ID: 993959167

View in Genome Browser
Species Human (GRCh38)
Location 5:94275738-94275760
Sequence AAGGACTACCTGAGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993959167 Original CRISPR AAGGACTACCTGAGGGAGCA AGG (reversed) Intronic
900009000 1:88948-88970 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
900018663 1:171767-171789 AAGGACTATCTGAGGGGACGGGG + Intergenic
900048921 1:530362-530384 AAGGACTATCTGAGGGGACGGGG + Intergenic
900131111 1:1087741-1087763 AAGGACACCCCCAGGGAGCATGG + Intronic
900757227 1:4444646-4444668 ACTGACAACCTGAGGGAGCTTGG + Intergenic
903011751 1:20336231-20336253 AAGGACTTCCGCAGGGAGCAAGG - Intronic
903674098 1:25053677-25053699 AAGGGCTACCTGTGGCTGCAGGG - Intergenic
903773773 1:25780316-25780338 AAGGAGGGCCTGAGGGAGCCTGG - Intronic
906637192 1:47417222-47417244 GAGGCCTACCTGAGGCAGCCGGG + Exonic
906796007 1:48696902-48696924 AAGGGCTTCCTCAGGGAGGAGGG - Intronic
907997101 1:59644017-59644039 AAGGACTAGCTTAAGGAACATGG - Intronic
910235142 1:85027713-85027735 AAGGCCTCACTGAGGGAGCAGGG + Intronic
911086518 1:93982243-93982265 GAGGACTACTAGAGGGGGCAGGG - Intergenic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
915392917 1:155560990-155561012 AAAGACTTCCTGAGGCACCATGG + Intronic
915409073 1:155686908-155686930 AAAGACTTCCTGAGGCACCATGG + Intronic
915547512 1:156609748-156609770 CAGGCCTACTTGAGGGAGGAGGG + Intergenic
915577693 1:156791391-156791413 AGGAAGTAGCTGAGGGAGCAAGG + Intronic
915946648 1:160157340-160157362 AAGGCCTACTTGAGGGTGGAGGG - Intronic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
918561797 1:185877891-185877913 AGGGCCTACTTGAGGGAGGAGGG - Intronic
920315903 1:205075441-205075463 AAGGGCCACCTGTCGGAGCATGG - Exonic
920540738 1:206776135-206776157 AAGGAAAACCTGAGTAAGCATGG + Intergenic
921120763 1:212134867-212134889 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
924388848 1:243528476-243528498 AAGGCCTACTTGAGGGTGGAGGG - Intronic
924819732 1:247477321-247477343 AGGGCCTACCTGAGGGTGAAGGG + Intergenic
1064936047 10:20680193-20680215 TAGAGCTATCTGAGGGAGCAGGG - Intergenic
1066142009 10:32514236-32514258 AAGGTCACCCTGAGGTAGCAGGG - Intronic
1067091552 10:43268108-43268130 AAGGACTAAGTGAGTAAGCAAGG - Intergenic
1068748366 10:60561983-60562005 AAGGAATACATGAGTGAACATGG - Intronic
1071524788 10:86352276-86352298 ACTGACTGCCTGAGGGAGCGTGG - Intronic
1072734096 10:97867509-97867531 GAGGACTTCCTGAGGCTGCAAGG - Exonic
1073601616 10:104851569-104851591 AAGGCCTACCTTAGAGAGCAAGG - Intronic
1073726634 10:106239731-106239753 AAGAAATACCTGAGGGGCCAGGG + Intergenic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1075162525 10:120037085-120037107 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
1075707287 10:124509030-124509052 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1077135550 11:996401-996423 AGGAACTCGCTGAGGGAGCATGG + Intronic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077975703 11:7246312-7246334 AAGCACTGCCTTAGAGAGCAAGG + Intronic
1078159018 11:8824353-8824375 AAGGCCTACTTGAGGGTGAAGGG - Intronic
