ID: 993962459

View in Genome Browser
Species Human (GRCh38)
Location 5:94316620-94316642
Sequence TGACTCTCAGGACAGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993962459_993962462 13 Left 993962459 5:94316620-94316642 CCATCTGGCTGTCCTGAGAGTCA 0: 1
1: 0
2: 1
3: 24
4: 219
Right 993962462 5:94316656-94316678 ACAGTCCACTCTGAATCAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 125
993962459_993962461 10 Left 993962459 5:94316620-94316642 CCATCTGGCTGTCCTGAGAGTCA 0: 1
1: 0
2: 1
3: 24
4: 219
Right 993962461 5:94316653-94316675 GAAACAGTCCACTCTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993962459 Original CRISPR TGACTCTCAGGACAGCCAGA TGG (reversed) Intronic
900406487 1:2495281-2495303 AGACTCTCAGGGCAGCCACAAGG - Intronic
900501261 1:3005841-3005863 TGATTCTCAGGAGAGCCTGGAGG - Intergenic
901323867 1:8355731-8355753 AGACTCTGCAGACAGCCAGAGGG + Intronic
902854626 1:19192249-19192271 TGACTCGGAGGGCAGCCAGTGGG + Exonic
904360385 1:29967416-29967438 GGACTGCCAGGAGAGCCAGAAGG + Intergenic
904576994 1:31511334-31511356 TGAGTCTCAGGCAAACCAGATGG + Intergenic
906847974 1:49215100-49215122 TGTCTCTCAGGAGAGCCACAAGG + Intronic
906967785 1:50475656-50475678 TTGCTCTAAGGACAGCCGGATGG + Exonic
907704316 1:56819600-56819622 TGACTGTCAGACCAGCCGGAGGG - Intronic
908401412 1:63775051-63775073 TGACTCTCGGGAGGGCCGGAGGG - Intronic
910214099 1:84824844-84824866 AGTCTAGCAGGACAGCCAGATGG - Intronic
910465963 1:87500404-87500426 TATCTCTCAGGAAATCCAGATGG + Intergenic
913172024 1:116241685-116241707 TGACTGTTAGGACACCCACAGGG + Intergenic
916403428 1:164473165-164473187 TGAGTCTCAGAACAGCTAAATGG - Intergenic
917435782 1:175019741-175019763 TGACTGACAGGACAGGCAAAGGG + Intronic
919747579 1:201018065-201018087 TCCCTCTTAGAACAGCCAGAGGG - Intronic
920356000 1:205373161-205373183 TCAATCTCTGGAGAGCCAGAGGG - Intergenic
921899007 1:220430806-220430828 TGAGTCTCAGGCTAGCCAGGGGG - Intergenic
923146043 1:231198855-231198877 TGAATCTCATCACAGCCATATGG - Intronic
923298202 1:232615488-232615510 TGAATCACAGGAAAGCCAGAGGG + Intergenic
923396248 1:233567992-233568014 TGACGCTAAGGACAGACACAGGG - Intergenic
923499962 1:234556364-234556386 TGACTTGTAGGACACCCAGATGG - Intergenic
923907353 1:238400105-238400127 GGACTCTCGGGACAGACTGAAGG - Intergenic
924067964 1:240245765-240245787 TGAATCTCTGGACAACCTGATGG - Intronic
1062848278 10:724535-724557 TGGGTCTGAGAACAGCCAGACGG - Intergenic
1064054412 10:12085501-12085523 TGACTCTGAGGAGAGCCAATAGG - Intronic
1065210492 10:23397927-23397949 TGAATTACAGGACAGCCAGTTGG - Intergenic
1066023046 10:31320590-31320612 TAACTCTCACGCCAGGCAGAGGG - Intronic
1067019054 10:42779481-42779503 TGACTCTCCTGACATGCAGAGGG - Intergenic
1067498912 10:46785075-46785097 TGACTCTCCTGACAAGCAGAGGG - Intergenic
1067550045 10:47227710-47227732 AGTCTCACAGCACAGCCAGAAGG + Intergenic
1067595731 10:47555298-47555320 TGACTCTCCTGACAAGCAGAGGG + Intergenic
1068209069 10:53896840-53896862 TGTCTCTCATCACACCCAGATGG + Intronic
