ID: 993955650

View in Genome Browser
Species Human (GRCh38)
Location 5:94229107-94229129
Sequence AGCAGGAAATCTAACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993955650_993955653 0 Left 993955650 5:94229107-94229129 CCTCCTGTGTTAGATTTCCTGCT 0: 1
1: 1
2: 1
3: 20
4: 204
Right 993955653 5:94229130-94229152 TTCTGAATCTAACTCTTTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993955650 Original CRISPR AGCAGGAAATCTAACACAGG AGG (reversed) Intronic
900664303 1:3803969-3803991 AGCAGGACATAAAACAAAGGGGG - Intergenic
901950312 1:12740126-12740148 TGCAAGAAAACTGACACAGGAGG + Intergenic
908742835 1:67346116-67346138 AGCTGGAACTCAAACCCAGGTGG - Intronic
909418142 1:75430746-75430768 ATCAGGAAATCTCACCCAGGTGG + Intronic
909586332 1:77292729-77292751 TGCAGGAAATATAACACAGTTGG - Intronic
909815610 1:79989060-79989082 AGAAGGAAATCTCTGACAGGCGG - Intergenic
909899922 1:81120394-81120416 AGCAGGAAACTTTTCACAGGAGG + Intergenic
910188659 1:84573090-84573112 AGCAGGAAATCCAAGGCAGTTGG - Intronic
911723911 1:101221175-101221197 AGCAGCAAATTTCACACAGAAGG + Intergenic
912757922 1:112340087-112340109 AGCAGCCATTCAAACACAGGGGG + Intergenic
914672519 1:149882312-149882334 TGCAGGAAGTCTAGTACAGGTGG - Intronic
914767624 1:150653415-150653437 TCCAGTAAATCTAACATAGGAGG - Intronic
916942624 1:169691913-169691935 AGCTGGAAATCTCAGACAAGAGG + Intronic
917653903 1:177106878-177106900 AGCAGGAAATCATATACAGAAGG + Intronic
918190192 1:182166279-182166301 AGCTGGAATTCTAGCTCAGGTGG - Intergenic
919605425 1:199676479-199676501 AGAAGGAAAGCTCACACATGAGG + Intergenic
924589882 1:245393797-245393819 AGCAGGAAACCAAAAACAAGGGG - Intronic
1062874893 10:935069-935091 GGCAGGAAAGGAAACACAGGGGG - Intergenic
1064153281 10:12883310-12883332 AGCAGGAAACCAAACAGAAGGGG + Intergenic
1064305220 10:14159395-14159417 AGGAAGAAATTTAACAAAGGAGG + Intronic
1066380424 10:34896589-34896611 AGCAGGAAGTCCAGCACAGGAGG + Intergenic
1067035606 10:42914133-42914155 AGAAGGAAATTGAACACAGAAGG + Intergenic
1074198154 10:111207459-111207481 TGAAGGTAATCTCACACAGGTGG - Intergenic
1074970364 10:118531523-118531545 AGCAGGCAATCAAGCACAGCTGG + Intergenic
1078967843 11:16367864-16367886 AGCATTAAATCTAATACAGTAGG + Intronic
1079478208 11:20853919-20853941 AACAAAAAATCTTACACAGGAGG - Intronic
1081450886 11:43169886-43169908 AGCAGGAATAATATCACAGGCGG + Intergenic
1081831026 11:46114353-46114375 ATCAGGAGGCCTAACACAGGTGG + Intronic
1086353746 11:85970711-85970733 GGCAGGAGGTTTAACACAGGAGG + Intronic
1086920915 11:92585808-92585830 AACAGGAAAGCAAACAAAGGAGG - Intronic
1090247457 11:125226642-125226664 AGCAGGAAATCTAAAAGAAGAGG - Intronic
1090436083 11:126687420-126687442 AGCAGGAAATCTCACCCAGCTGG + Intronic
