ID: 993953365

View in Genome Browser
Species Human (GRCh38)
Location 5:94202098-94202120
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 5, 1: 26, 2: 63, 3: 90, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
901668100 1:10837903-10837925 GGAGGTGGACTCATGGACCTTGG + Intergenic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902657546 1:17879710-17879732 GGGAGAGCACAGATGTACCCAGG + Intergenic
904314363 1:29650716-29650738 GGCTGTGCACAGATGGACACAGG - Intergenic
904588745 1:31595577-31595599 GGAAATGCTCAGATGGGCTTAGG - Intergenic
905640748 1:39588156-39588178 GGAAGTGCACGGATTGGCCTAGG - Intergenic
907125004 1:52041993-52042015 GGAAGTGGAGTCATGGACCTAGG - Intronic
907452305 1:54553373-54553395 GGATGTGCCCAGTTGAACCTGGG + Intronic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
908912615 1:69089593-69089615 GGACATATACAGATGGACCTAGG - Intergenic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
911416440 1:97581006-97581028 GGAAGTACACAGGTGGGCCTTGG + Intronic
911511982 1:98818099-98818121 GAAAGGGCACAGATGGACAAGGG - Intergenic
913566423 1:120077259-120077281 GGAGTTGATCAGATGGACCTGGG - Intergenic
913631708 1:120716290-120716312 GGAGTTGATCAGATGGACCTGGG + Intergenic
914287182 1:146237975-146237997 GGAGTTGATCAGATGGACCTGGG - Intergenic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
914548214 1:148688717-148688739 GGAGTTGATCAGATGGACCTGGG - Intergenic
914618469 1:149382989-149383011 GGAGTTGATCAGATGGACCTGGG + Intergenic
914991821 1:152505294-152505316 GGAAGTGCACACACACACCTGGG + Intergenic
915931586 1:160063656-160063678 GGGAGAGCAGAGATGGAGCTAGG + Intronic
916217506 1:162410027-162410049 GGAAGTACACAAATGGGCCTTGG - Intronic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
918983138 1:191589128-191589150 GGTAGTGCACAGATGAGTCTAGG + Intergenic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920722528 1:208400954-208400976 GGAAGCCCCTAGATGGACCTTGG - Intergenic
922070253 1:222185296-222185318 GGAAGTAGACAGACAGACCTGGG + Intergenic
922222543 1:223619353-223619375 GGAGGTGCACAAATGGAACCTGG - Exonic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922369594 1:224896057-224896079 GTAAGTGCACAGATAGGCTTAGG + Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
924431250 1:243998573-243998595 GGAAGTGGACAGATGGAGCGCGG - Intergenic
924653011 1:245947993-245948015 GGAACAACACGGATGGACCTAGG - Intronic
924727071 1:246681002-246681024 GAAAGAGACCAGATGGACCTTGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063974219 10:11402345-11402367 GGAGGTGTACAGATGAGCCTCGG - Intergenic
1064555047 10:16539540-16539562 GGAAGGACAGAGATGGACATTGG - Intergenic
1065982147 10:30910044-30910066 AGAAGTGCCCAGTTGAACCTAGG - Intronic
1066292295 10:34025505-34025527 GGAAGGGCAAAGTTGGATCTGGG - Intergenic
1066443595 10:35461559-35461581 GGAAGTGCACAGTTGGGCCCAGG + Intronic
1066515029 10:36149079-36149101 AAAAGTGCACATATGGCCCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1068243847 10:54339661-54339683 GGAAGTATACAGATGAGCCTAGG - Intronic
1069473741 10:68715236-68715258 TTAAGTGCACAGGTGGGCCTAGG + Intergenic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1071586744 10:86830318-86830340 GGAAGTACACAGATAGGCCTGGG + Intronic
1072576434 10:96704808-96704830 TAATGTGCACAGAAGGACCTGGG - Intronic
