ID: 993950952

View in Genome Browser
Species Human (GRCh38)
Location 5:94174638-94174660
Sequence CAAGCTTATCCCCCTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993950952 Original CRISPR CAAGCTTATCCCCCTTTAAG AGG Intronic
902242152 1:15096289-15096311 AAAGCTTATCCCCATTTAGGGGG - Intronic
902648298 1:17819402-17819424 CAGGCTTATCTGCCTTTAATCGG - Intronic
905950265 1:41944972-41944994 CAGGTTTCTCCCCCTTGAAGAGG - Intronic
906507429 1:46390640-46390662 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
908451544 1:64260918-64260940 CAAGCTTACTACCCTTTAATAGG + Intronic
908589275 1:65612108-65612130 AAATCTTATCCCGGTTTAAGAGG - Intronic
910590904 1:88927335-88927357 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
915518235 1:156426132-156426154 CATGCTTATGCCCCTTAAGGAGG - Intronic
915773509 1:158455908-158455930 ATAGCTTTTCCCCCTTCAAGGGG - Intergenic
916958052 1:169860849-169860871 CTAGCTTATCTCCCTTTCTGTGG + Intronic
918806214 1:189049152-189049174 CAAGTTTCTCCCCCTTTAATTGG + Intergenic
1070403271 10:76072292-76072314 CAAGGTCACACCCCTTTAAGTGG - Intronic
1072378206 10:94838875-94838897 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1072830013 10:98647553-98647575 CAAGCTTCTCCCCCTTCAGTAGG - Intronic
1079947163 11:26758554-26758576 CAAGGTTTTCCCTCTTTAGGAGG - Intergenic
1083037425 11:59652491-59652513 CAAGCTTATCACCCCTCAGGTGG - Exonic
1085601892 11:77862802-77862824 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1085673470 11:78491508-78491530 CAAGGTTATGCCCCTTCCAGTGG + Intronic
1095248408 12:39948747-39948769 CCAGCTTCTTCCCTTTTAAGTGG - Intronic
1096374267 12:51095164-51095186 CATTCATATCCCCCTTCAAGAGG + Exonic
1097149791 12:56968257-56968279 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
1106690707 13:32112429-32112451 CAAGCTTATACAGCTATAAGAGG + Intronic
1107046858 13:36001986-36002008 CTACCTTATCCCCTTTTAGGAGG + Intronic
1107703743 13:43077604-43077626 CAAGCTTATCCCACTTTGCAGGG - Intronic
1109931629 13:69224363-69224385 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
1110591917 13:77272948-77272970 CAAGCTCATCACCATTTTAGTGG - Intronic
1111021827 13:82460223-82460245 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
1111962342 13:94825445-94825467 CAAGCTTATCTCCCCTTTACAGG + Intergenic
1112973721 13:105291385-105291407 CAAGTTTACACCCCTTTAAGAGG - Intergenic
1119910828 14:78347822-78347844 CAATCTTATCTCCCTTTCAATGG - Intronic
1127074423 15:55311695-55311717 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1127940038 15:63685657-63685679 CAATCTTATCCCCCTGCATGGGG + Intronic
1141375295 16:83524821-83524843 CAAGTTTATCCATCTTTAAATGG + Intronic
1142185956 16:88694849-88694871 CAGGCTTCTGCCCCTTTCAGAGG + Intergenic
1145359998 17:22204122-22204144 CAAGATCATCACCCTTGAAGTGG + Exonic
1147268243 17:39247851-39247873 CACTCTTATCCCCCTTTATAGGG - Intergenic
1149242400 17:54665307-54665329 CAAACTTATCCACCATTTAGAGG - Intergenic
1149274218 17:55015949-55015971 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1157237725 18:45980072-45980094 CAAGCTGCTGCACCTTTAAGAGG - Intergenic
1162005051 19:7772814-7772836 CATTCTTATACCCCTTTGAGTGG - Intergenic
1166020434 19:40024031-40024053 CAAGCTTATTACCCCTCAAGTGG - Intergenic
926864337 2:17341703-17341725 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
929170512 2:38927968-38927990 CATTCTTCTCCCCCTTTAGGTGG - Intronic
939824800 2:147000985-147001007 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
944311439 2:198237934-198237956 TAAGCTTATCCCCCTTGCTGGGG + Intronic
944741768 2:202619495-202619517 ACGGTTTATCCCCCTTTAAGAGG - Intergenic
945230182 2:207580118-207580140 GAAGCTTATCCCCACTTTAGAGG + Intronic
1169864860 20:10188804-10188826 CATCCTTCTCCCCCTTTAAAGGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172513177 20:35514645-35514667 CCAGCTTCTCCTCCTTTAACGGG - Exonic
1177263630 21:18757732-18757754 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
1177896127 21:26857506-26857528 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
1179115586 21:38488979-38489001 CAAGCTTATTCCCCTTGGAGAGG + Intronic
1182533572 22:30982222-30982244 TTAGGTTATCTCCCTTTAAGAGG + Intergenic
951200811 3:19873967-19873989 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
951837747 3:27001728-27001750 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
952113511 3:30152712-30152734 CAAGTTTATCCATATTTAAGGGG - Intergenic
954114460 3:48458031-48458053 CAAGCTTATACCTTTTGAAGGGG + Intronic
957365396 3:79215763-79215785 CAATATTTTCCCCCTTAAAGGGG + Intronic
957365399 3:79215773-79215795 CAAATTGAGCCCCCTTTAAGGGG - Intronic
963187817 3:142438698-142438720 CAGGTTTCTCCCCCTTGAAGAGG - Intronic
963444840 3:145391611-145391633 CAAGCTTATACCCCTTAAGTAGG + Intergenic
964953304 3:162323797-162323819 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
966320206 3:178694134-178694156 CAAGCATATCCTCCTTCATGTGG + Intronic
967393677 3:188982504-188982526 CAATCTTATCCACCTTTTATGGG + Intronic
967560502 3:190912672-190912694 CAAGCCTATCCAGGTTTAAGGGG - Intergenic
967623492 3:191661422-191661444 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
975313946 4:72931094-72931116 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
977408120 4:96626394-96626416 CATATTTATCCTCCTTTAAGTGG + Intergenic
978127115 4:105147502-105147524 CCTTCTTATCCCCCTTTAGGGGG + Intronic
978586929 4:110283756-110283778 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
978909437 4:114047251-114047273 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
980517306 4:133879362-133879384 CAGCCTTATCCCCCTTTCACTGG + Intergenic
984734281 4:183096536-183096558 GAAGATTATCCCCATTTTAGAGG - Intergenic
986531028 5:8737064-8737086 CATGCATAACCCCCTTAAAGGGG + Intergenic
986870893 5:12044596-12044618 CCATCTGATCCCCCTTTCAGAGG + Intergenic
988957297 5:36332413-36332435 CAGGTTTCTCCCCCTTGAAGAGG + Intergenic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
992632032 5:78690883-78690905 CCAGCCTATGCCCCTTTATGAGG + Intronic
993950952 5:94174638-94174660 CAAGCTTATCCCCCTTTAAGAGG + Intronic
998477576 5:142434541-142434563 AAAGCTTGTGCCCCTCTAAGAGG + Intergenic
998616386 5:143745053-143745075 CATGCAGATACCCCTTTAAGTGG + Intergenic
1003560881 6:7178913-7178935 AAAGCTTATCCCACTTGAAAAGG - Intronic
1005323787 6:24680267-24680289 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1011539986 6:88418724-88418746 CAAGTTTCTGCCCCTTGAAGAGG + Intergenic
1013543425 6:111133501-111133523 CAGGTTTCTCCCCCTTGAAGAGG - Intronic
1018760917 6:166893711-166893733 CAGGTTTCTCCCCCTTGAAGAGG - Intronic
1018843175 6:167533221-167533243 CAAGCTTATCCCACTTTCCGTGG + Intergenic
1030337172 7:108339932-108339954 CAGGTTTCTCCCCCTTGAAGAGG - Intronic
1030843615 7:114383640-114383662 CAGGTTTCTCCCCCTTGAAGAGG + Intronic
1031471407 7:122173146-122173168 CAGGTTTCTCCCCCTTGAAGAGG - Intergenic
1032253760 7:130280731-130280753 CAAGTTTATTTCCCTTTGAGAGG + Intronic
1032382190 7:131496956-131496978 CAAGCATATCCCCTTTAAAGAGG - Intergenic
1033507444 7:142019591-142019613 CAAGTTTATCCCTTTTAAAGTGG + Intronic
1034640045 7:152595190-152595212 CAAGCTCAACCCCCCTTGAGAGG - Intergenic
1047444004 8:124903482-124903504 CAGGTTTCTCCCCCTTAAAGAGG + Intergenic
1047540649 8:125762344-125762366 GAAACTTAGCCCCTTTTAAGAGG - Intergenic
1048407567 8:134138842-134138864 CAAGCCTAAACCTCTTTAAGCGG - Intergenic
1057417132 9:94874291-94874313 CAAGAATATCCCACTTTCAGAGG + Intronic
1059098588 9:111446187-111446209 CAAGCTTCCTCTCCTTTAAGTGG + Intronic
1188836796 X:34967532-34967554 CAAGCTTAGTCCCCTTTCATAGG + Intergenic
1189811653 X:44786239-44786261 CAAGCTCATCCTCATTTAAAAGG - Intergenic
1193102627 X:77632799-77632821 CTTGCTTATCTCCTTTTAAGGGG - Intronic
1193764570 X:85510815-85510837 GAATCTTATCCCCATTTAACAGG + Intergenic
1196959734 X:120988643-120988665 CAAGCTTATTCTTTTTTAAGTGG + Intergenic