1078552262 11:12288923-12288945 AAAGAAAACCTCAGGGAGCAGGG + Intronic
1079306262 11:19326130-19326152 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1080767446 11:35309849-35309871 TAGGACAACCTGAGGAAGAATGG - Intronic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1082107828 11:48239923-48239945 AGGGACTACTTGAGGGGGGAGGG - Intergenic
1084841482 11:71854526-71854548 AAGGCCTACCTGGGGGTGGAGGG + Intergenic
1088418537 11:109617304-109617326 AAGGCCTACTTGAGGGTGGAGGG + Intergenic
1088451922 11:109990755-109990777 AAGGACAACCTGAGATTGCAAGG - Intergenic
1088933000 11:114371075-114371097 ATGGACTAACTGAGGGTGCCAGG + Intergenic
1089444422 11:118540470-118540492 CAGGACCTTCTGAGGGAGCATGG - Intronic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1093429043 12:19063447-19063469 GAGGTCTACTTGAGGGAGGAGGG - Intergenic
1094255536 12:28421362-28421384 AGGGCCTACCTGAGGGTGGAGGG - Intronic
1095681432 12:44981048-44981070 GAAGACTACCTGAGTGAGGAGGG + Intergenic
1095968048 12:47882685-47882707 AACACCTACCTGAAGGAGCAGGG + Exonic
1096755055 12:53792410-53792432 AAGGACTACCTGAGGCTGCTGGG - Intergenic
1097696711 12:62781716-62781738 AAGAAGTACCTGAGAGAGGAAGG + Intronic
1097950395 12:65420630-65420652 GGGGCCTACTTGAGGGAGCAGGG - Intronic
1097961289 12:65534140-65534162 CAGCACTACCTGAATGAGCAAGG - Intergenic
1098999836 12:77166521-77166543 AAGGCCTACTTGAGGGTGAAGGG + Intergenic
1099301904 12:80906657-80906679 ATGGCCTTCCTGAGGGTGCAGGG + Intronic
1099648673 12:85395531-85395553 AAGGTCTACTTGAGGGAGGATGG - Intergenic
1099651799 12:85438072-85438094 AAGGCCTACTTGAGGGTGAAGGG - Intergenic
1100240493 12:92706510-92706532 AAGAACTACGAGAGGAAGCATGG + Exonic
1102717926 12:114990230-114990252 AAGGTCTCCCTGCAGGAGCAGGG + Intergenic
1103870216 12:124085876-124085898 AAGGCCTGTCTGAGGGAGCAAGG + Intronic
1103899388 12:124295460-124295482 GAGGACAGCCTGAAGGAGCAGGG + Intronic
1104616898 12:130278170-130278192 AGGGCCTACCTGAGGGTGAAGGG + Intergenic
1107012705 13:35683992-35684014 AAGAACCACCTGTGGGAGAAGGG + Intergenic
1107703938 13:43080229-43080251 GAGGCCTACCTGAGGGTGGAGGG - Intronic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1108854884 13:54780766-54780788 GGGGCCTACCTGAGGGAGAAGGG + Intergenic
1109311749 13:60703100-60703122 GGGGACTACCCGAGGGAGGAGGG - Intergenic
1110387270 13:74928030-74928052 AAGGCCTACTTGAGGGTGGAAGG - Intergenic
1110464296 13:75783230-75783252 AAGGCCCAGCTGAGGGAGCAGGG + Intronic
1110619405 13:77578344-77578366 AAGGAACTCCTGGGGGAGCAGGG + Intronic
1112700624 13:102003727-102003749 AAGAAATACCTGAAGAAGCAAGG + Intronic
1113013360 13:105796460-105796482 CAGGTCTAACTGAGGGAGAAAGG + Intergenic
1115805881 14:37051255-37051277 AAAGAATACCTGAGGGAGAAGGG + Intronic
1116737873 14:48717178-48717200 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
1116830812 14:49717974-49717996 AAGGACTGCTTGAGGGTCCAAGG - Intronic
1118369455 14:65125080-65125102 AAAAAATACCTGAGGTAGCAGGG + Intergenic
1119784390 14:77301441-77301463 AAGCACTGTCTGAGGGCGCAGGG + Intronic
1121700793 14:95952685-95952707 AAGTATTACCTGGGGGAGCAGGG - Intergenic
1122071134 14:99206012-99206034 AAGGAACACCTGAGCCAGCAAGG + Intronic
1123028389 14:105439271-105439293 AAGGGCTGCCTGAGTGACCAGGG - Intronic
1124611938 15:31215281-31215303 AAGGACTGGCTGCGAGAGCAAGG - Intergenic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1127902980 15:63354836-63354858 AAGGACTTCCTGAGGGTGGGTGG - Intronic
1128173142 15:65530568-65530590 GAGCACTACCTGAGGCAGCGAGG + Exonic
1128248331 15:66148185-66148207 AGGGACTCCCTGAGTGGGCAGGG + Intronic
1130847749 15:87763113-87763135 AAGGACAACCTCAGAGGGCAGGG - Intergenic
1131314813 15:91326014-91326036 AAGGCCTACCTGAGGGTGGAGGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131613485 15:93989238-93989260 AAGGAATAACTAAGGGAACAGGG - Intergenic
1132029868 15:98430660-98430682 GAGGACTGCATGAGGGTGCAGGG + Intergenic
1135655582 16:24245752-24245774 AAGGACTGCTTTAGGTAGCATGG - Intergenic
1137829321 16:51528483-51528505 ATGGACTTCCTGAGGCAGCCTGG + Intergenic
1139499877 16:67354144-67354166 AAGGACTATTTGGGGGAGGAAGG - Intronic
1140073114 16:71670339-71670361 AAGGGCTAGCTGAGGAAGAAGGG + Intronic
1141636196 16:85315194-85315216 AAGGGGTGGCTGAGGGAGCAGGG + Intergenic
1142444995 16:90130696-90130718 AAGGACTATCTGAGGGGACGGGG - Intergenic
1142455335 16:90218016-90218038 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1143050513 17:4121696-4121718 AAAGACAACCTGAAGGAGAATGG + Intronic
1144398899 17:14875026-14875048 AAGGACTCTCTGAGGGACCAAGG - Intergenic
1144484477 17:15653342-15653364 AAGGAATACCTGAGGGGGTGGGG - Intronic
1144806821 17:17973202-17973224 AAGCATTTCCCGAGGGAGCAGGG + Intronic
1146500167 17:33357181-33357203 AGGGACTTCCTGAGGAAGCTGGG - Intronic
1146534334 17:33637182-33637204 AAAAACTGCCTGAGGTAGCAAGG + Intronic
1146908532 17:36633201-36633223 AGTGACGACCTGAGGGAGAAGGG - Intergenic
1147798558 17:43064660-43064682 AAGGATTCTGTGAGGGAGCATGG - Intronic
1149171765 17:53820621-53820643 AAGGACTACCTAAGTTAGGATGG + Intergenic
1151398425 17:73840282-73840304 AAGGGCTGCCTGAGGGAACAGGG - Intergenic
1155450605 18:25959135-25959157 AAGGACTAGATGTGTGAGCAAGG - Intergenic
1156067871 18:33166932-33166954 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1156866657 18:41896116-41896138 AAGAATTGACTGAGGGAGCATGG + Intergenic
1157999074 18:52595005-52595027 TAAGACTACCTGAAGGATCAAGG + Intronic
1158384547 18:56974779-56974801 AACGACTACCTGGGTGGGCAAGG + Intronic
1158601482 18:58859720-58859742 AGGGCCTACCTGAAGGAGAAGGG - Intergenic
1160774429 19:848523-848545 AAGGAGTCCCTGAGCCAGCAGGG - Intergenic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1162059956 19:8088373-8088395 AAGGAATGCATGAGTGAGCAAGG + Intronic
1163181039 19:15602175-15602197 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1164697725 19:30259310-30259332 AAGGGATACATCAGGGAGCAGGG + Intronic
1166441549 19:42819691-42819713 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166460982 19:42987983-42988005 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166478271 19:43147963-43147985 AAGGAATACCTGAGTGAGGCTGG - Intronic
926629414 2:15123169-15123191 AAGGAGAAACTGAGAGAGCATGG - Intergenic
927033546 2:19148199-19148221 AATGAATGCCTGAGGTAGCATGG - Intergenic
927145933 2:20166555-20166577 AAGGACATCGTGAGGGAGCAGGG + Intergenic
927203482 2:20592659-20592681 AAGGACCCTCTGAGGGCGCAGGG - Intronic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
928103410 2:28452514-28452536 AAGGGCTCTGTGAGGGAGCAGGG + Intergenic
928774831 2:34748347-34748369 AAGGCCTACTTGAGGGTGAAGGG + Intergenic
931557904 2:63525233-63525255 AAGGCCTACCTGAGGGTGGAGGG + Intronic
931677170 2:64708912-64708934 GAGGAATACCTGAGGGAGAGGGG - Intronic
932422597 2:71610495-71610517 AAGAACTACATGAGGAAGCAAGG - Intronic
932532988 2:72557636-72557658 AAGGTCTACTTGAGGGTGGAGGG + Intronic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
935197588 2:100827540-100827562 GAAGACTACTGGAGGGAGCAGGG - Intronic
936401538 2:112168309-112168331 AAGGACTAACTCAGGGAACAAGG + Intronic
937480074 2:122249092-122249114 AAAGACCACCTGGGTGAGCAGGG + Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
941324716 2:164099538-164099560 AAGGACTCCCAGTGTGAGCATGG - Intergenic
941667814 2:168259765-168259787 AAAGTCTACCTGGGGGAGGATGG - Intergenic
944281220 2:197900009-197900031 AAGTACTAGCTTAGGTAGCATGG - Intronic
945170919 2:206994160-206994182 AAAGAATACTTGAGTGAGCAGGG + Intergenic
946135068 2:217639227-217639249 AGGGCCTACTTGAGGGTGCAGGG + Intronic
946738894 2:222782244-222782266 TAGGACTACATGAGGGAGGGTGG - Intergenic
947638685 2:231693903-231693925 AAGAACTCCCTCTGGGAGCAAGG + Intergenic
948561556 2:238857087-238857109 AAGGACCACTGGAGGGAGCTTGG + Intronic
949086816 2:242162742-242162764 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1175726856 20:61324412-61324434 TAGAACTACCGGAGGGAGCATGG - Intronic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1177876857 21:26644264-26644286 AGGGCCTACCTGATGGTGCAGGG + Intergenic
1183291395 22:37003894-37003916 AGGGACTCCCTGGGGCAGCAGGG - Intronic
1183758353 22:39791889-39791911 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1184649845 22:45914719-45914741 CAGGACTATCTCAGGGAGCCAGG - Intergenic
1185212543 22:49578951-49578973 AAGAACTACCTGAGAAATCATGG + Intronic
949720363 3:6982284-6982306 GAGGACTACAAGAGGGAGAAGGG + Intronic
951104787 3:18730211-18730233 AAGGAGTGCCTGAGGTAGCTGGG - Intergenic
951780909 3:26362057-26362079 AGGGACTACCAGAGGGTGGAGGG - Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
954794030 3:53152379-53152401 ATGGACTGACTGATGGAGCAAGG - Intergenic
955353081 3:58208438-58208460 AAGGACTCCCTGAGGTAGGTAGG + Intronic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
959551619 3:107665983-107666005 AAAGACTACATGAAGGTGCAAGG - Intronic
959990446 3:112625750-112625772 AATGATTACCTGTGGGTGCAGGG + Intronic
960286928 3:115840037-115840059 ATGGAATACTTGAGGGAGAAGGG - Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
962604648 3:137023458-137023480 AAGGGCTCCCAGAGGGAGCATGG + Intergenic
968005688 3:195241103-195241125 AAGGCCGACCTGAAGAAGCAGGG + Intronic
969363415 4:6679779-6679801 AAGTGCTACCTCAGGGAGCAAGG - Intergenic
970567587 4:17347596-17347618 AATGAACACCTGTGGGAGCAGGG - Intergenic
972269264 4:37494282-37494304 GAGGACTACTGGAGGGTGCAGGG - Intronic
972724644 4:41736099-41736121 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
972935204 4:44125744-44125766 AAAGACGACCTGAGGCAGAATGG - Intergenic
973101602 4:46278716-46278738 AAGGACTATATGAAGAAGCATGG + Intronic
973584533 4:52377236-52377258 AAGTACTACCTGAGGGCGCGGGG + Intergenic
973698476 4:53514016-53514038 AAGGCATATCTGAGGCAGCAGGG - Intronic
974683174 4:65191344-65191366 AGGGCCTACTTGAGGGTGCAGGG - Intergenic
975031374 4:69621995-69622017 AAGGCCTACTTGAGGGTGGATGG + Intronic
977005322 4:91561489-91561511 AATGACTACATGAGGGATCAGGG - Intronic
977445799 4:97130434-97130456 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
979581095 4:122361475-122361497 AAGGGCTCCATGAGGGAGGAGGG + Intronic
980846359 4:138329912-138329934 AAGGACTGCCTGAAGGGACAAGG - Intergenic
983471930 4:168167774-168167796 AAGGCATAAATGAGGGAGCAAGG - Intronic
985565999 5:617681-617703 GAGGGCTACCTGAGGAAACAGGG + Intronic
985845289 5:2340320-2340342 GGGGACTACCTGAGGGTGGAGGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987141444 5:14951107-14951129 AAGACCTACCTGTGGGAGCCAGG + Intergenic
989509538 5:42268946-42268968 ATGGCCTACCTGAGGGTGAAGGG + Intergenic
991091134 5:62695061-62695083 TAGCACCTCCTGAGGGAGCATGG + Intergenic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
993671178 5:90763679-90763701 GGGGACTACTTGAGGCAGCAGGG - Intronic
993747868 5:91624107-91624129 AGGGACTACTTGAGGGAAGAAGG + Intergenic
993883258 5:93387736-93387758 AAACACCCCCTGAGGGAGCAAGG + Intergenic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
994348260 5:98714341-98714363 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
995943248 5:117610594-117610616 AGGGCCTACCTGAGGGTGGAGGG - Intergenic
996504783 5:124257124-124257146 AAGGACCATCGGAGGGGGCAGGG + Intergenic
997694552 5:135850927-135850949 AAGGAATACCTCAGGTCGCATGG - Intronic
998215179 5:140232752-140232774 AAGAACTAGCTGAGGCAGGAAGG + Intronic
999834709 5:155356809-155356831 GGGGACTACCTGAGGGTGAAGGG + Intergenic
1005687198 6:28266057-28266079 AAGGACTTCTTGAGGGTGGAGGG - Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1011253561 6:85398757-85398779 GAGGCCTACCTGAGGGTGGAGGG + Intergenic
1011282757 6:85693038-85693060 AGGGCCTACCTGAGGGATTAGGG - Intergenic
1012140303 6:95618563-95618585 AAAGAATACCAGAGGAAGCATGG - Intergenic
1012141137 6:95628378-95628400 GAGGTCTACTTGAGGGTGCAGGG + Intergenic
1012911509 6:105123139-105123161 TATTACTACCTGAGGGAGGAAGG - Intronic
1012941887 6:105424251-105424273 AAGGACTATCTGTGGGATCAGGG - Intergenic
1014072697 6:117201712-117201734 AAGGCCTTCCTCAGGGAACAAGG + Intergenic
1014299829 6:119667461-119667483 AAGGAGTAGCTGAGAGACCAAGG - Intergenic
1017236076 6:152118833-152118855 GAGGACTCCCCGAGGGAGCTTGG + Intronic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1020677950 7:11202712-11202734 AAGAACTACGCAAGGGAGCAGGG - Intergenic
1020706625 7:11552147-11552169 AGGGCCTACCTGAGGGTGTAAGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023869273 7:44254224-44254246 AAGGGCTGCCTGAGGGTCCACGG + Intronic
1027536869 7:79414296-79414318 AAGGACAACTTGAGAGAGGAAGG - Intronic