1069894343 10:71671336-71671358 GGTCTCACAGGCCAGCCAGATGG - Intronic
1070598269 10:77847992-77848014 TGACTCTCAGGCCAGGCTCAGGG - Intronic
1072395935 10:95041447-95041469 TGTCTTTTAGAACAGCCAGAAGG + Intronic
1072545239 10:96432217-96432239 TGATTCTCAAAACAACCAGATGG + Intronic
1073869273 10:107843864-107843886 TGACTCTCTTGACAGCCAATGGG - Intergenic
1074900664 10:117813848-117813870 TAACTTTCAAGACAGACAGATGG + Intergenic
1075390584 10:122088106-122088128 AGAGCCTCAGGACATCCAGAGGG - Intronic
1075906340 10:126084882-126084904 TGAGGCTCAGGAAGGCCAGAGGG - Intronic
1075974907 10:126686536-126686558 TGACCCTCAGGACAGAAAGCAGG - Intergenic
1077286454 11:1768089-1768111 TGACTCTCCACACAGCCAGGAGG - Intergenic
1079077271 11:17391797-17391819 TGAGTCACAGGTCAGCCAGGTGG - Intergenic
1079701945 11:23558916-23558938 TGACTCTAAGAACAGAAAGAAGG - Intergenic
1080328380 11:31106538-31106560 TGCCTGTCAGCACAGCAAGAGGG - Intronic
1082082742 11:48025021-48025043 ATACTCTCAGGCCTGCCAGATGG - Intronic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1083170325 11:60920500-60920522 TGACTCCCTGGACAGCTAGCAGG + Intronic
1083184037 11:61007359-61007381 TGACTCTAAGGAGAACCACAGGG + Intronic
1084777944 11:71389513-71389535 TCCCTGTCAGGACAGGCAGAGGG + Intergenic
1088699969 11:112403014-112403036 TGAGTCTCAGGACAGGGTGAGGG + Intergenic
1088845937 11:113667578-113667600 TGACTCTCATGGAAGCTAGAAGG - Intergenic
1088952196 11:114583214-114583236 TGACTGACAGGAGAGACAGAGGG + Intronic
1088990758 11:114951424-114951446 TGACTCTGAGGAAAGACAGCTGG - Intergenic
1089168125 11:116493387-116493409 TTTCTCTGAGGGCAGCCAGATGG - Intergenic
1089493719 11:118898459-118898481 TGTGTCCCTGGACAGCCAGATGG - Exonic
1090182921 11:124716690-124716712 TGGCTCTTAGAAAAGCCAGATGG + Intergenic
1091114922 11:133004195-133004217 TGACTCTCAGGCAAGGCAGATGG - Intronic
1091795896 12:3297425-3297447 TGATTCTCAGGAATGCCAGTGGG - Intergenic
1093635329 12:21459688-21459710 TGAATTAGAGGACAGCCAGATGG + Intronic
1094220069 12:27983297-27983319 TGATTCTTATGACAGCCCGATGG - Intergenic
1098116962 12:67189403-67189425 ACACTCTCAGGATAGCAAGATGG + Intergenic
1101799467 12:108008215-108008237 TGAATTGCAGGACAGCCAGCTGG - Intergenic
1102327382 12:111998809-111998831 AGACTCTCAGGAAAGGCAAAGGG + Intronic
1102883566 12:116504983-116505005 TGATGCTCTGGACAGCCATAAGG + Intergenic
1105461431 13:20593003-20593025 TGAGTCTCCTGACAGCCAAATGG + Intronic
1114082737 14:19215698-19215720 TTCATCTCAGGACAGGCAGAGGG + Intergenic
1115401722 14:32969124-32969146 AGACTACCAGGACAGCCACAAGG - Intronic
1117223805 14:53634483-53634505 AGTCTCTCAGGACTCCCAGAAGG - Intergenic
1120715350 14:87835465-87835487 TGTCTTCCAGGACAGCCAGCTGG - Intergenic
1120875030 14:89367789-89367811 TGGCTCTCTGGACAGCCACTGGG - Intronic
1121294704 14:92809424-92809446 TCACTTTCAGTACAGCCAGCTGG - Exonic
1121614460 14:95303784-95303806 GGCATCTCAGAACAGCCAGATGG - Intronic