1073539289 10:104305382-104305404 GGACACGCACAGATGAACCTAGG + Intergenic
1073725644 10:106227072-106227094 GGAAGTCCAGAGATAGACATAGG - Intergenic
1074848058 10:117416252-117416274 GGAAGCACACAGATGGGCCTAGG + Intergenic
1074954370 10:118373680-118373702 GGTAGTGCACCCATGGACTTGGG - Intergenic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075624768 10:123954298-123954320 GGAAGTGCACAGACGGGCCGAGG + Intergenic
1075665040 10:124223935-124223957 GGAAGTGCACAGGAAGGCCTGGG - Intergenic
1075935316 10:126335847-126335869 GGAAGATCACAGATGGAAGTGGG - Intronic
1077117421 11:891441-891463 GGAAGTGGGCAGTTGGAGCTGGG - Intronic
1080090459 11:28342190-28342212 GGAAGGGCATAGATACACCTGGG - Intergenic
1084661113 11:70546917-70546939 GGAAGCGCACAGATGGACTCAGG - Intronic
1084857512 11:71998470-71998492 GGAGGCCCACAGATGGAACTGGG - Intergenic
1085455535 11:76663441-76663463 GGAAGCGCAGAGCTGGACCAGGG - Intronic
1085523918 11:77153542-77153564 GGAAGTCCAGAGAGGGACATGGG - Intronic
1086694232 11:89824709-89824731 GGCAGTGCAGAGATGGAGCAGGG - Intergenic
1086711914 11:90019802-90019824 GGCAGTGCAGAGATGGAGCAGGG + Intergenic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1087658338 11:100954614-100954636 GGAAGTTCTCAGATGTCCCTAGG + Intronic
1087899600 11:103625928-103625950 GGAAGTGCACAGATGGGCAAAGG + Intergenic
1088066208 11:105723039-105723061 GGAAGAACACAACTGGACCTTGG + Intronic
1089162284 11:116447842-116447864 GGAAGGGCACACAAGGTCCTAGG + Intergenic
1089776346 11:120839318-120839340 GGAAAGGCATGGATGGACCTTGG + Intronic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1092000841 12:5030726-5030748 AGGAGTACACAGATGGACCTAGG + Intergenic
1094122172 12:26986161-26986183 AGATGTGCGCAGATGGGCCTAGG - Intronic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094474088 12:30827967-30827989 GGATGTGCCCAGATGGGCCTTGG - Intergenic
1094496981 12:30994726-30994748 CTAAGTGCACAGCAGGACCTTGG - Exonic
1096498393 12:52051472-52051494 GGGAGTGCACAGAAGAACTTCGG + Intronic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100763757 12:97839437-97839459 GGAAGTACACAGATGGGCCCAGG + Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102061728 12:109937671-109937693 TCAAGTGCAGAGATGGACTTGGG + Intronic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1102637480 12:114336756-114336778 GGAAGTACACAGATTGGCCCAGG - Intergenic
1102772203 12:115487821-115487843 GGTGGTTCACAGATGGACATTGG + Intergenic
1103251590 12:119504620-119504642 GGAAGTGTACACATGGAATTTGG + Intronic
1103944719 12:124519613-124519635 GGAAGTGGTCAGATGGACTCTGG + Intronic
1104633163 12:130421949-130421971 GGAGGTGCCCAGATGGATGTGGG + Intronic
1105052135 12:133064127-133064149 GGAAGTTCAAAGAGGCACCTAGG + Intergenic
1105725667 13:23160167-23160189 GGAAGGACACAGAGGGACATAGG + Intergenic
1106332668 13:28753966-28753988 GGAAGTGCATAGAAGGCCCTAGG - Intergenic
1106825786 13:33518994-33519016 TAAAGTGCTCAGATGGGCCTAGG - Intergenic
1106948295 13:34853528-34853550 GGAAGTGCACAGAAAGGCCTAGG + Intergenic
1107502341 13:40993374-40993396 GGCAGTGCACCGATGGGTCTGGG + Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1108700237 13:52937537-52937559 AAAAGAGCCCAGATGGACCTTGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1110893271 13:80716457-80716479 GGAAGTACAGAGATGGGCCTAGG + Intergenic