1027875361 7:83761626-83761648 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1028109161 7:86918202-86918224 AAAGACTAAGTGAGGGAGCTTGG - Intronic
1028865686 7:95708779-95708801 AAGACCTACTTGAGGGAGGAGGG + Intergenic
1029250109 7:99230097-99230119 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1031258220 7:119483390-119483412 AGGGCCTACTTGAGGGTGCAGGG - Intergenic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1034064590 7:148124103-148124125 AGGGACTGGCTGAAGGAGCAAGG + Intronic
1035497893 8:68527-68549 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
1039845597 8:41323445-41323467 AAGCACTGCCTGAGGCAGCCAGG + Intergenic
1040992381 8:53366640-53366662 AAGGCCTCCCTGAGATAGCATGG + Intergenic
1045127462 8:99108000-99108022 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1046889639 8:119408408-119408430 AAAGACTACCAGAGGGAGAAGGG + Intergenic
1048688545 8:136932391-136932413 AAGGTTTGCCTGAGGGATCAAGG - Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049646922 8:143739692-143739714 ACGGACAACCTTAAGGAGCACGG - Intergenic
1049823588 8:144652746-144652768 AGGGTCTACCTGAGGGTGGAGGG + Intergenic
1050932886 9:11351857-11351879 AATGATTACCTGTGGGAGGACGG + Intergenic
1051234110 9:14980399-14980421 AAGGCCTACATGTGGGAGTATGG - Intergenic
1055531394 9:77187866-77187888 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1057638075 9:96789799-96789821 GAGGCCTACCTGAGGGTGAATGG - Intergenic
1057806089 9:98220852-98220874 AGGGACTTCCTGAGCCAGCAGGG - Exonic
1060040929 9:120300309-120300331 ATGGACAACCTGAGGCAGAATGG + Intergenic
1060119891 9:120979088-120979110 AAGGAAAAAGTGAGGGAGCAAGG - Intronic
1061287821 9:129634192-129634214 AAGACCTACCTGGGGGAGGAGGG + Exonic
1062177192 9:135170300-135170322 AAGAACTAACTGTGGGAGCTGGG - Intergenic
1062344251 9:136107505-136107527 GGGGACCATCTGAGGGAGCACGG + Intergenic
1062749980 9:138245693-138245715 AAGGACTATCTGAGGGGACGGGG - Intergenic
1185794851 X:2956204-2956226 AAGTACTACATGAGGGTGGAAGG + Intronic
1186188353 X:7043545-7043567 AAGGAATACCTGAGTGAGGCTGG - Intergenic
1188362310 X:29271015-29271037 AAGGTCTACTTGAGGGTGGAGGG - Intronic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1189798891 X:44673773-44673795 AAACACAGCCTGAGGGAGCAAGG + Intergenic
1191817321 X:65260404-65260426 AGGGACTACTTGAGGGTGTAGGG + Intergenic
1191908477 X:66121860-66121882 AGGGACCCCCTGAGGGGGCAAGG - Intergenic
1193340533 X:80343953-80343975 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1193482074 X:82039016-82039038 AGGGCCTACCTGAGGGTGGAGGG + Intergenic
1193687748 X:84598937-84598959 GAGGCCTACATGAGGGAGGAGGG + Intergenic
1194407192 X:93511273-93511295 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1194817935 X:98468001-98468023 AGGGACTACCAGAGGGTGGAGGG + Intergenic
1195288811 X:103411745-103411767 GAGGCCTACCTGAGGGTGGAGGG - Intergenic
1195728615 X:107942385-107942407 GGGGACTACCTGAAGGAGAAGGG + Intergenic
1198974691 X:142323059-142323081 GGGGACTACCTGAGGGTGGAGGG - Intergenic
1200444559 Y:3243843-3243865 AGGGACTACTTGAGGGTGGAGGG + Intergenic