1121780378 14:96618294-96618316 TGATCCTCAGAACAGCCAGTGGG + Intergenic
1123223610 14:106879375-106879397 GGACGCTCAGGACAACCAGGGGG - Intergenic
1124673155 15:31659286-31659308 TCACTCTCAGGACAGCAAACAGG + Intronic
1125303261 15:38280345-38280367 AGATTCTCATGATAGCCAGAAGG + Intronic
1127482661 15:59391666-59391688 TAATTGTCAGGGCAGCCAGAAGG + Intronic
1128447830 15:67780306-67780328 TGATTACAAGGACAGCCAGAGGG + Intronic
1129243937 15:74268543-74268565 ACACCCTCAGGTCAGCCAGAGGG - Intronic
1129321715 15:74778718-74778740 TGGCTCAAGGGACAGCCAGAAGG - Intergenic
1129877838 15:78988432-78988454 TGCCTCTCAGGAGAGAAAGAGGG - Intronic
1131246633 15:90799922-90799944 TGACTGTTAGGAAAGACAGATGG + Intronic
1131375488 15:91919460-91919482 GGACTCACAGTGCAGCCAGACGG + Intronic
1131660163 15:94505571-94505593 TCAGTCTCAAGCCAGCCAGACGG + Intergenic
1133139009 16:3730965-3730987 TGACCCTGGGGACGGCCAGAGGG - Intronic
1133212265 16:4270335-4270357 TGTCTCCCAGGCCTGCCAGAGGG - Intronic
1133716938 16:8458871-8458893 GGAGTCTCAGGACAGGCATAAGG - Intergenic
1134008904 16:10836707-10836729 AGGCTCTCAGGACTGCCAGTGGG + Intergenic
1134676816 16:16096514-16096536 GGCCTCTGAGGACAGCCAGAAGG - Intronic
1135390584 16:22089924-22089946 TGCCTCTCAGGAAAGCCAAAGGG - Intergenic
1137390063 16:48073970-48073992 TGAATTTCAGGACACCCAGCTGG - Intergenic
1138172742 16:54868174-54868196 TGACACTCAAGACAGCCTCAGGG + Intergenic
1138509839 16:57502113-57502135 GCTCTCTAAGGACAGCCAGAGGG - Intergenic
1142072398 16:88098449-88098471 TCACCCTCAGGAAAGCCGGAGGG - Intronic
1143315354 17:6027854-6027876 TGCCTCTCAGGAGAGCCATGCGG + Intronic
1144059472 17:11569540-11569562 TGTCTGTCAGGACAGAGAGACGG + Intergenic
1144777510 17:17792177-17792199 TGACTCCCAGGAACGCAAGACGG - Intronic
1145980324 17:29007253-29007275 TGAGTCACAGGACAGCAAGGGGG + Intronic
1146566084 17:33914327-33914349 AGCCTCTCAGGGCAGCCAGTGGG + Intronic
1146800567 17:35816676-35816698 TGACTCTGAGTAAAGCCTGAAGG + Intronic
1146824991 17:36014130-36014152 AGACTCTTGGGGCAGCCAGAGGG + Intronic
1147980307 17:44269954-44269976 TGACTCCTAGGGCAGGCAGAGGG - Intergenic
1148723086 17:49768794-49768816 TTACTCTCAGGGTAGCCAGATGG + Intronic
1151061782 17:71102964-71102986 TGAGACTCAGGAGGGCCAGAAGG + Intergenic
1155509939 18:26566434-26566456 TTTATTTCAGGACAGCCAGAAGG - Intronic
1159388619 18:67759339-67759361 TTACTCTCAGTACTGCCTGATGG - Intergenic
1160497053 18:79381917-79381939 GGCCTCTCAGGACAGGAAGAAGG - Intergenic
1162339445 19:10083366-10083388 TCACTCTCAGGGCATGCAGATGG - Intergenic
1163090208 19:15014018-15014040 TGCCTCACAGGACAGCCTTAAGG - Intronic
1164807519 19:31128344-31128366 TGACTCTCAGGGCTGCCCTAAGG + Intergenic
1164810836 19:31154590-31154612 AGACTCTCAGCAAAGCAAGAGGG + Intergenic
1165061913 19:33209017-33209039 GGACTCTGAGGACAGACAGATGG + Exonic
1165961979 19:39542409-39542431 TGACTCTCCAGGCAGCCTGAGGG - Intergenic
1166741758 19:45118715-45118737 TGAGGGACAGGACAGCCAGATGG - Intronic
1166866811 19:45843584-45843606 AGAATCTCAGGCCTGCCAGATGG + Intronic
