ID: 993953361

View in Genome Browser
Species Human (GRCh38)
Location 5:94202048-94202070
Sequence CTGGCTAAACTGATTTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 12, 2: 51, 3: 80, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993953361 Original CRISPR CTGGCTAAACTGATTTAGCA AGG Intronic
900804093 1:4755998-4756020 TTGGCTAAACTCACTTAGCAGGG + Intronic
900846637 1:5108547-5108569 CTGGCTAAACTAACTTAGCAAGG + Intergenic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
902195406 1:14794461-14794483 CTGGCTACACCCATTTAGTAGGG - Intronic
905711415 1:40107605-40107627 CTCTCTAAACTGACTTAGCAAGG - Intergenic
905976438 1:42177868-42177890 CTAATTAAAGTGATTTAGCATGG + Exonic
906686202 1:47765042-47765064 CTGGCTAAATGGATTGAGCTGGG - Exonic
908395861 1:63725209-63725231 CTTGCTAAAATGACTTAGCAGGG - Intergenic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
908872331 1:68627789-68627811 CTGAGTCAACTGCTTTAGCAAGG - Intergenic
909839870 1:80306593-80306615 CTGGCAATACTGATACAGCAGGG + Intergenic
910310831 1:85822752-85822774 CTTGCTAAACCGACTTGGCAGGG - Intronic
910365908 1:86465344-86465366 CTGGCTAAACTGACTTGATAGGG + Intergenic
911416396 1:97580673-97580695 TTTGCTAAACTGACTTAGCAGGG - Intronic
911474520 1:98359252-98359274 CTGGCTAAAATGACTTAGCAGGG - Intergenic
912848767 1:113103243-113103265 CTTGCTAAACTGGTTTTACAGGG - Intronic
916217512 1:162410076-162410098 CTTGCCAAACTGACTTAGTAGGG - Intronic
916657844 1:166893151-166893173 CTGGCCAAACTGAAATGGCAAGG + Intergenic
916842712 1:168616144-168616166 GTTGCTAAACTAACTTAGCAGGG - Intergenic
917246399 1:173005593-173005615 CTTGCTAAACTGCTCTAGCTAGG + Intergenic
918222519 1:182448601-182448623 CTGGCAATTCTGATTTAGAAGGG - Intergenic
918732103 1:188012037-188012059 CTTGCTAAACTGACTTAGCATGG + Intergenic
920055888 1:203191412-203191434 CTTGCTAAATTGACTTAGCAGGG - Intergenic
920189188 1:204181549-204181571 TTTGCTAAATTGACTTAGCAGGG + Intergenic
920286225 1:204881825-204881847 CTTGTCAAACTGACTTAGCAGGG - Intronic
922232577 1:223699718-223699740 CTAGCTAAACTGACTTAGCAGGG - Intergenic
922679875 1:227584901-227584923 CTTGCTAAACTGACTTTTCAAGG + Intronic
922683225 1:227618158-227618180 CTTGCCAAACTGCTTAAGCATGG + Intronic
922767558 1:228163791-228163813 CTGGCTAAACTGACTCAGTAGGG - Intergenic
922818218 1:228466354-228466376 CTAGTTAAACTGACTTAGCGGGG - Intergenic
923101002 1:230817448-230817470 CTAGTTAAACTGACTTAGCAGGG - Intergenic
924669125 1:246105199-246105221 CTGGCTAAATTGACTTAGCAGGG + Intronic
1063256135 10:4329247-4329269 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1064443370 10:15372104-15372126 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1065476934 10:26148842-26148864 CTTGCTAAGCTCATTTATCAGGG + Intronic
1066435736 10:35395607-35395629 TCAGCTAAACTGACTTAGCAGGG + Intronic
1066443590 10:35461510-35461532 CTTGCTAATCTGACTTAGCAGGG + Intronic
1067495065 10:46754228-46754250 CCAGCTAAACTGACTTAGCAGGG + Intergenic
1067599590 10:47586168-47586190 CCAGCTAAACTGACTTAGCAGGG - Intergenic
1068139987 10:52993783-52993805 TTTGCTAAAATGACTTAGCAGGG - Intergenic