1112278710 13:98044314-98044336 GCAAGTGCAGAGATGGGCCTAGG + Intergenic
1114926412 14:27405573-27405595 GGAAATGCTCATATTGACCTTGG - Intergenic
1115788280 14:36850887-36850909 GGGAGTGCACACAGGGACCACGG + Intronic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119928934 14:78525519-78525541 GGCAGTGCACAGATAGGGCTGGG - Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1120280217 14:82429741-82429763 GGGAGTTCACAGATGGGCCAAGG + Intergenic
1121271112 14:92638921-92638943 GGAAGTGCTTCGATGGAGCTGGG - Intronic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1123003999 14:105312730-105312752 CCAAGTGCACAGATGTCCCTTGG - Exonic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1131588061 15:93717506-93717528 AGAAGTGCACACATGGATCCAGG + Intergenic
1131962899 15:97807992-97808014 AGAAGTGGACAGGTGGAACTGGG - Intergenic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1132644085 16:990836-990858 GGCAGTGCCCAGATGGGCCCAGG + Intergenic
1132699047 16:1214504-1214526 GGTACTGCCCAGATGGACCTGGG - Intronic
1133456407 16:5946170-5946192 GAAAGTGCACAGACGGCCCGAGG + Intergenic
1135054713 16:19221279-19221301 GGTGGTGCACTGATGGGCCTAGG + Intronic
1136654677 16:31702820-31702842 GTGAGTGGACAGATGTACCTGGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1141644625 16:85360594-85360616 GGCAGTGCACAGCTGGGCCCGGG - Intergenic
1143508370 17:7381913-7381935 GGAAGGACACAGATGAGCCTGGG + Intronic
1143880321 17:10024887-10024909 CGATGGGTACAGATGGACCTGGG - Intronic
1144220761 17:13097770-13097792 GAAAGCGCATAGATGGGCCTAGG + Intergenic
1144344818 17:14340176-14340198 GGAAGTGCACAGGAGGTCCTGGG - Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144646525 17:16978388-16978410 GGCAGTGCACAGATGTTTCTCGG + Intergenic
1144994869 17:19260500-19260522 GGAAGGACACAGGTGGACCTGGG + Intronic
1145990733 17:29077919-29077941 GGAAGTCAGCTGATGGACCTGGG - Exonic
1147214716 17:38892492-38892514 GGAGGGGCTCAGAAGGACCTCGG + Intronic
1147685558 17:42284818-42284840 GTAAGTGCACAGATGGCACCAGG - Intergenic
1149461176 17:56831466-56831488 CCAAGTGCTCAGATGGACATAGG + Intronic
1152408737 17:80111585-80111607 GGAAGTACAAGGATGGGCCTGGG + Intergenic
1152535789 17:80949716-80949738 GGCAGTGCACTCAGGGACCTGGG - Intronic
1153095329 18:1394784-1394806 GGAAGAGCACGGATGGGACTAGG + Intergenic
1153354584 18:4121383-4121405 GGAAGTGCCTGGATGGGCCTAGG - Intronic
1153944233 18:10004630-10004652 GGAAATGCACATATGGGTCTAGG - Intergenic
1157607678 18:48936162-48936184 GGAAGTACATTGATGGACCAGGG - Intronic
1158094853 18:53758746-53758768 GGAAGTGCAGAAATGGGCCTAGG + Intergenic
1159140916 18:64393173-64393195 GGAAGTTCACAGATGTGCCTAGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159821731 18:73154416-73154438 GGAAGGGCAGAGAAGGGCCTGGG - Intronic
1160508608 18:79441051-79441073 GGAACAGCACAGATGGCCCCTGG + Intronic
1162060109 19:8089830-8089852 GGCAGTGCGGAGATGGATCTGGG + Intronic
1162325634 19:9997463-9997485 GGAAGTGCAAAGTTTGAGCTAGG + Intronic
1163407302 19:17130881-17130903 AGAAGTGCACAGATGGGACTGGG - Intronic
1164694398 19:30232742-30232764 GGAACTTAACAGATGAACCTGGG + Intronic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165682763 19:37791545-37791567 TGAAGTGTACAGATGGGCCCAGG + Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1166125295 19:40711765-40711787 GTAAGTGCACAGAAGGCACTGGG - Intronic