1167093228 19:47359043-47359065 AGACTCACATGGCAGCCAGAGGG - Intronic
1167618127 19:50547355-50547377 TGGCTCTCAGGATGGTCAGATGG + Intronic
924998502 2:385461-385483 TGACTCTCAGGAGGGACAGGGGG - Intergenic
926280123 2:11439301-11439323 TGACTCTCAGGATAAACACATGG - Intergenic
927651661 2:24917236-24917258 TGCCTCTCCTGACACCCAGAAGG + Intronic
928121969 2:28590217-28590239 TCCCTCTCAGTACAACCAGATGG - Intronic
928223860 2:29430566-29430588 TGACTCTCAGGCCAGCCACCTGG - Intronic
928224218 2:29433681-29433703 TGACTCCCAGGCCAGCCACCTGG - Intronic
930063981 2:47313617-47313639 TGACTGTCTGTACAGTCAGAGGG + Intergenic
932000124 2:67877452-67877474 TGATTCTCCAGACAGGCAGAGGG - Intergenic
932194678 2:69773216-69773238 TGACTCTCAGTATTTCCAGAAGG + Intronic
932451412 2:71813007-71813029 TGACACTCAGGTGGGCCAGAGGG - Intergenic
932653981 2:73591894-73591916 TAACTCACAGGAAAACCAGAAGG - Intronic
935150315 2:100428076-100428098 AGACTGACAGGACAGCAAGAAGG - Intergenic
936855811 2:116956134-116956156 TGACTATCAGGACTCCCAGATGG + Intergenic
937382896 2:121397235-121397257 TGAGTCTCTGGCCAGACAGATGG - Exonic
938065819 2:128281457-128281479 TGTCTCTAAGGACATCCTGATGG - Intronic
938792766 2:134691371-134691393 GGGCTCTCAGTACAGCCACAAGG - Intronic
939347916 2:140991710-140991732 TGACTCTCAATACAGCCATTTGG - Intronic
941323432 2:164083814-164083836 TGACTCTCAGGGCTGACACAAGG + Intergenic
944013928 2:195009257-195009279 TGTCTCTCAGCACTGCCAGATGG - Intergenic
947708252 2:232293634-232293656 AGGCCCTCAGGACAGACAGAAGG - Intronic
948476037 2:238220668-238220690 TGACTGTTAGAACAGCCTGAAGG + Intergenic
1168797659 20:622285-622307 TTCCTCTCTGGCCAGCCAGAAGG + Intergenic
1169805950 20:9559249-9559271 AGACTGTCAGGAGAGACAGAGGG + Intronic
1169814951 20:9646758-9646780 TGTTTCTAAGGACAGCAAGAGGG - Intronic
1170557106 20:17523662-17523684 GGACTCTCAGGACAGCTAGTAGG - Intronic
1170586864 20:17741345-17741367 TGGCTCCCAGGACTGCCAGCAGG - Intergenic
1170749773 20:19135286-19135308 TGAGTCTGAGGTCAGCCACATGG - Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1176297208 21:5080469-5080491 TGACACCCAGGACAGCCACGAGG - Intergenic
1177189962 21:17839879-17839901 TGACTTTCAGCTCAGCCAGAAGG - Intergenic
1177911348 21:27036861-27036883 AGAATCACAGGACAACCAGAAGG - Intergenic
1179859821 21:44181479-44181501 TGACACCCAGGACAGCCACGAGG + Intergenic
1179980521 21:44893341-44893363 GGGCTCTGGGGACAGCCAGAAGG - Intronic
1180006981 21:45027404-45027426 AGACTCTCAGGACGGACAGAGGG + Intergenic
1180069379 21:45428527-45428549 TGACATTTAGTACAGCCAGAAGG + Intronic
1180498042 22:15906971-15906993 TTCATCTCAGGACAGGCAGAGGG - Intergenic
1182468608 22:30533136-30533158 TGACTCCCAGGGCAGCCATGCGG - Intronic
1182943916 22:34304598-34304620 TCACTCTCAGGATATCCTGAAGG - Intergenic
1183499184 22:38168264-38168286 TGGCTGACAGGACAGCCAGATGG + Intronic
1183546493 22:38456823-38456845 CGAGGCTCAGGAGAGCCAGAGGG - Intergenic
1183723382 22:39574987-39575009 TGACTCACTGGAGAGCCAGCAGG + Intronic