1069367455 10:67709572-67709594 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1070064033 10:73016106-73016128 CTGGCTAACCTGACTTAGCAGGG - Intronic
1070286341 10:75086636-75086658 CCTGATAAACTGACTTAGCAGGG - Intergenic
1070525326 10:77291457-77291479 CTGCCTAAACTGATTTATGTGGG - Intronic
1071651116 10:87394052-87394074 CCAGCTAAACTGACTTAGCAGGG - Intergenic
1073379184 10:103065139-103065161 CTGAGTCAACTGATTAAGCAAGG - Intronic
1074848052 10:117416204-117416226 CTTGCTAAACTGACTTAGTGAGG + Intergenic
1075839721 10:125490433-125490455 CTGGCTATGCTCAGTTAGCATGG - Intergenic
1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG + Intronic
1078322766 11:10351686-10351708 CTTGCTAAGCCGATTTTGCAAGG + Intronic
1078604915 11:12766748-12766770 GTGGCTAACCTGATTTAAAATGG + Intronic
1078636580 11:13056051-13056073 CTGAATAAACTGATATACCAGGG - Intergenic
1078708325 11:13766272-13766294 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1079916998 11:26381161-26381183 TAGACTAAACTGATTTAGAATGG + Intronic
1080538719 11:33246205-33246227 ATGGAGAAACTCATTTAGCAAGG - Intergenic
1081246931 11:40778649-40778671 CTGGCTAAATAGATTGATCAAGG + Intronic
1081247499 11:40787049-40787071 CTGGTAAAACTTATTTGGCATGG - Intronic
1082701006 11:56430489-56430511 CTTGTTAAACTGACTTAGCGGGG + Intergenic
1082939560 11:58689721-58689743 ATTGCTAAACTGACTTAGCAAGG + Intronic
1083543809 11:63534376-63534398 CCTGCTAAACTGACTTGGCAGGG + Intergenic
1083712331 11:64556847-64556869 CTTGCTAAACTGATTCAGCAGGG + Intronic
1086980112 11:93187305-93187327 CTGGGAAAACTGACTTAGCATGG - Intronic
1087899593 11:103625882-103625904 CTTGTTAAATTGACTTAGCAAGG + Intergenic
1091868432 12:3863909-3863931 CTGGACAAACTGGTATAGCACGG + Intronic
1091885940 12:4017065-4017087 CTTGCTAAACTGACTTTGCAAGG + Intergenic
1092510418 12:9149655-9149677 GTGACTAGACAGATTTAGCATGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093738985 12:22658838-22658860 CTTGCTAAACTGACTCAGTAGGG + Intronic
1094177180 12:27552991-27553013 CTTGCTAAACTGACTTAGCAGGG + Intronic
1095464315 12:42474798-42474820 CTGCTTAGCCTGATTTAGCAGGG - Intronic
1098611216 12:72460523-72460545 CTGGCCAGACTGATTTAGGCTGG - Intronic
1099317092 12:81097634-81097656 CTGGCTAAAGTGAGTTAGGAGGG - Intronic
1099473437 12:83078046-83078068 CTTGCTGAACTGACTTAGCAGGG + Intronic
1100201551 12:92304183-92304205 CAGGCAAACCTCATTTAGCACGG + Intergenic
1100751370 12:97701983-97702005 CATGCTAAACTCACTTAGCAGGG - Intergenic
1100763753 12:97839389-97839411 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1100958630 12:99937654-99937676 ATTGCTACACTGATTTAACAAGG + Intronic
1100989254 12:100234516-100234538 CTTGCTAAACTGACACAGCAGGG + Intronic
1101153834 12:101908729-101908751 CTTGCTAAACTGACTTAGCCAGG + Intronic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1101433603 12:104646381-104646403 CTCCCTAAACTGATTTCTCATGG + Intronic
1101836922 12:108302436-108302458 CTGGCAAAAGTGATTTATTAAGG + Intronic
1102637485 12:114336804-114336826 CTGGCTAACCTGACTTAGCAGGG - Intergenic
1104157277 12:126145522-126145544 CTGCTTAAATTGACTTAGCAGGG + Intergenic