1091295125 11:134468418-134468440 AGCCGGAGGTCAAACACAGGGGG - Intergenic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1092883383 12:12905281-12905303 AGCAAGAAATCCAAAACAAGAGG - Intronic
1093215507 12:16357148-16357170 AGCAATAAATCAAACACAAGAGG - Intronic
1093963962 12:25305418-25305440 AGCAGTTAATCAAACACAGAGGG + Intergenic
1094274400 12:28654720-28654742 AACAGAAAATCAAACACAGCAGG - Intergenic
1094413025 12:30188361-30188383 GGCTGGGAATCTAACACAGATGG - Intergenic
1095417506 12:41992633-41992655 AGCTGTAATTCTAACCCAGGAGG - Intergenic
1097947088 12:65381085-65381107 AGCAGGAAATTTAATGCTGGGGG - Intronic
1098695569 12:73549873-73549895 AGCAGGAATTCTAAAAAAAGTGG - Intergenic
1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG + Intronic
1100811676 12:98344953-98344975 AGCAGGAAAGCCAGCCCAGGTGG - Intergenic
1101293330 12:103394684-103394706 AGCAGGAAAGCAAGCACTGGAGG + Intronic
1101995060 12:109519371-109519393 GGCAGGAAATGTATCACAAGAGG + Intronic
1102854626 12:116282684-116282706 AGCAGGCAATCTCACAAATGGGG - Intergenic
1106383261 13:29260653-29260675 AGCAAGAAAGCTAACTCAGCAGG + Intronic
1108338461 13:49471720-49471742 AACAGAAAATGTAACACAGCAGG + Intronic
1109355994 13:61230375-61230397 AGCAGGAACAGTATCACAGGGGG + Intergenic
1110374780 13:74780652-74780674 GGCAGGAAATGTCACACAGTCGG + Intergenic
1110928926 13:81191674-81191696 AGCAGGAAAGATAACTCAGAAGG - Intergenic
1111475121 13:88735772-88735794 TGCAGGAAATCTGACAATGGTGG - Intergenic
1111802856 13:93000861-93000883 AGCACGAAATCTAGCAAAGAAGG + Intergenic
1115168912 14:30480699-30480721 AGCAGGAACTTCAACACATGAGG + Intergenic
1115175480 14:30557840-30557862 TACAGGTAATCTGACACAGGGGG - Intergenic
1116481895 14:45401105-45401127 ATGAGCAAATCTAACATAGGAGG + Intergenic
1118191123 14:63581248-63581270 AGCAGGAAGTGGAACACAGATGG - Intergenic
1118430033 14:65708556-65708578 AGGAGGAAATTTAACCAAGGAGG - Intronic
1118508391 14:66442556-66442578 AATAGCAAATGTAACACAGGTGG - Intergenic
1119943002 14:78660908-78660930 AGTAGGAAATGTAATACTGGAGG + Intronic
1121724502 14:96137279-96137301 ACCAGGTAATCTTACAGAGGAGG - Intergenic
1123850311 15:24349171-24349193 AGCATCAAATCTTGCACAGGAGG + Intergenic
1126576037 15:50197568-50197590 AGCAGAACTTCTAACACAGATGG + Exonic
1128870150 15:71148810-71148832 AGCCTGATTTCTAACACAGGCGG - Intronic
1129999225 15:80032822-80032844 GCCAGGAAATCTAACAAACGAGG + Intergenic
1132753259 16:1468850-1468872 AGCAGCAAAGGTAGCACAGGGGG - Intronic
1134193486 16:12140374-12140396 GGCAGGAAAAGTAACACAGCTGG - Intronic
1134226391 16:12394378-12394400 AGGTGGAATTCAAACACAGGTGG - Intronic
1135236778 16:20764143-20764165 TTCAGGAAATCTTACACAGGAGG - Intronic
1135910547 16:26556718-26556740 TGCAGGAAATCTGAGACAGCTGG - Intergenic
1135958907 16:26979566-26979588 AGCATGACAGCTCACACAGGAGG - Intergenic
1138080396 16:54085125-54085147 AGTAGGAAATTTAACACATCAGG - Intronic
1138312493 16:56039985-56040007 AGCAGGAACAATAAAACAGGTGG + Intergenic
1138772163 16:59678727-59678749 AGCATGAAATCTCAAACAGAAGG - Intergenic
1140506271 16:75475233-75475255 AGCTGAAAACCTAAGACAGGTGG + Exonic
1140521670 16:75587257-75587279 AGCAGGAAACTTAAGGCAGGTGG - Intergenic
1140642963 16:76998787-76998809 ATCAGAAAATGTAACACATGGGG + Intergenic
1140876394 16:79156479-79156501 GGCAGAAAATATTACACAGGTGG + Intronic
1141905396 16:87022106-87022128 ATCAGGAAATCTCACGAAGGAGG + Intergenic
1141917299 16:87108071-87108093 CGGAGGACATCCAACACAGGTGG + Intronic
1142943416 17:3403064-3403086 AGGAGGTAATCTGACATAGGTGG - Intergenic
1145372981 17:22322789-22322811 AGAAGGAAAACTAGCACAGGGGG + Intergenic
1147248392 17:39137754-39137776 AACAGGGGATCCAACACAGGAGG + Intronic
1148326686 17:46787267-46787289 AGCAAGAAAACTTTCACAGGTGG - Intronic
1148331184 17:46814833-46814855 AGCAGGACATCTGACAGATGGGG + Intronic
1149580469 17:57746796-57746818 AGCTGGGACTCTAACCCAGGTGG - Intergenic
1155519075 18:26651343-26651365 AGCAGGGATTCTAACTCAGCTGG - Intronic
1156239943 18:35243467-35243489 AACAGGGAAACTCACACAGGAGG - Intronic
1157537188 18:48468479-48468501 GGGAGAAAATCTAACCCAGGGGG + Intergenic
1160287601 18:77559448-77559470 AACAGGAAACCTAATACAGTAGG - Intergenic
1163542942 19:17922436-17922458 AGAAGGAAATCTATGACAGGAGG + Intergenic
1165054852 19:33168539-33168561 AGGAATAAATCTAACAAAGGTGG + Intronic
1165337599 19:35182689-35182711 AACAGGCAATCTATCACAGCAGG + Intergenic
1166244153 19:41513970-41513992 ATTAGGAAATATATCACAGGGGG + Intergenic
927205823 2:20609691-20609713 AGCTGGAAATCGTACAGAGGAGG + Intronic
927739941 2:25559839-25559861 AGAAGGCAATGTAACCCAGGAGG + Intronic
932240465 2:70152458-70152480 GGGAGGAAATATAAAACAGGTGG + Intronic
935179478 2:100676942-100676964 AGCCTCAATTCTAACACAGGAGG + Intergenic
937825485 2:126364456-126364478 AGCAGGAAATGGTACAGAGGAGG - Intergenic
938309063 2:130274313-130274335 AGCAGGAAATCTAACACATGCGG + Intergenic
938376016 2:130807238-130807260 AGCAAGATGTCTAGCACAGGTGG - Intergenic
939043819 2:137225348-137225370 ATCAGTAAATCTAGCACTGGGGG - Intronic
939329213 2:140736316-140736338 AGCAGGTAATCTATTACAGTAGG + Intronic
939692978 2:145288902-145288924 AACAGGAAATGTGACCCAGGTGG + Intergenic
940273569 2:151916300-151916322 ATCAGGAAATCACACACAAGAGG - Intronic
942666408 2:178323975-178323997 AGCAGCAAATCTAGAAGAGGAGG + Intronic
943480276 2:188408842-188408864 AACTGGAAATCAATCACAGGAGG + Intronic
945772795 2:214066043-214066065 AGCTGGACTTCTAACACAAGGGG - Intronic
1168997825 20:2145976-2145998 AGCAAGAAAAATAACAAAGGGGG - Exonic
1169686069 20:8273580-8273602 AGCAGGAAACCTAACCCCGCTGG + Intronic
1171547028 20:26010416-26010438 AGAAGGAAAACTAGCAAAGGGGG + Intergenic
1172575491 20:36005078-36005100 ACCAGGAAATCTGCCACAGTAGG - Intronic
1176698095 21:10005601-10005623 AGCAAGAAATGTAAAACAGTTGG + Intergenic
1177955232 21:27590295-27590317 AGCAGGAAAGATAACTCTGGGGG - Intergenic
1180100846 21:45584438-45584460 AGCTGGAAATCCACCACAGTGGG - Intergenic
1183116114 22:35693946-35693968 AGTAGGAAAAATATCACAGGCGG - Intergenic
1183117007 22:35699962-35699984 AGTAGGAAAAATATCACAGGCGG - Intergenic
949383786 3:3476522-3476544 AACATGAAATCTGACAGAGGAGG + Intergenic
955621049 3:60864367-60864389 AGCTGGAATTTTAACACAGGAGG + Intronic
955768427 3:62368280-62368302 AGCAGGAATTCGAACTCCGGGGG - Intergenic
957288133 3:78243263-78243285 ATTAGTAAATCTCACACAGGTGG - Intergenic
958697888 3:97549866-97549888 AGCAGGAAATTCAACATAGATGG - Intronic
960510415 3:118542443-118542465 AGCTGGAAATGTGACAGAGGAGG - Intergenic
961878972 3:130046895-130046917 AGGAGGAATCCTAACGCAGGAGG + Intergenic
962850396 3:139304104-139304126 GGCAAGAAATCCAAGACAGGTGG - Intronic
963424009 3:145100196-145100218 AGCATGAAATCAATCACATGAGG + Intergenic
966301664 3:178485868-178485890 AGCTGGCAATGTTACACAGGGGG - Intronic
966342890 3:178945215-178945237 AGAAGGAAATGCAACACAGGTGG - Intergenic
971025585 4:22585878-22585900 AGCAGGAACCATAACACAGAAGG + Intergenic
972371423 4:38427257-38427279 GGCAGGAAATCTAAAGAAGGAGG - Intergenic
972405269 4:38740151-38740173 AGCAAGAATTCTAACCCAGGTGG + Intergenic
975217937 4:71778756-71778778 AGCAGGAATTCAAATCCAGGTGG - Intronic
975875905 4:78836583-78836605 AGCAGGGAATCCAAGACAGAAGG - Intronic
976130877 4:81882664-81882686 GGCAGGAGATACAACACAGGGGG - Intronic
976262167 4:83156006-83156028 AGAGAGAAATCTAACACAGCAGG + Intergenic
976575087 4:86660002-86660024 AGAAGGAAATATAACCCAGAAGG + Intronic
977325062 4:95564555-95564577 AGCAGCAAATCTACCCCAGAAGG - Intergenic
980370640 4:131865423-131865445 AGCAAGAAATGTAAAACAGTTGG + Intergenic
980881416 4:138713559-138713581 TGCAGGAACATTAACACAGGAGG + Intergenic
983655315 4:170077406-170077428 AGGAATAAATCTAACAAAGGAGG - Intronic
986672119 5:10151729-10151751 ACCAGGAAAGCTACCATAGGTGG + Intergenic
989251838 5:39325967-39325989 TGCAGGAAATCTACCAAAGAAGG - Intronic
990089241 5:52020741-52020763 AGAATGAAAGCTAACAAAGGAGG + Intronic
993897799 5:93558812-93558834 AGCAGCAAGTCTAAAACAGTGGG + Intergenic
993955650 5:94229107-94229129 AGCAGGAAATCTAACACAGGAGG - Intronic
993957481 5:94253387-94253409 AGAAGAAATTCTAACACATGCGG + Intronic
994358682 5:98825308-98825330 ACCAGGGAATCCAACACAGGAGG + Intergenic
995443809 5:112220809-112220831 AGCAGGATATCTATCACATGAGG - Intronic