1184321117 22:43742839-43742861 TGGCTCTAAGGACACCTAGAGGG - Intronic
1184876424 22:47278813-47278835 TGAGACTCAGGACAGCCAAGGGG - Intergenic
950508093 3:13408391-13408413 AGACTCTCAGGAGAGAGAGAAGG - Intronic
950509173 3:13415462-13415484 TGACTCTAAGGCCAGGCATAAGG + Intronic
950716833 3:14853682-14853704 TAACTCTGAGCACAGCCAAAAGG - Intronic
953006683 3:38985428-38985450 TGATTCTTAAGACAGCCAGCAGG - Intergenic
953691687 3:45125129-45125151 TGACTGTCAGGAAGGACAGATGG + Intronic
953928588 3:46994876-46994898 TGAGGCTCAGGAAAGTCAGAGGG - Intronic
954649724 3:52153827-52153849 TGACTCTCCAATCAGCCAGAGGG + Intronic
954744573 3:52779830-52779852 TGAGTCCCAGGACCGCCACAGGG + Intronic
955143801 3:56296066-56296088 TGAGTCTCAGGTCAGCCACTTGG - Exonic
955631342 3:60978675-60978697 TAACTCTCAGGGCAGCTACAAGG + Intronic
956045415 3:65190805-65190827 TGGCCCACAGGACAGTCAGAGGG - Intergenic
957461609 3:80528720-80528742 TAAGTCTCAGGACAGCTTGATGG - Intergenic
960747226 3:120903494-120903516 TGACTATCAGAACAGCTGGAAGG - Intergenic
961209938 3:125117937-125117959 AGACTCTCAGGAAAGCCAAAGGG + Intronic
963905471 3:150770330-150770352 TGTCTGGCAGGACAGCCAAATGG - Intergenic
967144598 3:186596201-186596223 GGACTCTCAGACCAGCCAGTGGG - Intronic
967795406 3:193593497-193593519 TGACTCTCAGGCCAGGCCGACGG + Intronic
968074041 3:195806282-195806304 TGAGGCTGAGGACAGCCAGGTGG - Intronic
968569435 4:1331725-1331747 AGGCCCTCAGGACAGCCAGAGGG + Intronic
969641604 4:8402124-8402146 TGACTCCCAGGACAGCCTGAGGG + Intronic
974343596 4:60648067-60648089 TGACTCTCTGCAAAACCAGAAGG - Intergenic
975611367 4:76206885-76206907 GGACTCACAGGAAAGCCAAAAGG + Intronic
976124064 4:81814848-81814870 TGCCTCTCAGGAGAGCAGGATGG + Intronic
978227473 4:106354714-106354736 TTACTCAGAGGACAGACAGAGGG + Intergenic
981455993 4:144953916-144953938 AGACTCTCAGCAAAGCAAGAGGG - Intergenic
982211476 4:153040057-153040079 TGCCTCTCACCACAGCAAGATGG - Intergenic
982505559 4:156213060-156213082 AGACACTCAGGACTGCTAGAGGG + Intergenic
983976989 4:173946889-173946911 TGAAACTCAGCACAGCTAGAAGG + Intergenic
984717277 4:182937515-182937537 TGGCTCTCAGGTCAGCCTGCAGG - Intergenic
985487215 5:158440-158462 AGACTCCCAGGACGGGCAGAGGG - Intronic
985487260 5:158559-158581 AGACTCCCAGGACGGGCAGAGGG - Intronic
985763425 5:1763633-1763655 TGTCTCTCAGGACCCCCAGCAGG - Intergenic
989169649 5:38461820-38461842 TGACTCTGACGACAGGAAGAGGG - Intronic
990333328 5:54748524-54748546 TGACTCACAGGAAAGGCAGCTGG - Intergenic
993962459 5:94316620-94316642 TGACTCTCAGGACAGCCAGATGG - Intronic
999685177 5:154096401-154096423 TCAATCACAGGACAGCAAGATGG - Intronic
1001211816 5:169816906-169816928 AGGCTTTCAGGACAGACAGAAGG - Intronic
1001810706 5:174625975-174625997 TGGATCTCAGGGCAGTCAGATGG - Intergenic
1006714416 6:36106312-36106334 TCATTCTCAGGACAATCAGAGGG + Intronic
1007728919 6:43933850-43933872 GAAGACTCAGGACAGCCAGAGGG - Intergenic
1007903798 6:45438653-45438675 TGTCTGTCTGGACATCCAGAAGG + Intronic