1105370304 13:19796226-19796248 CTTGCTAAATTGACTCAGCAAGG + Intergenic
1105587591 13:21759212-21759234 TTGGCTAAACTGCCTTAGTAGGG + Intergenic
1105815430 13:24032055-24032077 CTTACTAAACTGACTTACCAGGG - Intronic
1106066054 13:26351408-26351430 CTGGCCACGCTGATTTAACAGGG - Intronic
1106090063 13:26583085-26583107 CTGTCCAAACTGCTTTACCATGG - Intronic
1106094011 13:26626387-26626409 CTTGCTAAACACATTTAGCAGGG + Intronic
1106332671 13:28754015-28754037 CTTGCTTAACTGACTTAGCAGGG - Intergenic
1106825789 13:33519024-33519046 CTTGTTAAGCTGACTTAGCAGGG - Intergenic
1108291513 13:48966480-48966502 CTTGCTAAAGTCAATTAGCAGGG + Intergenic
1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG + Intergenic
1109089040 13:58015837-58015859 CTGGCTAGACTGACTTAGCAGGG - Intergenic
1111339918 13:86870956-86870978 CTAGCTAACCTGATTTAGCAGGG - Intergenic
1111742092 13:92217344-92217366 CTTGATAAACTGACTTAGCAGGG - Intronic
1112278706 13:98044266-98044288 CTGGCTAAACTGACTTAGCAGGG + Intergenic
1112613549 13:100980136-100980158 TAGGCTAAACTTATTTAGAATGG + Intergenic
1112904537 13:104400805-104400827 CTTGCTAAAGTGACTTAGCAGGG - Intergenic
1113258453 13:108533094-108533116 CTGGTGAAACTGATTTGGAATGG + Intergenic
1113676473 13:112210410-112210432 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1114676784 14:24446521-24446543 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1116189798 14:41649586-41649608 CTTGCTAAACTGACGCAGCAGGG - Intronic
1117087273 14:52214581-52214603 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1117626731 14:57647740-57647762 CTGGTTAAAGTGACTTAGCAGGG - Intronic
1121288756 14:92757385-92757407 CTTGCCAAACTGACTTAGCAGGG + Intergenic
1121797767 14:96749522-96749544 CTGCCTAAGGTGATTTATCAGGG - Intergenic
1121909519 14:97776362-97776384 CTTGCTAACCTGACTTAGCAGGG - Intergenic
1122579891 14:102764876-102764898 CTTGTTAAACTGATGAAGCAGGG + Intergenic
1126493747 15:49267386-49267408 CTCACTAAACTGATTTAGCAAGG + Intronic
1126685655 15:51246762-51246784 CACGCTAAAAGGATTTAGCAGGG - Intronic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1128480328 15:68032054-68032076 CTTGCTAAATTGACTTAGCAGGG - Intergenic
1128820697 15:70650138-70650160 CTTGCTAAACTGACTTGGTAGGG + Intergenic
1129141945 15:73606894-73606916 CTTGCTAAACTGACTTAGCAAGG - Intronic
1133292285 16:4730332-4730354 CAGGCTCACCAGATTTAGCATGG - Intronic
1133363115 16:5189604-5189626 ATGTCTAAACTGAAGTAGCATGG - Intergenic
1133521688 16:6564520-6564542 CTGGCTTATCTCACTTAGCACGG - Intronic
1134899082 16:17918483-17918505 CTGCCTCAACTGATGTAGTAGGG - Intergenic
1136085063 16:27878944-27878966 CTGGCTAAATTGACTCAACAGGG + Intronic
1138761594 16:59550376-59550398 CTTGCTAAAATGATTTGTCAGGG + Intergenic
1139133289 16:64171689-64171711 GTGGCTTAAATGAATTAGCAGGG - Intergenic
1139280986 16:65770333-65770355 CTGGCTAACCTGATTTTTCTGGG - Intergenic
1203116230 16_KI270728v1_random:1493430-1493452 CTAGCTAATCTCACTTAGCAAGG + Intergenic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1144587235 17:16494467-16494489 CTTGCTAAACTGTCTTAACAGGG + Intergenic