1202714643 1_KI270714v1_random:35533-35555 GGAGGCTCACAGATGGAGCTGGG + Intergenic
925740894 2:7005321-7005343 GGAAGCCCACCGATGGTCCTCGG - Intronic
925748692 2:7067768-7067790 GGAAGTACACAGGTAGACATAGG - Intronic
926330754 2:11823230-11823252 GGAGGCGCGCAGATGGAACTCGG + Intronic
929692225 2:44084560-44084582 GGAAGTATACAGATGGGCCTAGG - Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930026330 2:47031377-47031399 AGAGGTGCGCAGATGGAGCTGGG - Intronic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
930787182 2:55282256-55282278 GGAACTGCCCAGAGGGATCTCGG - Intergenic
931804042 2:65787743-65787765 GGAAGTGTACAGATGGACTTAGG - Intergenic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
932986792 2:76736133-76736155 GGAAGTATACATATGGGCCTAGG - Intergenic
933435123 2:82239688-82239710 GGAAATGCACACATGGACTTTGG - Intergenic
935282761 2:101533484-101533506 GGATGTGCACACACGGACTTGGG - Intergenic
935390168 2:102542664-102542686 GGAAGTACACAAACGGGCCTTGG + Intergenic
935435063 2:103021908-103021930 AGAAGAGTACAGAAGGACCTTGG + Intergenic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
936152133 2:110027708-110027730 GGAAGTGCAGAGATGGACAGGGG + Intergenic
936192545 2:110343705-110343727 GGAAGTGCAGAGATGGACAGGGG - Intergenic
937454070 2:122026189-122026211 GGAGGTGCACATACGGACCTAGG + Intergenic
937816894 2:126260564-126260586 GGAAGTGGACAGATAGGCATAGG + Intergenic
937840945 2:126524054-126524076 GGAAGCACACAAATGAACCTAGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938213296 2:129486410-129486432 GGAAGGGCACAGATGGCACAAGG + Intergenic
938322535 2:130374697-130374719 GGCAGTGCATACAGGGACCTGGG - Exonic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
939254301 2:139722560-139722582 GTAAATGCACAGATGGGCTTAGG - Intergenic
944678095 2:202051128-202051150 GGATGGGCAAAGATGCACCTTGG + Intergenic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
945356104 2:208841438-208841460 GGAAATGCACAGTTGGGCTTAGG + Intronic
946402033 2:219473223-219473245 GGAAGTGTACAGATGGGCCAAGG - Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
946559438 2:220896421-220896443 GCAAGTGTATAGATGCACCTGGG + Intergenic
948433455 2:237935751-237935773 GGAAGTGCACAGAGGGGCCCAGG - Intergenic
948751840 2:240137609-240137631 TGCAGTGCACAGATGGGCCTGGG - Intergenic
1170833230 20:19861412-19861434 GGAAGTGCTCAGAAGCACCTAGG - Intergenic
1173447626 20:43134298-43134320 GGAAGTACACAGATGGGCCAAGG - Intronic
1173775898 20:45706076-45706098 GGGAGTGCAAAGATAGCCCTTGG - Intronic
1175510250 20:59519287-59519309 GGGAGGGCTCAGATGCACCTGGG - Intergenic
1175966125 20:62661039-62661061 GGAAGGGCACAGAGTGAGCTGGG - Intronic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1178664187 21:34532289-34532311 GGAAGTGCACAGGTGAGCCTAGG + Intronic
1180800435 22:18629354-18629376 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1180848693 22:18999185-18999207 GGAGGTTCACAAAGGGACCTGGG + Intergenic
1180851670 22:19024910-19024932 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG + Intronic
1181221284 22:21365908-21365930 GGAAGTGCTCAGATGTGCCTAGG - Intergenic
1182651041 22:31851494-31851516 GTAAGTGCTCTGATGGACGTAGG - Intronic
1182942340 22:34288808-34288830 AGAAGAGCACAGAAGAACCTGGG - Intergenic
1183292954 22:37014031-37014053 GGAAGGGCTGAGATGAACCTGGG + Intronic