995915165 5:117236654-117236676 GGCAGGGAATATAACACACGGGG - Intergenic
996469754 5:123845848-123845870 AGCAGAAAATCAAATATAGGGGG - Intergenic
997687469 5:135798629-135798651 ATTAGGAAATCTATCACAGCAGG - Intergenic
999256003 5:150210357-150210379 AGAAGGAAAACTAACAGAGGGGG + Exonic
999640764 5:153670942-153670964 AGCATGAAATCTGAAATAGGAGG + Intronic
1001297124 5:170505889-170505911 AGCAGGACATGTAACTCAGCTGG - Intronic
1001552516 5:172613854-172613876 AGTAGTAAATCTAACCAAGGAGG + Intergenic
1003125582 6:3353296-3353318 TATAGGAAATCTAACACAGACGG - Intronic
1003708450 6:8561615-8561637 GGAAGTAAAACTAACACAGGGGG + Intergenic
1004688118 6:17967685-17967707 AGGAGGAAACCTAACACTGCAGG - Intronic
1005575048 6:27182698-27182720 AACAGGAAATCCAAACCAGGAGG + Intergenic
1008202838 6:48613745-48613767 AGAAGGACATCTAACCCTGGTGG - Intergenic
1010943673 6:81949931-81949953 AGCTGGACATCTTAAACAGGTGG + Intergenic
1015426420 6:133074189-133074211 AGAAGAAAATTTAACACAGAAGG - Intergenic
1017333181 6:153223511-153223533 AGCAGGAAAACCAACAGAGTGGG + Intergenic
1017562725 6:155647492-155647514 AGCAGGACATAAAACTCAGGAGG + Intergenic
1019302321 7:312236-312258 AGAAGGAAATCTATCCCAGAAGG - Intergenic
1021550337 7:21864562-21864584 AGCAGGAAATCCAATTCAAGAGG - Exonic
1021867010 7:24968248-24968270 ATCAGGAAACATAACACATGAGG - Intronic
1023330999 7:39116747-39116769 ATCAGGATATCTAACACTGGAGG - Intronic
1023638171 7:42234310-42234332 AGCAGGATACCTTACATAGGAGG + Intronic
1025229134 7:57188290-57188312 AGTAGGAAACCTAACACATGCGG + Intergenic
1025731202 7:64109744-64109766 AGCAGGAAACCTAACACATGCGG - Intronic
1026068706 7:67098659-67098681 AGCTGGAAATTTTACACTGGTGG - Exonic
1027928568 7:84500206-84500228 AGGAATAAATCTAACCCAGGAGG - Intergenic
1029343512 7:99962801-99962823 ATTAGGAAAATTAACACAGGAGG - Intergenic
1033450864 7:141461374-141461396 AGCAGAAAATGTCACACAGATGG + Intronic
1034002292 7:147428719-147428741 AGTAGGACATAAAACACAGGGGG - Intronic
1035145189 7:156808632-156808654 AGAAGGGAAGCTAACACATGGGG - Intronic
1036664182 8:10728416-10728438 AGAAGGAAATGTCACACAGGTGG + Intronic
1038423446 8:27449303-27449325 AGCAAGAAACCTAACTCATGGGG + Intronic
1041795401 8:61742468-61742490 TGCAGGAACTCTACCACAGTTGG - Intergenic
1043094508 8:75949403-75949425 ACCAGGAAATCCAACATTGGAGG + Intergenic
1043633752 8:82366833-82366855 AGTAGGAAAAATAACACACGGGG - Intergenic
1045029081 8:98117718-98117740 AGCAGGAAAGGGAACACGGGAGG - Intronic
1045273444 8:100680986-100681008 AGCAGGAAACCTCCCCCAGGGGG - Intergenic
1047512674 8:125527801-125527823 AGCAGGAACTGGAACACAGGCGG - Intergenic
1049946197 9:598568-598590 AGGAACAAATTTAACACAGGAGG - Intronic
1050029888 9:1374673-1374695 TACAGGATATCCAACACAGGGGG + Intergenic
1051098631 9:13495634-13495656 AACAGAAAATCAAACACAGTAGG + Intergenic
1053277771 9:36796328-36796350 AGCCAGAAGTCTAACCCAGGAGG + Intergenic
1053635229 9:39991947-39991969 AGCAAGAAATGTAAAACAGTTGG + Intergenic
1053770703 9:41472358-41472380 AGCAAGAAATGTAAAACAGTTGG - Intergenic
1053797778 9:41741762-41741784 AGAAGGAAAACTAGCAAAGGGGG - Intergenic
1054147411 9:61573195-61573217 AGAAGGAAAACTAGCAAAGGGGG + Intergenic
1054186191 9:61953815-61953837 AGAAGGAAAACTAGCAAAGGGGG - Intergenic
1054208658 9:62258751-62258773 AGCAAGAAATGTAAAACAGTTGG - Intergenic
1054316147 9:63589388-63589410 AGCAAGAAATGTAAAACAGTTGG + Intergenic
1054467157 9:65504233-65504255 AGAAGGAAAACTAGCAAAGGGGG + Intergenic
1054549434 9:66384188-66384210 AGCAAGAAATGTAAAACAGTTGG - Intergenic
1054652312 9:67634708-67634730 AGAAGGAAAACTAGCAAAGGGGG + Intergenic
1057809668 9:98248188-98248210 AGCAGATCATCTAAGACAGGAGG + Intronic
1058521143 9:105815140-105815162 AGTAGGAAAACTATCGCAGGCGG + Intergenic
1058632111 9:107000020-107000042 ACAAGGATATCGAACACAGGAGG + Intronic
1060324647 9:122601914-122601936 AGCAGGATAGATAACAAAGGGGG - Intergenic
1060834641 9:126745941-126745963 AACCAGAAATCAAACACAGGAGG - Intergenic
1062658608 9:137616733-137616755 AGCAGAAAGTGTACCACAGGTGG + Intronic
1185711578 X:2307979-2308001 ACCAGGGAACCGAACACAGGAGG + Intronic
1185770544 X:2762549-2762571 GACAGGAAATCAAACACAGCTGG - Intronic
1188405944 X:29809814-29809836 AGAAGGAAAACTAACACAGAGGG - Intronic
1188578463 X:31681537-31681559 AGAAGGAAATTGAAGACAGGAGG - Intronic
1189826782 X:44926778-44926800 AGCAGACACTCAAACACAGGTGG - Intronic
1189888463 X:45574472-45574494 AGGAGTAAATCTAACCAAGGAGG - Intergenic
1191687898 X:63911197-63911219 ATCAGGAATTCTGAAACAGGTGG - Intergenic
1195129878 X:101841227-101841249 AGCAGCAATTCTAAGACAAGCGG - Intronic
1195176358 X:102318596-102318618 AGCAGCAATTCTAAGACAAGCGG + Intronic
1195182506 X:102368497-102368519 AGCAGCAATTCTAAGACAAGCGG - Intronic
1195644322 X:107211056-107211078 AGCTGAAAAACTAAAACAGGAGG - Intronic
1198378155 X:136059854-136059876 AGCAGTATACCTAACACTGGGGG - Intergenic
1199088632 X:143664030-143664052 AGCATGGAATCTAACACATAGGG + Intergenic
1199461617 X:148091664-148091686 AGCAGGAAATTGAACTTAGGTGG + Intergenic
1200372151 X:155738963-155738985 AGCTGGAATTCTAACCCAGTGGG - Intergenic
1201299718 Y:12495184-12495206 GACAGGAAATCAAACACAGCTGG + Intergenic
1201417350 Y:13760682-13760704 AGCAAGAAATAAAACACAGCAGG - Intergenic
1202339541 Y:23847895-23847917 AGTAAGAGATCTAACACAGAAGG + Intergenic
1202345856 Y:23925802-23925824 AGCAGTAAATTTAACCAAGGAGG + Intergenic
1202524915 Y:25744288-25744310 AGCAGTAAATTTAACCAAGGAGG - Intergenic
1202531225 Y:25822173-25822195 AGTAAGAGATCTAACACAGAAGG - Intergenic