1144588206 17:16501795-16501817 CTTGCTAAACTGACTTAGCACGG - Intergenic
1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG + Intergenic
1144686486 17:17229318-17229340 CCAGGTAAACTGCTTTAGCAAGG + Intronic
1147531985 17:41287887-41287909 CTTGCTAAACCTATTTAGCAGGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151223411 17:72630823-72630845 GTGGTTAAGCTGCTTTAGCAAGG + Intergenic
1153134937 18:1905867-1905889 CTGGCTAAACTGACTTAATAGGG + Intergenic
1153354590 18:4121432-4121454 CTTGCCAAAGTGACTTAGCAGGG - Intronic
1155324799 18:24655053-24655075 CTGTCTAAACTGACTTAACAGGG - Intergenic
1155478564 18:26261077-26261099 CTGGCTAGACTGTTTTAGTGAGG + Intronic
1157988290 18:52464916-52464938 CTACCTAAACTGATTAAGGAAGG - Intronic
1159443593 18:68512257-68512279 CTGGACAAAATGATTTAGCAAGG - Intergenic
1159507457 18:69355834-69355856 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1160005809 18:75068265-75068287 CTGGCTAAACCGATTTGGCAGGG + Intergenic
1163407307 19:17130929-17130951 CCTGTTAAACTGACTTAGCAGGG - Intronic
1164654742 19:29911987-29912009 CTGGATGAACTGATTTGTCAGGG - Intergenic
1164727942 19:30479391-30479413 CAGGCTTATCTGATTTAGCTGGG - Intronic
1165401511 19:35603654-35603676 CTAGCTAAACTGACGTAGAAGGG + Intergenic
1165492402 19:36132078-36132100 CTCGATAAACTGACTTAGCAGGG + Intergenic
1165682757 19:37791496-37791518 CTTGCTAAACTGACTTAAAAGGG + Intronic
1168019700 19:53600310-53600332 GTGGTTAAACTAATTCAGCAAGG + Exonic
926468342 2:13219647-13219669 GTGGCTAATCTGATTTTCCATGG + Intergenic
927064777 2:19460467-19460489 CTTGCTAAACTGATTTAGCAGGG - Intergenic
929276319 2:40028937-40028959 CTGGTTTAACTGAGTTAGCTTGG + Intergenic
929923008 2:46186246-46186268 TTTACTGAACTGATTTAGCAGGG + Exonic
931768126 2:65474831-65474853 CTGGCTAAACCAATTTAGCCGGG + Intergenic
932053354 2:68420481-68420503 CTATCTCAGCTGATTTAGCAGGG + Intergenic
932788743 2:74633333-74633355 CTCGCCAAACTGACTTAGCAGGG - Intronic
932986798 2:76736182-76736204 CTTGCTAAACTGACTTAGCAGGG - Intergenic
934698178 2:96415662-96415684 CTGGCTAAACCAACTTAGCAGGG - Intergenic
935266585 2:101400304-101400326 CTCGCTAAAGTGACTCAGCAGGG - Intronic
935390164 2:102542616-102542638 CTTGCTAAACTGACTTAGAAGGG + Intergenic
935539578 2:104333819-104333841 AGGGCTATACTGACTTAGCAGGG + Intergenic
935682030 2:105646598-105646620 CTGCCAATACTTATTTAGCAAGG - Intergenic
935736266 2:106108911-106108933 CTTGTGAAACTGACTTAGCAGGG - Intronic
936129311 2:109821050-109821072 CTGGCTTCTTTGATTTAGCAAGG + Intronic
936215386 2:110550435-110550457 CTGGCTTCTTTGATTTAGCAAGG - Intronic
936424523 2:112405008-112405030 CTGGCTTCTTTGATTTAGCAAGG - Intronic
937122476 2:119450455-119450477 CTTGATAAACTGATTTGCCATGG - Intronic
937278212 2:120699936-120699958 CTTGCTAAACTGGGTTAGCAGGG - Intergenic
937620432 2:123979132-123979154 CTTGATAAACTGAGTTACCAAGG + Intergenic
937840942 2:126524005-126524027 CTTACTAAACTGACTTAGCAGGG + Intergenic
937850199 2:126625415-126625437 TTGAATAAACTAATTTAGCAAGG + Intergenic
938119170 2:128621915-128621937 CTTGCTAACCTGACCTAGCAAGG - Intergenic
938182879 2:129199593-129199615 CTTGTTAAACTGACTTAGCAGGG - Intergenic