1183598378 22:38825804-38825826 GGAGGTGCACAGACCTACCTGGG - Intronic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184965142 22:47966038-47966060 GGAAGTGCACAGGTGGGTCTGGG - Intergenic
1185405098 22:50643183-50643205 GGAAGTGCACAGATGGGCTCCGG - Intergenic
949915873 3:8964078-8964100 GGAAGTACACAGATTGGCCTAGG - Intergenic
949943734 3:9174056-9174078 GGAAGAGAATGGATGGACCTTGG + Intronic
950321888 3:12063535-12063557 GGAAGTTCACAGATAAACATGGG + Intronic
950487067 3:13280170-13280192 GGAAGTGCAGGGCTGGGCCTAGG + Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
951591242 3:24267503-24267525 GGAAGTGCATAGATGAGCCCAGG - Intronic
952875066 3:37937820-37937842 GGAAGTATGCAGGTGGACCTAGG + Intronic
953404122 3:42652158-42652180 GGGAGTGAACAGGTGGAGCTAGG - Intergenic
953898837 3:46826649-46826671 GGAAGTGCACAGACAGACCGAGG - Intergenic
955808204 3:62758669-62758691 GGATGTGCCCAGATAGAACTGGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957415688 3:79900437-79900459 GGAAGTGCATAGAAGTGCCTAGG + Intergenic
957782252 3:84834626-84834648 GGAAGTGCAAAGGTGGACCTAGG + Intergenic
958082661 3:88766846-88766868 GGAAGTGAACAAAAGGAACTAGG + Intergenic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
958918127 3:100072315-100072337 GGAAATGCACAGAATGAACTAGG - Intronic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959052904 3:101541361-101541383 AGAAGTGCACAGATGGGCTCAGG + Intergenic
959154331 3:102648388-102648410 GGAAATGCACAGGTGGGCTTAGG - Intergenic
959357658 3:105353521-105353543 GGAAGTGGACAGACTGACTTAGG - Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960154884 3:114289933-114289955 GGAAGTGCATGGATGGGCCTAGG - Intronic
960628010 3:119700529-119700551 GAAAGTACACAGACAGACCTAGG + Intergenic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
961386997 3:126528450-126528472 GGTAGTGCACTGGTGGGCCTTGG + Intronic
962729451 3:138266631-138266653 GGAAGTGTCCAGTTGGAACTAGG + Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
964979548 3:162662566-162662588 TGAAGTGCACAGATGTGCTTAGG + Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
966238480 3:177728658-177728680 GGAAGTGCACAGACAGGCCTAGG + Intergenic
968243168 3:197111663-197111685 AGAAGTGCACAGTTGAACATCGG - Intronic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970471258 4:16381471-16381493 GGAGGTACACAGATGGGCCTAGG + Intergenic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
971755453 4:30702093-30702115 GGAAGTTCACTGATGGTCCTCGG - Intergenic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
976266329 4:83188899-83188921 GGAAGTACAGAGATGGGCCTTGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979129653 4:117026458-117026480 TGAAGTGCACAAATGGGCCCAGG + Intergenic
979525012 4:121707300-121707322 AGAAGTGCACACGTGGGCCTAGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980197090 4:129603309-129603331 GCAAGTTCACAGATGGTCCTAGG - Intergenic
980459066 4:133081719-133081741 AGAAGTGCACATATGGGCATAGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
981539136 4:145830863-145830885 GGAAGACCACACATGGTCCTAGG - Intronic
981791423 4:148541141-148541163 AGAAGTACACAGTTGGACCCAGG - Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
983082359 4:163402253-163402275 GGAAGTATACAGATGGGCCTAGG + Intergenic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
