergenic
1177398600 21:20571028-20571050 TTCCTTCTTCTCCTTCCCAGTGG + Intergenic
1178556665 21:33597288-33597310 TTTCTTCTGTTGTTACCCAGTGG + Exonic
1180580768 22:16834229-16834251 TGCCCTCTGTTCATGCCAAGTGG + Intergenic
1181541626 22:23576057-23576079 TGCCTACTGACCTTGCCCAGTGG + Intronic
1181551497 22:23641392-23641414 TGCCTACTGACCTTGCCCAGTGG + Intergenic
1182030887 22:27158600-27158622 TTCCTTCTTTTCTTTTCCACGGG - Intergenic
1182700720 22:32235487-32235509 TGCCTCCTGATCTTTTTCAGAGG - Intronic
1182848255 22:33449380-33449402 TGACTTCTGCTCTTACCCTGGGG - Intronic
1182941887 22:34284628-34284650 TCCCTGCTGTTCTTTCTCTGTGG + Intergenic
1183156676 22:36081160-36081182 GGACTTCTGTTCCTTCCCACTGG + Intergenic
1184121457 22:42453111-42453133 TGCCTTTGGTTCTTTGCCACGGG - Intergenic
1184365758 22:44050204-44050226 TGCCTTCCTCTGTTTCCCAGTGG + Intronic
949656077 3:6221501-6221523 TGCCATCTTTTCTTTTTCAGTGG - Intergenic
949668114 3:6365114-6365136 TCCCTTCTATTCATTCCTAGTGG - Intergenic
949791790 3:7800957-7800979 TCCTGTCTCTTCTTTCCCAGAGG + Intergenic
950377579 3:12584338-12584360 TGCCTTCTTTTCTATCCCTTTGG - Exonic
951580306 3:24156272-24156294 AGCCTTCTGATCTTGCCCATAGG - Intronic
951743321 3:25948231-25948253 TTCATTCTGTTCTTTCCCAGTGG + Intergenic
951846902 3:27094419-27094441 TGTATTCTTTTCCTTCCCAGGGG + Intergenic
954438800 3:50510356-50510378 TGCCTTCTGTTGTTACCAACAGG - Intergenic
955050162 3:55402652-55402674 TGCCTTCTAATCTTCACCAGTGG - Intergenic
955413397 3:58670512-58670534 TGCCTTCTCTTCTGTCTCAGAGG + Intergenic
956466327 3:69523905-69523927 TGCCTTCTGATCCCTCACAGAGG - Intronic
957104525 3:75869542-75869564 TCCCTTCTGGGCTTCCCCAGTGG + Intergenic
957258629 3:77871555-77871577 TGAACTCTGTTCTTTCACAGTGG + Intergenic
957339142 3:78870729-78870751 AGCCTTGTGTTCACTCCCAGAGG - Intronic
957849557 3:85789976-85789998 TGCTTTATGTTCTTACCCAGTGG - Intronic
957966955 3:87334271-87334293 TGCTTTCTGTCCTTCCACAGTGG - Intergenic
959560283 3:107771866-107771888 TGCCTTTTCTTTTTTTCCAGGGG - Intronic
960592696 3:119380882-119380904 TGCCTTGTGTTCTTCTCCACAGG + Exonic
961974886 3:131013017-131013039 TTCCTTCTGTACTCTCCCACTGG - Intronic
963236587 3:142963011-142963033 TGCCGTCTGTTCTTCCTGAGCGG - Exonic
963720239 3:148853667-148853689 TTCCTTCTGTTCTTTACAATTGG + Intronic
964242300 3:154610339-154610361 TGCATTTTGTTATTTCCCAAAGG + Intergenic
966318055 3:178670911-178670933 TCCCTTTTGTACATTCCCAGAGG - Intronic
966464025 3:180209629-180209651 GGCTTTCTATTCTTTCCCATTGG - Intergenic
966513641 3:180792786-180792808 TGCCCTCTCTTTTTTCCCTGAGG - Intronic
966757989 3:183389476-183389498 TGCAATCTGATCTTTCCCAAAGG - Intronic
967085230 3:186088772-186088794 AGCCCTCTGGTCTTTGCCAGTGG - Intronic
967299345 3:187997345-187997367 GGCTTTCTGTTTTTTTCCAGAGG + Intergenic
968617111 4:1582390-1582412 GCCCTTCTGGTCTTTCCCCGCGG - Intergenic
969453340 4:7287222-7287244 AGCCTTCTCTTCTTCCCAAGTGG - Intronic
970640807 4:18064046-18064068 TGCCTGCTTTTGTTTCCCTGGGG + Intergenic
972391069 4:38614112-38614134 TGCCTTCAGCTCTTTCCCCAGGG - Intergenic
972630028 4:40834703-40834725 TGCCTCCTGTTCTTTCCCTTAGG - Intronic
975282567 4:72578657-72578679 TGCTTGCTTTTGTTTCCCAGAGG + Intergenic
976002014 4:80385845-80385867 TGCCCTGTCTTCTCTCCCAGGGG + Intronic
977096933 4:92758173-92758195 TGCCTTTTTTTCTTTCAAAGTGG + Intronic
977125814 4:93166372-93166394 TGACTTCTTTTCTTTCCCACAGG - Intronic
977195285 4:94051262-94051284 GGCTTTCTGTTCTATTCCAGTGG - Intergenic
977869241 4:102070384-102070406 GGCTTTCTTTTCTTTTCCAGTGG + Intronic
978088934 4:104690714-104690736 TGCCTTTTGTTGTTTTCCATTGG + Intergenic
978328562 4:107586770-107586792 TGTCTTCTGTTCTTGCCTTGAGG - Intergenic
979973760 4:127170074-127170096 TCCTTTCTCTTCTTTCTCAGTGG + Intergenic
980152630 4:129066904-129066926 TTCCTTCTGTCCCTTCCCAGTGG - Intronic
983575792 4:169260396-169260418 TGTGGTCTGTTCTTTCCAAGTGG - Intronic
983589769 4:169395769-169395791 TGCCTTCCTTTCTTCCCCAGGGG + Intronic
983702337 4:170613569-170613591 TGCCTTCTTTCTTTTCCCAAGGG + Intergenic
983826906 4:172273829-172273851 TGCCTTCTTTTCTTTGCCCACGG - Intronic
984091137 4:175376729-175376751 TGGCTTTTTTTCTTTCCCTGTGG - Intergenic
984307816 4:178017212-178017234 TGCCTTTTGTTGTTTTCCATTGG - Intergenic
984844753 4:184099960-184099982 TTGCTTCTGTTCTTTGCCATGGG - Intronic
985697482 5:1348992-1349014 TGCCTGCTGCCCTTTCCTAGTGG + Intergenic
985946156 5:3185684-3185706 TGTCTTCTGTGCTCTGCCAGGGG + Intergenic
986822574 5:11483453-11483475 TGTCATCTGTTCTTTGCCAACGG - Intronic
986869562 5:12030792-12030814 TGCATTCTGTTCATGCCCTGGGG + Intergenic
986901328 5:12437748-12437770 TTCCTTCTCTTCTCTCCTAGTGG + Intergenic
987803916 5:22737101-22737123 TGCTTCCTGTTATTTCCCAGTGG + Intronic
987947549 5:24631288-24631310 TGACTTCTGGTGTTTTCCAGAGG - Intronic
988127331 5:27058024-27058046 TGGCTTCTGGACTTTCTCAGTGG - Intronic
989185069 5:38615917-38615939 TGCTGACTGTTCTTTCCCATAGG - Intergenic
989502561 5:42185794-42185816 TGCCTTCTGGTTTTTTCAAGAGG - Intergenic