938337492 2:130512403-130512425 CTTGCTAAACTGACTTACCAAGG - Intergenic
938352347 2:130608332-130608354 CTTGCTAAACTGACTTACCAAGG + Intergenic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
939936952 2:148304743-148304765 CTGGCTGAACTGACTTGACAGGG + Intronic
940449215 2:153817360-153817382 CTTGCTAAACTGATTTATCAGGG - Intergenic
943218114 2:185065473-185065495 CTGGCTGAACTGACTTTGCAGGG + Intergenic
944546376 2:200802986-200803008 CTGGCTTATTTCATTTAGCAAGG - Intergenic
945302989 2:208231698-208231720 CTTGCTAAAGTGACTTGGCAGGG - Intergenic
945356099 2:208841390-208841412 TTTGCTAAACTAACTTAGCAGGG + Intronic
946015996 2:216604436-216604458 CTTGCTAGACTGATTTAGCAGGG + Intergenic
946494746 2:220184525-220184547 TTTGCTAGACTGACTTAGCAGGG - Intergenic
947395891 2:229686436-229686458 CTGGCCAACCTGACTTAGCCTGG + Intronic
948751846 2:240137658-240137680 CTGGCTAAACCAACTTAGCAGGG - Intergenic
1169830329 20:9818123-9818145 TTTGCTAAACTGACTTAGCAGGG - Intronic
1170418099 20:16165730-16165752 CTTGCTAAACTGACTTATCAGGG + Intergenic
1177403464 21:20636367-20636389 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1177415552 21:20788509-20788531 CTTGCTAAACTGACTTAGCTGGG + Intergenic
1177782363 21:25634846-25634868 CTAGCTAAACTGATTTGTTAGGG - Intergenic
1179455839 21:41499433-41499455 CTGGCTAAACTGACTGAGCAAGG - Intronic
1179730118 21:43363025-43363047 CTGGGCAAACTGATTTATGATGG + Intergenic
1179794588 21:43775761-43775783 CTGGCTAAACTGACTTAGCCAGG - Intronic
1181016445 22:20071839-20071861 CTTGCTAAAGTGACTTTGCAGGG + Intergenic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
1183682902 22:39344343-39344365 CTTGCTAAACTGACTTAGGAGGG + Intergenic
1184903188 22:47460382-47460404 CCGGCCAAACTGATTTTTCAGGG - Intergenic
949915877 3:8964127-8964149 CTTGGTAACTTGATTTAGCAGGG - Intergenic
951575653 3:24111113-24111135 CTGGCTCATCTGCTTTTGCAGGG + Intergenic
951591245 3:24267552-24267574 TTGGTTAAACTGACTTAGCAGGG - Intronic
951693219 3:25418792-25418814 CTGGCCAAACTGACTCAGAAAGG + Intronic
952875061 3:37937772-37937794 CTTGCTAAACTGATTTAGCAGGG + Intronic
954685535 3:52368190-52368212 CTGGCTAAACTGACTTAGCAGGG + Intronic
955302054 3:57789540-57789562 CTGGCTAAACTGACTTAGCAAGG + Intronic
957219371 3:77362511-77362533 CTTGCTAAACTGACTTAGCAGGG + Intronic
957516472 3:81259877-81259899 CTAATTAAAATGATTTAGCAGGG - Intergenic
957782248 3:84834577-84834599 TTAGCTAAACTGATTTAGCAGGG + Intergenic
957928944 3:86852332-86852354 CTGGCAAAAATAATTTTGCATGG + Intergenic
958055423 3:88404900-88404922 CTTATTAAACTGACTTAGCAAGG - Intergenic
959051573 3:101529385-101529407 CTTGCTAAACTGACTTAGCAGGG - Intergenic
959770596 3:110090510-110090532 CTTTCTAAACTGACTTGGCAGGG + Intergenic
959842514 3:110994548-110994570 CTTGCTAAACTGACTTAGTTGGG + Intergenic
959856977 3:111170793-111170815 CTTGCTAAACTAACTTAGCAGGG + Intronic
960924935 3:122785369-122785391 CTTGCTAAACTGACTTAGCAAGG - Intronic
962107988 3:132413824-132413846 TTGGCTAAACTGACTTAGCCAGG - Intergenic
962581748 3:136804301-136804323 CTTGCTAAACCAACTTAGCAGGG - Intergenic
963769075 3:149370417-149370439 ATGGCTGAAGTGATTTGGCAGGG - Intronic
963774404 3:149423354-149423376 CTTGCTAAACTGACTTAGCAGGG + Intergenic
964016050 3:151948134-151948156 CTGGCTAAACAGTCTTAACAGGG + Intergenic
964275129 3:155001380-155001402 CTTGCTAAACAGACTCAGCAGGG - Intergenic
964372393 3:156014149-156014171 CTGGCTTATCTCATTTAACATGG - Intergenic
964828729 3:160859316-160859338 CTGACCAAACTGAATTAGCCTGG - Intronic
965463122 3:168993500-168993522 TTGGCCAAACTTACTTAGCAGGG - Intergenic
965681858 3:171260025-171260047 CTAGCTAAACTGACTTAGCAGGG - Intronic
966238473 3:177728610-177728632 CCTGCTAAACTGACTTAGCAGGG + Intergenic
967087147 3:186106135-186106157 CTGGGTAAATGGATTTGGCACGG - Intronic
971025462 4:22585025-22585047 CTTGCTAAACTGACTTAGTAGGG - Intergenic
973071831 4:45869738-45869760 TTGGAGAAACTTATTTAGCAGGG + Intergenic
973177383 4:47224620-47224642 CTTGCTAAACTGACTTAGTGGGG + Intronic
974763812 4:66313982-66314004 GAGGCTTAACGGATTTAGCAAGG - Intergenic
977993676 4:103476374-103476396 CTTGCTAAACATAGTTAGCAAGG + Intergenic
977997642 4:103514669-103514691 CTGGCAAAACTGTTTCACCAGGG + Intergenic
978340172 4:107714189-107714211 CTGACTAAAACGATTTAACAGGG - Intronic
978926183 4:114248454-114248476 CTTGCTAAACTGACTTAGAAAGG - Intergenic
979129650 4:117026409-117026431 CTTGCTAAACTGACTTAGCAGGG + Intergenic
980642574 4:135598766-135598788 ATGGCTAAAGTCATTTAACAAGG + Intergenic
980653802 4:135756093-135756115 CTTGGTAAACTGATTTAGCAAGG + Intergenic
981122886 4:141073097-141073119 CTGGCTCACCTGATGTAGCTGGG - Intronic
984279336 4:177650159-177650181 CTTGCTAAACTGATTTAGCAGGG - Intergenic
984632336 4:182074127-182074149 ATGGCTAAACTGCTTTACAAGGG + Intergenic
986613674 5:9594673-9594695 CTTGCTAAACTGACTTGGCCGGG + Intergenic
987148208 5:15013027-15013049 CTTGCTAAAGTGACTTAGTAGGG + Intergenic
987259791 5:16191863-16191885 CTCACTGAACTGACTTAGCAGGG - Intergenic
987854104 5:23396593-23396615 CTTGCTAAACTGACTTAGCAGGG - Intergenic
988131853 5:27116578-27116600 CTTGCTCAACTGATCTAGCAAGG + Intronic
988297503 5:29384609-29384631 CTTACCGAACTGATTTAGCAGGG - Intergenic
990276372 5:54201458-54201480 CTTGCTGAACTGACTTAGCCAGG - Intronic
992288626 5:75262067-75262089 CTTGCTAAACTGACTTAGCAGGG - Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
996703652 5:126475079-126475101 CAGGGTAAACTGCTTTAGAAGGG - Intronic
998446515 5:142203048-142203070 CTGGCTAAACTGTCTTGGGAAGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
1000273403 5:159709423-159709445 CTTGCTAAACTGATTTAGCAGGG + Intergenic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1000778140 5:165444517-165444539 CTGGAGAAACTAATTTAGAAAGG - Intergenic
1001402825 5:171456163-171456185 CTTGCTAAACTGACTTAGCAGGG - Intronic
1005419856 6:25637846-25637868 CTTGCTAAAGTGACTTAGCAAGG + Intergenic
1005577640 6:27205124-27205146 GTTGTTAAACTGATTTATCAGGG - Intergenic
1005660627 6:27995524-27995546 CTGGCTAAGATGACTTATCATGG - Intergenic
1005762274 6:28978155-28978177 CTTGCTAAACTGACTTGGCAGGG - Intergenic
1006445851 6:34079382-34079404 CTGGCTAAACTGTTGTTGCAGGG - Intronic
1007044558 6:38759647-38759669 CTTGCTAAACTGACTTAGCAGGG - Intronic
1008152211 6:47967623-47967645 CTGGCTAATATGATGTACCAAGG - Intronic
1010917486 6:81638466-81638488 CTTGTTAAACTGACTTAGCAAGG - Intronic
1012497016 6:99844679-99844701 TTTGCCAAACTGACTTAGCAGGG - Intergenic
1012669311 6:102020596-102020618 CTTGCTAAACTGACTTAACAGGG + Intronic
1014595050 6:123325610-123325632 CTGTTTAAACTGATATAACAGGG - Intronic
1014854317 6:126380971-126380993 CTTGCCAAACTGTCTTAGCAGGG - Intergenic
1015978872 6:138818883-138818905 CTTCCTAAACTGACTTAACAGGG + Intronic
1016388812 6:143554632-143554654 CTCGGTAAACCAATTTAGCAGGG + Intronic
1016583955 6:145662786-145662808 CTTGCTAAATTGACTTAGCTGGG + Intronic
1020591120 7:10138447-10138469 CTGGCTAAACTGATTTAGCCAGG - Intergenic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1021812716 7:24418974-24418996 CTGGCTAAGCTGATATAACAAGG + Intergenic
1022136374 7:27453228-27453250 CTGGCTTAACTGAATCAGGAAGG + Intergenic
1022159583 7:27695721-27695743 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1022378830 7:29840980-29841002 CTTGCTAAACCGACGTAGCAGGG + Intronic
1023083468 7:36547059-36547081 ATGGGAAAACTGATTTGGCAAGG - Intronic
1023197176 7:37653876-37653898 CTGGCTTAGTTTATTTAGCATGG + Intergenic
1024146929 7:46526535-46526557 ATGGCCAAACTGATTAAGCCTGG + Intergenic
1025006909 7:55362647-55362669 CTTCCTAAAGTGACTTAGCAAGG + Intergenic
1025963445 7:66245520-66245542 CTTGCTAAACTGCCTTAGCAGGG + Intronic
1026288667 7:68986375-68986397 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1026863052 7:73806077-73806099 CTGGCTAAATTGACTTAACCAGG - Intronic
1026901707 7:74040934-74040956 CTGGCTAACAAGATTCAGCAGGG - Intronic
1027699952 7:81457452-81457474 CTTGCTAAAATGACTTAACAGGG - Intergenic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1028122248 7:87069414-87069436 CTGGCTTAAATAATTTAGGAAGG - Intergenic
1029865274 7:103620927-103620949 CTGGCTGAAAACATTTAGCATGG + Intronic
1030845252 7:114401111-114401133 CTAGCTAAACTGACTTAGTAGGG + Intronic
1033231245 7:139599902-139599924 CTTGCTAAACTGACTTAGCAAGG - Intronic
1033991044 7:147287374-147287396 CTTGCTAAACTGACTTAGCAGGG + Intronic
1033993000 7:147311101-147311123 CTGGCTAAACTGACTTCGCAGGG + Intronic
1035241477 7:157533430-157533452 CTTGCTAAACTGACTTAACATGG - Intergenic
1036507602 8:9369584-9369606 CTGGTCAAACTGAATTAGAAGGG - Intergenic
1038163386 8:25061674-25061696 CTGGCTAAACTCATACAGCAGGG + Intergenic
1039230933 8:35447168-35447190 TTGGCTAAACTCACTTAGCAAGG + Intronic
1039733925 8:40309599-40309621 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039734251 8:40313927-40313949 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039850340 8:41359170-41359192 CTGGCTAACCTGATTTAGCAGGG + Intergenic
1041236440 8:55807470-55807492 CTGCCCAAACTGATATAGCTGGG + Intronic
1041322336 8:56626216-56626238 CTTGACAAACTGACTTAGCAAGG - Intergenic
1041652721 8:60316983-60317005 CAGGCTAAACTGACTTAGCAGGG - Intergenic
1042383727 8:68149732-68149754 CTGCCTTAATTGATTTTGCATGG - Intronic
1043704983 8:83337600-83337622 CTGGCCAAACTGATTTATATAGG + Intergenic
1043775301 8:84259917-84259939 TTTGCTCATCTGATTTAGCAGGG + Intronic
1044123090 8:88422670-88422692 CTTGCTAAACTAACTTTGCAGGG - Intergenic
1046335194 8:112776971-112776993 CTGGATAGAATGATTAAGCATGG + Intronic
1048567319 8:135615133-135615155 CTTGCTAAACTGGCTCAGCAAGG + Intronic
1049297454 8:141850272-141850294 CTTGATAAACTGACTTAGCAGGG + Intergenic
1050317210 9:4414728-4414750 CTGGCTAAAACAATTTAGCAGGG - Intergenic
1050760502 9:9063829-9063851 CTGGCAAAAGTGATTTAGACTGG - Intronic
1052804696 9:33002387-33002409 CTTGGTAAACTGACTTAGCCAGG - Intronic
1053185380 9:36011925-36011947 CTTGCTGAACTGACTTAGCAGGG + Intergenic
1053537181 9:38937572-38937594 CTTACTAAACTGACTTAGCAGGG + Intergenic
1053809821 9:41840544-41840566 CTTGCTAAATTGACTTAGCGGGG + Intergenic
1054620772 9:67346884-67346906 CTTGCTAAATTGACTTAGCGGGG - Intergenic
1054628954 9:67426358-67426380 CTTACTAAACTGACTTAGCAGGG - Intergenic
1055388279 9:75788545-75788567 CCAGCAAAAATGATTTAGCAAGG + Intergenic
1057377033 9:94534482-94534504 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1059306917 9:113360957-113360979 CTGGCTACACTGACTTAGCAGGG - Intronic
1059350317 9:113659632-113659654 CTGGTTACACTGACTTAGCAGGG + Intergenic
1060054617 9:120402884-120402906 CTGGCTGATCTGTTTGAGCAGGG + Exonic
1061494453 9:130963707-130963729 CTGACCACACTGATTTAGCAGGG + Intergenic
1062314909 9:135962107-135962129 CTTGCTAAACTCACTTATCAAGG - Intergenic
1185986824 X:4844555-4844577 CTTGCTAAACTGGCTTAGCAGGG - Intergenic
1186045591 X:5533155-5533177 CTGGCTCAGATGATTTTGCAAGG - Intergenic
1186244342 X:7605149-7605171 CCTGCCAAACTGACTTAGCAGGG - Intergenic
1186550253 X:10497374-10497396 CTGGCTAAACCAACTCAGCAGGG - Intronic
1186858807 X:13651513-13651535 TTGGCTAAACTGATTTATCAAGG - Intergenic
1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG + Intergenic
1188458886 X:30399319-30399341 GTGGTTAAACTGAATTAGGAGGG - Intergenic
1188988807 X:36792056-36792078 CTTTCTTAACTGACTTAGCAGGG - Intergenic
1189630604 X:42948585-42948607 CTGGCTCAGGTGATATAGCAGGG + Intergenic
1190110198 X:47584378-47584400 CTTGCTAAACTGACTTAGCAAGG + Intronic
1190680689 X:52825678-52825700 CTGCTTCATCTGATTTAGCAAGG + Intergenic
1190998312 X:55634430-55634452 CTGCTTCATCTGATTTAGCAAGG + Intergenic
1192614237 X:72601578-72601600 CTGGCTAAACTGACTTAGCAGGG + Intronic
1193552501 X:82914381-82914403 GTTGCTAAACTGACTTAACAGGG - Intergenic
1194062281 X:89218485-89218507 CTGGCTAAACTGGCTTAGCAGGG - Intergenic
1194088817 X:89561190-89561212 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1194497315 X:94634082-94634104 TTGGTCAAACTGATTTTGCAAGG + Intergenic
1194770826 X:97902814-97902836 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1195652370 X:107298533-107298555 CTTGCTAAACAGACTTAGCAGGG + Intergenic
1196596084 X:117547098-117547120 CTTGCCAAACTGATTTTTCAAGG - Intergenic
1197907364 X:131440396-131440418 CTGGCTAAGTGGATTTTGCATGG - Intergenic
1200441490 Y:3217241-3217263 CTGGCAAAACAGATTTTGAAAGG - Intergenic
1200716148 Y:6547451-6547473 CTGGCTAAACTGGCTTATCACGG - Intergenic
1201966325 Y:19740585-19740607 GTGTGGAAACTGATTTAGCAGGG - Intronic