985061853 4:186088157-186088179 GGATTTCCAAAGATGGACCTGGG + Intergenic
986065018 5:4226914-4226936 GGAAGTCCACGAATGGACCTAGG - Intergenic
986569061 5:9146630-9146652 GGAACTGAACCGAAGGACCTTGG - Intronic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987072237 5:14349511-14349533 GGAAGAGCACAGCTTAACCTTGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
988602558 5:32653563-32653585 GGAAGTGTACAGACAGGCCTAGG - Intergenic
990276366 5:54201409-54201431 AGAAGTGCACAGATGGGTTTAGG - Intronic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
998983545 5:147730284-147730306 GGACATACACAGATGGACTTAGG - Intronic
999351277 5:150873953-150873975 TGAAGAGGACAGATGGATCTTGG + Intronic
999642127 5:153682426-153682448 AGAATTGCACAGATGGGCCTAGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001782960 5:174386189-174386211 GGAAGGGGACAGATGGACTCAGG + Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1002875308 6:1204633-1204655 GGAAGTGCACGGATGGGCTTAGG + Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005577635 6:27205077-27205099 GGAAGAACACAGATGGGCCCTGG - Intergenic
1006302058 6:33199086-33199108 GGAAGTTCACACAAGGATCTGGG + Intronic
1006387646 6:33740287-33740309 GGAAGTGGACAGATGGCCCCAGG + Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1008157195 6:48031086-48031108 GAAAGTGCACAGATTAGCCTAGG - Intronic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1008619215 6:53255378-53255400 GGAAGTGCAGTGGTGGATCTTGG + Intergenic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010917484 6:81638417-81638439 GGAAATGCGCAGATGAACTTAGG - Intronic
1011648702 6:89485419-89485441 GCAGGTGCAGAGCTGGACCTGGG + Intronic
1012450862 6:99351022-99351044 GGAAGGGCACAGAAGGAGCATGG - Intergenic
1014573877 6:123045786-123045808 GCAAGTGCAGTGATGGACCCAGG + Intronic
1015978878 6:138818932-138818954 GGAAGTGCACAGGTGGGCCAAGG + Intronic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1017686265 6:156916168-156916190 AGAAGTACACAGTTGGACATTGG + Intronic
1019420448 7:948247-948269 GGCATTGCACTGATGGACCTGGG - Intronic
1020591112 7:10138397-10138419 GGAAGGGCATATATGGGCCTAGG - Intergenic
1021243740 7:18236657-18236679 TGAAGTGAACAGACAGACCTTGG + Intronic
1021809560 7:24390158-24390180 GCAAGTACAAAGATGGACCAAGG - Intergenic
1022090310 7:27103727-27103749 GGATTTGGACACATGGACCTGGG - Intergenic
1022159589 7:27695769-27695791 GGAAGAGCATAGATGGGCCTAGG + Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1024056731 7:45664186-45664208 GGAAGTGCACCGTTGGGCCTAGG + Intronic
1025006915 7:55362696-55362718 GGAAGTGTGCAGATGGGCCTTGG + Intergenic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1027804543 7:82800407-82800429 TGAAGTGCACACATGGAACAAGG - Intronic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1029221530 7:98994473-98994495 GGGAGTGCAGAGATGACCCTGGG + Intronic
1030440179 7:109579507-109579529 AGAAGTGCAGAGATGAACATGGG + Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1031102794 7:117503004-117503026 GGAAGTATAAAGAAGGACCTGGG + Intronic
1031323653 7:120364870-120364892 AGAATTGCACAGATGGGCCTAGG + Intronic
1031974393 7:128084691-128084713 GGAAGAGCACAGTGAGACCTGGG - Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1035241471 7:157533381-157533403 AGAAGGGCACAGATGGGACTAGG - Intergenic