991123347 5:63042006-63042028 TGCCTTCTGCTAATTCCCACAGG - Intergenic
993041615 5:82821300-82821322 TGCCTTCTGTGTTTTACAAGTGG - Intergenic
993100559 5:83534000-83534022 TTCTTTATTTTCTTTCCCAGAGG + Intronic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994000315 5:94772066-94772088 TGCACCCTGTACTTTCCCAGTGG + Intronic
996041346 5:118816418-118816440 TGTCTTCTGTTCTGTTCCATTGG - Intergenic
996073127 5:119157652-119157674 TGCCTTCTATTCTGTTCCATTGG + Intronic
996615180 5:125432939-125432961 TAACTTCTGTTATTCCCCAGTGG + Intergenic
997501195 5:134375218-134375240 TGCATTCTGTTATTTCACACTGG - Intronic
997756393 5:136403487-136403509 TGCCTTCTCTCCTTTCACATGGG + Intergenic
998349926 5:141493922-141493944 TCCCTTCTGGTCTTTCCAGGGGG - Intronic
1000555910 5:162725600-162725622 AGCCTTCTGTTCTGTTCCACTGG + Intergenic
1000830355 5:166094324-166094346 TGCATTCTGTTCATACCCCGGGG - Intergenic
1001094331 5:168764592-168764614 TGCCTTCTGTGATTTCCTTGTGG + Intronic
1002121314 5:177006585-177006607 TGCCTCCTTTTCTTCCTCAGCGG - Intronic
1003271118 6:4608864-4608886 TGCCTCCTGTTCTTTCACTCCGG + Intergenic
1003328332 6:5109537-5109559 TTCCTTCTGGCCTTTCCCAGGGG - Intronic
1004249635 6:14012925-14012947 TTCCTTCTGTTGTTTCCAAGGGG + Intergenic
1004674853 6:17831742-17831764 TGCTTTCTGATATTTGCCAGGGG - Intronic
1004927044 6:20425892-20425914 TGCCTTCTGTTGGTTCTTAGAGG + Intronic
1005166407 6:22926777-22926799 AACCTTCTGTTCACTCCCAGTGG - Intergenic
1005615376 6:27567532-27567554 TGCCTTCTCTGCTCTCACAGGGG + Intergenic
1006595608 6:35190955-35190977 TGCAGTCTTTTCTTTTCCAGGGG - Intergenic
1008440208 6:51524304-51524326 TGCATTCTGTACTTTCCTATAGG - Intergenic
1009500987 6:64413492-64413514 AGCCTTCTGTTTTCTCCCTGAGG - Intronic
1009597320 6:65752390-65752412 TGGCCTCTGTTCTATCCCATTGG - Intergenic
1009739815 6:67729925-67729947 AGCCTTCTGTTCTTTTCCATTGG + Intergenic
1011430144 6:87277003-87277025 TGCTTTCTCTTCTTTATCAGAGG + Intergenic
1011909101 6:92412285-92412307 TGCCATCTGGTCTTTTTCAGTGG - Intergenic
1012240196 6:96862560-96862582 TGCCTTATTTTCTATCCCACTGG + Intergenic
1012720463 6:102736277-102736299 TGCCTTCTGGTCTACCCTAGTGG - Intergenic
1013306053 6:108848208-108848230 TGCCTGCTGTTATTTAACAGAGG + Intergenic
1013847012 6:114465358-114465380 TCACTTCTGTTCTTTCCCTTTGG + Intergenic
1016888197 6:148979204-148979226 TGTCTTGTGTCCTTTCCCATGGG + Intronic
1017390436 6:153933106-153933128 TGCTATCTGGTCTTACCCAGTGG + Intergenic
1018565806 6:165151470-165151492 TGTCTTCTACTCTTTGCCAGTGG + Intergenic
1018927933 6:168219718-168219740 TGACTTCTGGTCTTGCCCACTGG - Intergenic
1021759982 7:23894312-23894334 TGCCTTCTGTTATGTGCCTGAGG - Intergenic
1022509199 7:30924327-30924349 TGCCCTGTGTTCTTTCCCCAGGG + Exonic
1022597688 7:31728298-31728320 TGGCTTGTTTTCTTTCCCAGAGG - Intergenic
1023073551 7:36461175-36461197 TGCCTTCAGTTCCTTACCACAGG + Intergenic
1024270047 7:47635338-47635360 TGCCTTCTCCTCTTTCCCGGAGG - Intergenic
1024308411 7:47947424-47947446 TGCCTGCAGATCTTGCCCAGTGG - Intronic
1024360338 7:48461457-48461479 TACCATCTGTTTTTTCCCACTGG - Intronic
1024458884 7:49639216-49639238 TGTCTTCTATTCTTTCCCAAGGG - Intergenic
1025733903 7:64130249-64130271 TGTCTTTTCTTCTTTCCCACTGG - Intronic
1026664745 7:72332590-72332612 TGACTTGTGGTCTCTCCCAGGGG - Intronic
1027261297 7:76466497-76466519 TGTTTTCTGTTCTTACCCTGAGG + Intronic
1027312681 7:76964605-76964627 TGTTTTCTGTTCTTACCCTGAGG + Intergenic
1027539626 7:79452461-79452483 TCCCTTCTTTTCTTCGCCAGCGG + Intronic
1028719134 7:94009372-94009394 TGACTTGTTTTTTTTCCCAGTGG + Intergenic
1029214913 7:98940789-98940811 TGCCTGCTGTGCTCTGCCAGAGG + Intronic
1029892399 7:103944385-103944407 TGCCTTCGGTCCTTTGCCAAAGG + Intronic
1030507925 7:110447696-110447718 TGCCTTTTTTTCTTTCCCCTTGG + Intergenic
1030626170 7:111848514-111848536 TGCATTCTCTTCTCTCCCTGAGG + Intronic
1030945109 7:115709150-115709172 TGCCTTTTTTTTTTTCCTAGTGG + Intergenic
1031002913 7:116438260-116438282 TGTCTTCAGTTGTTCCCCAGAGG - Intronic
1033294865 7:140123158-140123180 TGCCTTCTATTCTATTCTAGTGG - Intronic
1034268206 7:149791282-149791304 TTTCTCCTCTTCTTTCCCAGGGG + Intergenic
1034437084 7:151067852-151067874 TGCCTTCTCTTCTCTCCCCAAGG + Exonic
1036463862 8:8978287-8978309 TTCCAGTTGTTCTTTCCCAGTGG - Intergenic
1036466685 8:9004084-9004106 TGCCTTGTGTTCTTTGACATTGG + Intronic
1037598974 8:20377839-20377861 TGGCTTTTGACCTTTCCCAGGGG + Intergenic
1037702101 8:21284647-21284669 TTCCCTCAGTTCTTTCCCAAAGG + Intergenic
1039464905 8:37777951-37777973 TACCTTCTCTTTTTTCCCACAGG + Exonic
1039690485 8:39859422-39859444 TGTCTCCTTTTCTTTCCCATAGG - Intergenic
1040401673 8:47056622-47056644 TTCCTTTTGTTGTATCCCAGAGG - Intergenic
1041078670 8:54192556-54192578 GGCTTTCTGTTCTTTTCCATTGG + Intergenic
1041228972 8:55730232-55730254 TGCCTTATGCTCTTTGCTAGTGG - Intronic
1041997174 8:64076705-64076727 GCCATTCTGTTCTTTCCCACAGG + Intergenic
1042050592 8:64701055-64701077 TGCCTTCTGTTGTCCCCCTGAGG + Intronic
1042364153 8:67917336-67917358 GGGCTTCTGTCCTTTCCCAAAGG - Intergenic
1043684481 8:83069150-83069172 TGCTTTCTGTGATTCCCCAGTGG + Intergenic
1043729519 8:83657054-83657076 TTTCTTCTTTTATTTCCCAGTGG + Intergenic
1044945490 8:97385171-97385193 TGCATTCTGTTCATGCCCTGGGG - Intergenic
1045619368 8:103956410-103956432 AGGCTTCTGTTCTGTCCCATTGG - Intronic
1046359472 8:113131624-113131646 TCCCTTCTGCACTTTCCTAGCGG - Intronic
1046384314 8:113489331-113489353 TGTCTCCTGTCCTTTTCCAGAGG + Intergenic
1047550373 8:125865301-125865323 GGCTCTCTGTTCTTTCCCACTGG + Intergenic
1047550544 8:125867797-125867819 TTCCTTCTCTTCTTTGGCAGTGG + Intergenic
1048447710 8:134504435-134504457 TGCCCTTTCTTCTTTCCCTGGGG - Intronic
1049127330 8:140803912-140803934 TATCTTCTGTTCTCTCTCAGTGG - Intronic
1050113224 9:2237898-2237920 TGGGTTCTGTTCTAGCCCAGGGG - Intergenic
1050932651 9:11349459-11349481 GGTCATCTGTTCTTTGCCAGAGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051682149 9:19618266-19618288 AGCCTTCTTTTCTTTCCCCTGGG - Intronic
1051708064 9:19901446-19901468 TGTCTTCTGGTCTTTGCCAAAGG - Intergenic
1052429701 9:28350315-28350337 TGCCTTCTTTTGTTTTCCATTGG - Intronic
1053401745 9:37830526-37830548 TCCCTTCTCTTCCTCCCCAGAGG - Intronic
1053603290 9:39631960-39631982 TGCCTTCTGTGCTTCCTCATTGG - Intergenic
1053860922 9:42385679-42385701 TGCCTTCTGTGCTTCCTCATTGG - Intergenic
1054250248 9:62710465-62710487 TGCCTTCTGTGCTTCCTCATTGG + Intergenic
1054564356 9:66744993-66745015 TGCCTTCTGTGCTTCCTCATTGG + Intergenic
1054716561 9:68562705-68562727 TACCAGCTGGTCTTTCCCAGAGG - Intergenic
1055130491 9:72768909-72768931 TGCCTGGGGTTCTTTCCAAGAGG + Intronic
1056436343 9:86578745-86578767 TGCCTCATTTTCTTGCCCAGTGG + Intergenic
1057111313 9:92473977-92473999 TGCCTTCAGCTATTTCCAAGAGG - Intronic
1057333718 9:94140419-94140441 AGCCTTCTCTGCCTTCCCAGAGG - Intergenic
1057425940 9:94949818-94949840 TGCCTTCATTTTTTACCCAGAGG + Intronic
1057727353 9:97577333-97577355 TGCCTTCTGGTCATTCTCAGAGG + Intronic
1058221750 9:102312137-102312159 TGCTATATGTTGTTTCCCAGAGG + Intergenic
1058414652 9:104775011-104775033 TGCCTTCTCTCCTTTCACTGTGG + Intronic
1058610186 9:106768062-106768084 TGACTTCAGTTCTATCCCAAGGG + Intergenic
1059899232 9:118904348-118904370 TCCCTCCTGTTCTTCCTCAGTGG + Intergenic
1186332781 X:8553721-8553743 TGTCTTCATTTCTTTCCCAGAGG - Intronic
1186699691 X:12076963-12076985 TGCCTCCAGTTCTTTCATAGTGG + Intergenic
1187221134 X:17327369-17327391 AGCCTTCTCTCCTTTACCAGAGG + Intergenic
1187765170 X:22633602-22633624 CCCCTTCTTCTCTTTCCCAGAGG - Intergenic
1187940028 X:24372320-24372342 TTCCTTCTGCTCTTTCCCATTGG - Intergenic
1188524040 X:31070918-31070940 TTCCTTCACTTCTTCCCCAGAGG + Intergenic
1188547717 X:31327706-31327728 TGCCTTTTGTTCAACCCCAGAGG - Intronic
1189012760 X:37063146-37063168 TCCCTTCACTTCTTCCCCAGAGG + Intergenic
1189030295 X:37442591-37442613 TCCCTTCACTTCTTCCCCAGAGG - Intronic
1189033912 X:37477001-37477023 TGCCATCTGTTGTTTCTGAGGGG + Intronic
1189082791 X:37992356-37992378 TGCCTGCTGGCCTTTCACAGAGG + Intronic
1189763923 X:44349894-44349916 TGGAGTCTGTGCTTTCCCAGTGG + Intergenic
1190784290 X:53629118-53629140 TGCCTTTTGGTTTTTCCCAGAGG - Intronic
1190820113 X:53966011-53966033 TTCCTTTTGTTCTTTGTCAGTGG - Intronic
1190915692 X:54809549-54809571 TGCCATCAGTTCTTGCTCAGAGG + Intronic
1192712374 X:73604880-73604902 TGATTTCTGTTCTTTTGCAGAGG + Intronic
1195165594 X:102216375-102216397 TGTGTTCTGTCCTTTTCCAGGGG + Intronic
1195193264 X:102470716-102470738 TGTGTTCTGTCCTTTTCCAGGGG - Intronic
1195316408 X:103683390-103683412 GGCCATCTGTTCTGTCACAGTGG + Intronic
1195421758 X:104683397-104683419 TGTCTTCTGTGCATTCCTAGGGG + Intronic
1195482623 X:105364251-105364273 TGCTTTCTGTCCTTTTCCATTGG + Intronic
1195980426 X:110571431-110571453 TCCCTTATGTTCTATTCCAGGGG + Intergenic
1195992666 X:110698165-110698187 TGCCTTTTCTTCTTGCCCTGAGG + Intronic
1196078043 X:111599221-111599243 TTCCTTCTGTTCTATCTAAGAGG + Intergenic
1196144296 X:112299706-112299728 TGCCTCCTGGGCTTTCCCATGGG + Intergenic
1196886401 X:120250651-120250673 TGCCTTCGGTTCTTTCCGCAAGG - Intergenic
1196920754 X:120583083-120583105 TGCCTTCTGTTTTTCCTGAGGGG - Intergenic
1196985532 X:121265827-121265849 TGCCTTTTGTTGTTTTCCATTGG - Intergenic
1197949499 X:131878865-131878887 TGTCTTCTGGTCTCTCCCAAAGG + Intergenic
1198418338 X:136444099-136444121 TGCCTTCTTTTGTTTTCCACTGG + Intergenic
1198761256 X:140034901-140034923 TACCTTTTTTTCTTTCCCAGAGG - Intergenic
1199430836 X:147757913-147757935 TGCTTACTGTTCTTTCCCACTGG + Intergenic
1199930994 X:152521679-152521701 TGCCTTCTATTCTTTCCTTCTGG - Intergenic
1200093660 X:153647432-153647454 TTCCTTTTGTTCTCTCCTAGGGG + Intronic
1200323411 X:155213266-155213288 GGCCTTGGGCTCTTTCCCAGTGG + Intronic
1201196519 Y:11499720-11499742 TGCTTTCTGTTCTATGCCATTGG - Intergenic
1201430184 Y:13895051-13895073 TGCCTTCTCGACTTTCCCTGAGG - Intergenic
1201496124 Y:14592986-14593008 TGCCTTCTCAACCTTCCCAGAGG + Intronic
1202097956 Y:21273233-21273255 TGCCTTGATTTCTTTTCCAGAGG + Intergenic