1009286081 6:61819416-61819438 TGTCTCTCAGGAAAGAAAGAGGG - Intronic
1010656666 6:78519436-78519458 TTACTTTCAGGAAAGCCAAAGGG - Intergenic
1014493658 6:122092900-122092922 TCACTCTCAGAACAGCAAGGGGG + Intergenic
1016181450 6:141152907-141152929 TGACTCAAAGAAGAGCCAGATGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018379183 6:163241881-163241903 TGAATGTCAGGAATGCCAGACGG - Intronic
1018981673 6:168606469-168606491 TGACTCTTATGACAGCTGGATGG + Intronic
1019422598 7:958048-958070 AGCCTCTCAGCACAGGCAGAAGG + Intronic
1020240926 7:6394549-6394571 TGAGTCTCAGGACACACACAGGG - Intronic
1021798419 7:24280727-24280749 TGTCTATCTGAACAGCCAGAGGG + Intergenic
1026637092 7:72093628-72093650 TGACTACCAGGACTGCCAGCTGG + Intronic
1028581648 7:92415323-92415345 TTACCCTTAGGAGAGCCAGATGG - Intergenic
1029051857 7:97697905-97697927 TGACTCTCTGGACAAAGAGATGG + Intergenic
1034451579 7:151139849-151139871 CCACACTCAGGAGAGCCAGACGG - Intronic
1035682171 8:1496074-1496096 TGACTTTCAGGGAAGCCAGTGGG - Intergenic
1039094090 8:33864477-33864499 TGACTCTCAGGCCTCCCAGATGG + Intergenic
1040576238 8:48654025-48654047 TGACTCACTGGAGAGGCAGAGGG - Intergenic
1043505238 8:80895935-80895957 TGACTCCTAGGACAACCTGAAGG - Intergenic
1045191527 8:99888967-99888989 AGACTCTCAGCAAAGCAAGAGGG - Intronic
1045802952 8:106122980-106123002 TGGCACCCAGGACAGCCAGCCGG - Intergenic
1047058058 8:121190098-121190120 AAGCTCTCAGCACAGCCAGATGG - Intergenic
1048296637 8:133219407-133219429 TGACGCTCAGCAAAGCCTGAAGG - Intronic
1048880782 8:138870978-138871000 GGAGTCTCAGGCCAGGCAGAGGG + Intronic
1049444324 8:142623088-142623110 TGAGTCTCAGAACAGCCGGGAGG + Intergenic
1052363542 9:27586268-27586290 TGACTCTCAGGACTGGAACATGG - Intergenic
1052650087 9:31291020-31291042 CGACTCTCAGAACACCGAGAGGG + Intergenic
1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG + Intergenic
1053530029 9:38871355-38871377 TGACTCTGAAGGCAGTCAGAAGG + Intergenic
1055647238 9:78372739-78372761 AAACCCTCAGGACAGACAGAGGG + Intergenic
1056014348 9:82367173-82367195 TCAATATCAGGACAGCCACATGG - Intergenic
1057685814 9:97233291-97233313 TGATGCTCAGGACAGCCAGTGGG - Intergenic
1057956430 9:99411889-99411911 TGACAGTGAGGAAAGCCAGACGG - Intergenic
1060521062 9:124294363-124294385 TGCTTCTCAGACCAGCCAGATGG - Intronic
1061720335 9:132547221-132547243 TGACTCCAGGGACAGCCAGACGG + Intronic
1061846133 9:133389443-133389465 TGACACTCAGAGCAGCCAGCAGG - Intronic
1189602613 X:42643382-42643404 TTACTCTCAGAACTTCCAGAAGG + Intergenic
1196927324 X:120646406-120646428 TGTCTCTCAGGGAAGACAGAAGG - Intergenic
1197752743 X:129976741-129976763 AGGCTCTCAGGACTGCCAAAGGG - Intergenic
1197932401 X:131709553-131709575 TGTCTCTCATGACCCCCAGATGG - Intergenic
1200167335 X:154045876-154045898 GGCATCTGAGGACAGCCAGAAGG + Intronic
1200258329 X:154597709-154597731 AGACTCTCAGCAAAGCCAGAGGG - Intergenic
1201696864 Y:16835639-16835661 TGCCTCTCAAAACAGCTAGATGG + Intergenic