1035842672 8:2829171-2829193 GGATGGGCACAGAAGCACCTGGG + Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1037622727 8:20579120-20579142 GGAAGTTCACAGAAGGGCCTAGG + Intergenic
1037623086 8:20584182-20584204 GTAAGTGCACAGAAGGGCTTAGG + Intergenic
1037643967 8:20773489-20773511 CCATGTGCACAGCTGGACCTGGG + Intergenic
1037887224 8:22601492-22601514 GGCCGTGCACAAATGGAACTGGG - Intronic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039849206 8:41347732-41347754 GGAAGTGCACTTATAGGCCTAGG + Intergenic
1040725275 8:50375323-50375345 GGACATGCACAGGAGGACCTGGG + Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1041517655 8:58718418-58718440 GCAAGTGCAGAGCTGGAACTTGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042375490 8:68046438-68046460 TGAATTGCACAGATGGTTCTTGG + Intronic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1043342277 8:79254674-79254696 AGAAGTGCATAGATGGGCCCAGG + Intergenic
1043530974 8:81149731-81149753 GGAGGGGCAGAGATGGAACTAGG - Intergenic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1045848660 8:106666853-106666875 GGAAGTGAACAGATTGGCATAGG + Intronic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047756469 8:127922763-127922785 GGAAGTAAAGAGATGGGCCTGGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1048567324 8:135615182-135615204 GGAGCTCCACAGATGGGCCTAGG + Intronic
1049087921 8:140492557-140492579 GGAAGTACCCAGGTGGGCCTTGG - Intergenic
1049505134 8:142992148-142992170 GGAAAGGCACAGATGGGCCTGGG + Intergenic
1049769308 8:144372530-144372552 AGAACTTCACAGATGGACCTGGG - Intergenic
1050774140 9:9238901-9238923 GGAAGTACGCAGAGGGTCCTAGG - Intronic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051684405 9:19642246-19642268 GGGTCTGCACAGCTGGACCTGGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053209462 9:36215530-36215552 GCAAAAGCACAGAGGGACCTGGG + Exonic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1055804271 9:80075553-80075575 GGAAGTGAACTAATGGGCCTAGG - Intergenic
1056000421 9:82210515-82210537 GGACATGCTCAGAGGGACCTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056699347 9:88889118-88889140 GGAAGTGCTCAGATGTCCCCTGG - Intergenic
1057191920 9:93093206-93093228 GGAAGTTCACAGATGGGCCAAGG - Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1060148956 9:121274898-121274920 GGAAGTGCACAGGTAGGCCTAGG + Intronic
1060552686 9:124492973-124492995 GGAAGTGCACAGCGGGGCCAGGG + Intronic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1186244333 X:7605100-7605122 GGAGGTACACAGGTGGGCCTAGG - Intergenic
1188539637 X:31235106-31235128 AGAAGTGCACAGGTGGGCCTAGG + Intronic
1188759031 X:34002506-34002528 TGAAATGCACAGATAGGCCTAGG + Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190973862 X:55379966-55379988 GGGAGTGCAGAGCTGAACCTTGG + Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1193552499 X:82914332-82914354 GGAAGTGTACAGATGAGCCTAGG - Intergenic
1194688450 X:96953696-96953718 GGAAGAGAAGAGATGGACCCTGG - Intronic
1195652376 X:107298582-107298604 GGAAGTGCATAGATTGACTTAGG + Intergenic
1197118360 X:122860759-122860781 GGAGCTGCTCAGATAGACCTGGG - Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1199843148 X:151671252-151671274 GGAAGAGGAGAGAGGGACCTTGG + Intronic
1201463560 Y:14255383-14255405 GGAAGTACACATGTGGGCCTTGG - Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic