ID: 993969992

View in Genome Browser
Species Human (GRCh38)
Location 5:94407583-94407605
Sequence CAGTATGTGCATTTTGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993969992_993969994 11 Left 993969992 5:94407583-94407605 CCGGACACAAAATGCACATACTG 0: 1
1: 0
2: 7
3: 64
4: 365
Right 993969994 5:94407617-94407639 TTATACAGAAGTTCCAGAAAAGG 0: 1
1: 2
2: 1
3: 29
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993969992 Original CRISPR CAGTATGTGCATTTTGTGTC CGG (reversed) Intronic
900383398 1:2397038-2397060 CAGAAGGTACATTTTGTGGCAGG + Intronic
900667603 1:3825847-3825869 CAGTTTGTGTATTTTTTGTGGGG - Exonic
902064748 1:13675337-13675359 CAATATGTGGCTTTTGTGTCTGG + Intergenic
902139047 1:14336219-14336241 CAATATGTGGCTTTTATGTCTGG + Intergenic
902701198 1:18173571-18173593 CAGTTTGTGTCTTTTGGGTCTGG + Intronic
903036589 1:20496996-20497018 CTGAATGTGTATTTTGTGCCTGG - Intergenic
904903237 1:33874500-33874522 GAGTATTTGTATTTTGTGTGTGG + Intronic
905597708 1:39222625-39222647 CATTTTGTGCAGCTTGTGTCTGG + Intronic
907498931 1:54864422-54864444 CAGTATGTGCCTTTTGTGACTGG - Intronic
910083377 1:83370276-83370298 AAGTGTGTGCATGTTGTGACTGG - Intergenic
910437819 1:87222963-87222985 CAGTATGTGGTTTTTGTGACTGG + Intergenic
910816294 1:91294375-91294397 CAGTATTACCTTTTTGTGTCTGG + Intronic
911833525 1:102585214-102585236 CAGAATTTGCCTTTTGTGACTGG - Intergenic
912693511 1:111822458-111822480 CAGTATTTGTCCTTTGTGTCTGG + Intronic
913131831 1:115845653-115845675 CAATATGTGGTCTTTGTGTCTGG - Intergenic
914406330 1:147377412-147377434 TAGGATGTGCATTTTGTTTGTGG - Intergenic
915180427 1:154054251-154054273 CAGTATCTTCATTTACTGTCTGG + Exonic
916344864 1:163776356-163776378 GAGTACCTGAATTTTGTGTCAGG + Intergenic
917060794 1:171036115-171036137 CAATATGTACTTTTTGTGACTGG - Intronic
917301913 1:173584241-173584263 CAATATGTGGCTTTTGTGTCTGG - Intronic
918332013 1:183470842-183470864 TATTATGTGTGTTTTGTGTCAGG - Intergenic
919125027 1:193382987-193383009 CAGTATGTGCTTCTGGTGCCAGG + Intergenic
921662954 1:217829318-217829340 CAGTATTTTCTTTCTGTGTCTGG - Intronic
922304416 1:224331544-224331566 CAGTATTTGACTTTTGTGACTGG + Intergenic
922419944 1:225452633-225452655 AAGTTTGTGCATGTTGTGGCAGG - Intergenic
922419946 1:225452681-225452703 CAGTATTTGTCTTTTGTGTCTGG - Intergenic
922846981 1:228694233-228694255 CTGTATCTGCATATTATGTCTGG - Intergenic
922874562 1:228930127-228930149 CAGTATGTGTTATTTTTGTCTGG - Intergenic
922926676 1:229353038-229353060 CAGTATTTGTCCTTTGTGTCTGG + Intergenic
924426140 1:243952128-243952150 CAGTGTGTGCTTTTTATTTCAGG - Intergenic
924836922 1:247658679-247658701 CAGTATTTGTGTTTTGTGCCTGG + Intergenic
924844855 1:247756656-247756678 CAGTATGTTAATTTTTTGTTAGG + Intergenic
1063107409 10:3004435-3004457 CAGCATGTGGCCTTTGTGTCTGG + Intergenic
1063881419 10:10536528-10536550 AAGTATGTCCATTTTGTGGCTGG + Intergenic
1064102437 10:12475375-12475397 CTGTATGTGTCCTTTGTGTCTGG + Intronic
1064126874 10:12669783-12669805 TAGTATGTACCTTTTGTGTCTGG + Intronic
1064814149 10:19237385-19237407 CGGTATTTGCTTTCTGTGTCTGG + Intronic
1067336358 10:45368220-45368242 CTGCATGTGCACTATGTGTCTGG + Intergenic
1068546317 10:58349902-58349924 CAGTATGTATCTTTTGTCTCTGG + Intronic
1069910571 10:71756537-71756559 GAGTATGTGCATTTTCTTTTAGG + Intronic
1070799715 10:79238116-79238138 CTGAATGATCATTTTGTGTCTGG + Intronic
1071802498 10:89079247-89079269 CATGACTTGCATTTTGTGTCAGG - Intergenic
1072712798 10:97728277-97728299 TAGTATGTGGCTTTTATGTCTGG + Intergenic
1074023003 10:109604149-109604171 CAGTATGTACATCTTGGGTCAGG - Intergenic
1074470230 10:113720190-113720212 CAGTATGTGCACTTTCTATGTGG - Intronic
1074504852 10:114060495-114060517 CAAGATGTGCCTTTTGTGTCTGG - Intergenic
1074564056 10:114560770-114560792 CACTATTAGCCTTTTGTGTCTGG - Intronic
1074973411 10:118561655-118561677 CACTTTGTGCATTTTGTGCCAGG - Intergenic
1074997841 10:118773240-118773262 CAGTATGTACTTTTTGTGTGTGG + Intergenic
1075912540 10:126137635-126137657 CAATAAGTGCCTTTTGTGACTGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078343324 11:10518480-10518502 TAATATGTGCTTTTTTTGTCTGG - Intronic
1078722447 11:13897281-13897303 GAGTATGTGTTTTTTGTGTGTGG + Intergenic
1079461462 11:20682840-20682862 CAGTATGTGCTTTTTTGGTCTGG + Intronic
1079698651 11:23516336-23516358 CAGTTTTTGCATTATGTTTCTGG + Intergenic
1079907757 11:26269808-26269830 CAATATGTGAATTTTTTGGCAGG - Intergenic
1080140199 11:28908823-28908845 CAGTATGTGCATTTGGAGAGAGG + Intergenic
1081164699 11:39793274-39793296 CAGTAGGTGCACTGTCTGTCTGG + Intergenic
1081389524 11:42513314-42513336 CACTATGTGCCTTTTATGTGGGG + Intergenic
1081641358 11:44756663-44756685 CAGTATTTGTCTTTTGTGACTGG + Intronic
1083126728 11:60576345-60576367 CAGTATGTTCATTTTGTGATTGG - Intergenic
1086014104 11:82143473-82143495 CAGTTTCTGCAGTTTATGTCTGG + Intergenic
1086898407 11:92339430-92339452 TAGTATGTACGTTTTGTGTGGGG + Intergenic
1087068276 11:94048081-94048103 ATGAATGTGCCTTTTGTGTCTGG + Intronic
1087284029 11:96244941-96244963 CAGCATGTTCCTTTTGTTTCAGG - Intronic
1087367784 11:97243247-97243269 AGGTATGTGGATTTTGTTTCTGG + Intergenic
1087395835 11:97596755-97596777 TAGTATTTGCTTTTTGTGGCAGG - Intergenic
1087405238 11:97722041-97722063 GAGTATATGTATTTTGTGTTTGG - Intergenic
1088000185 11:104869948-104869970 CAGTATTTGCTTTTTGAGCCTGG - Intergenic
1088205648 11:107389003-107389025 CTGTATGTGTATGTTGTGTTGGG - Intronic
1089411796 11:118249950-118249972 CAATATGTGCTTTTGGTGACTGG - Intronic
1090685316 11:129111089-129111111 AAGTATGTTCCTTCTGTGTCTGG + Intronic
1092534417 12:9374917-9374939 CAGTAGGTATCTTTTGTGTCTGG + Intergenic
1094188699 12:27674341-27674363 TAATATGTGAACTTTGTGTCTGG - Intronic
1095781156 12:46061689-46061711 CAATATGTGTCTTTTGTGTCTGG - Intergenic
1097566538 12:61276752-61276774 CAGCATGAACATTTTGTTTCAGG + Intergenic
1097734009 12:63161716-63161738 TATTATGTGCATTTTTTTTCTGG + Intergenic
1097823265 12:64148958-64148980 CAGTATGTAGATTTTGTGTCTGG + Exonic
1098027381 12:66218919-66218941 CAGTATTTGTCTTCTGTGTCTGG + Intronic
1098335441 12:69399868-69399890 CAGTAGGTGGCCTTTGTGTCTGG - Intergenic
1098792573 12:74843380-74843402 CAGTTTGTTCATTTGGTGCCCGG - Intergenic
1098979523 12:76940177-76940199 TAGTCTGTGCACTTTTTGTCTGG - Intergenic
1099705556 12:86148480-86148502 CAGTAGGTACATTTGGTCTCTGG - Intronic
1099822377 12:87729110-87729132 AAGTATGTGTATTTTGTGGTTGG - Intergenic
1100062220 12:90593243-90593265 CAGTACCAGCATTTTGTATCTGG + Intergenic
1101120609 12:101575701-101575723 TAGTATGTTCCTTCTGTGTCTGG + Intronic
1102181563 12:110916557-110916579 CAATATGTGGTATTTGTGTCTGG - Intronic
1103733953 12:123046689-123046711 CAATATGTGCTTTCTGTGTCTGG + Intronic
1105206292 13:18227861-18227883 CAATATATTCCTTTTGTGTCTGG + Intergenic
1105929447 13:25038800-25038822 CAGTATTGTCCTTTTGTGTCTGG - Intergenic
1106016609 13:25875004-25875026 GAGTATTTGCCTTTTGTGACTGG - Intronic
1106037373 13:26056303-26056325 CAATATGTGCCTTTTGCGTCTGG - Intergenic
1107161007 13:37227702-37227724 TACAATGTGTATTTTGTGTCTGG + Intergenic
1108859545 13:54838229-54838251 TAGTATGTGCTCTTTTTGTCTGG + Intergenic
1109584915 13:64386988-64387010 TAGTTTGTGCATTTTATGTGTGG - Intergenic
1109631171 13:65048700-65048722 CAGTATGAGCAGTATGTGGCTGG + Intergenic
1109887574 13:68561832-68561854 AAGTATGTGCATTTATTATCTGG - Intergenic
1109935590 13:69279450-69279472 CAGTATGTGAAGTATGTGGCTGG + Intergenic
1114391744 14:22316494-22316516 CAATATGGCCATTTTGTGTCTGG - Intergenic
1115273917 14:31585070-31585092 CAATATGTGCTTTTTCTGACTGG + Intronic
1117397391 14:55324185-55324207 TAGTATGTGCCTTTTGTTTCTGG + Intronic
1117937954 14:60928123-60928145 AAGTATGTGGTTTTTGTGTCTGG + Intronic
1119772659 14:77230388-77230410 CAGTATGTGTTGTTTGTGCCTGG + Intronic
1119879257 14:78087233-78087255 CAGTATGTGCATTTTAGATGCGG + Intergenic
1120069411 14:80086133-80086155 CATTATGTGATTTTTTTGTCTGG - Intergenic
1120960246 14:90117926-90117948 CAGTATGTGACTTTTGTGTCTGG + Intronic
1121290876 14:92774108-92774130 CATTATGTGGCATTTGTGTCTGG - Intergenic
1124692137 15:31832695-31832717 TAGTATGTGTTTTTTGTGACTGG + Intronic
1125086549 15:35736901-35736923 CAATATGTGACCTTTGTGTCTGG + Intergenic
1125337530 15:38641889-38641911 TAGTATCTGTATTTTTTGTCTGG + Intergenic
1125404935 15:39342199-39342221 GGGCATGTGCATTTTGTTTCTGG - Intergenic
1125553203 15:40563408-40563430 CAGTATCTGCCTTTTGTGTATGG - Intronic
1126723968 15:51612131-51612153 TAGTATCTTCATTTTGTGTCTGG - Intronic
1126820561 15:52499582-52499604 CAGTATGTGTCTTTTGTGACTGG + Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1128526931 15:68418916-68418938 CAGGATATGCAATTTGTGGCAGG + Intronic
1129204880 15:74031230-74031252 TACAATGTGTATTTTGTGTCTGG + Intronic
1129668139 15:77591198-77591220 CCATATGTGCCTTTTGTGTGTGG + Intergenic
1129688438 15:77699497-77699519 TAGTATGTGCTTATTGTGTGTGG - Intronic
1129688454 15:77699713-77699735 TAGTATGTGCTTATTGTGTGTGG - Intronic
1130369251 15:83269966-83269988 CAGTCTGTGACTTTTGTGCCTGG - Intronic
1130423398 15:83771536-83771558 CAGTATTTGTCTTTTGTGACTGG + Intronic
1130637291 15:85636227-85636249 TAGTATGTTGACTTTGTGTCTGG + Intronic
1130881454 15:88059453-88059475 AATAATGTGCATTTTGTTTCAGG - Intronic
1131744171 15:95428154-95428176 CAGTATTTGTTTTCTGTGTCTGG - Intergenic
1131978840 15:97975320-97975342 CAGTATGTACCTTTTGAGACTGG + Intergenic
1134607557 16:15582995-15583017 CAGTATGTATATGTTGTATCTGG - Intronic
1135043600 16:19136427-19136449 CAGTCTGTGCAGTTTGGTTCTGG + Intronic
1135966255 16:27037572-27037594 CAGAATGCCCATTTTGTGCCAGG + Intergenic
1137262373 16:46842254-46842276 CAGTATATTCCTTTTGTGTTTGG + Intergenic
1137710868 16:50565999-50566021 CAGGATGTGCAGTGTGTGTCGGG - Intronic
1139389626 16:66598664-66598686 GAGTATGTACCTTTTGAGTCTGG + Intergenic
1139966271 16:70747211-70747233 CAGGATGTGGACTTTGTGGCTGG - Intronic
1140045825 16:71440092-71440114 CAGTATTGGCCTTTTGTGTCTGG - Intergenic
1140138788 16:72233831-72233853 CAATATGTGGCTTTTGTGTCTGG + Intergenic
1140934796 16:79660474-79660496 CAAAATGTGGCTTTTGTGTCTGG - Intergenic
1141489174 16:84360370-84360392 CAGGATGTGGTTTTTGTGACTGG + Intergenic
1141887137 16:86900047-86900069 AAATATGTGGTTTTTGTGTCTGG - Intergenic
1142914833 17:3127826-3127848 CAATATGTGTATTTTGGGGCTGG + Intergenic
1144117965 17:12119152-12119174 CAGAATGTGCACTTTGTCTATGG - Intronic
1144683108 17:17208082-17208104 CAGTATGTACTCTTTTTGTCTGG - Intronic
1144781997 17:17813010-17813032 CAGTCTGTGGACTTTGTGTGTGG - Intronic
1149032059 17:52095203-52095225 CAGAATGTACTCTTTGTGTCTGG - Intronic
1149148118 17:53523364-53523386 TAGTATGTGAATTTTCTGCCCGG + Intergenic
1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG + Intronic
1151752525 17:76048330-76048352 CAGAGTGTGCCTTTTGTGGCTGG + Intronic
1151972330 17:77465090-77465112 CAGTATGTGGCCTTGGTGTCTGG + Intronic
1152005876 17:77680827-77680849 GAGCATGTTCAGTTTGTGTCTGG + Intergenic
1153204785 18:2686705-2686727 CAGTTTGTGTATGTTGTGTGGGG + Intronic
1154051587 18:10964850-10964872 CAGTATGTGAACTTGGTGTCTGG + Intronic
1155679405 18:28471482-28471504 CAGTCTGTTCATTTTGTGATAGG + Intergenic
1156440211 18:37178335-37178357 CAGTATTTGTTTTTTGTGCCCGG + Intronic
1156652096 18:39236502-39236524 TAGTGTTTTCATTTTGTGTCCGG - Intergenic
1157904496 18:51557226-51557248 CAGTAAGTGCATTGTGTGCCAGG - Intergenic
1157937591 18:51890640-51890662 CAATATGTGCCTTTTGTGGCTGG + Intergenic
1158024758 18:52882905-52882927 CAGTATTTGCTTTATATGTCTGG + Intronic
1159170345 18:64757955-64757977 CAGTGTATGCATTTAGTCTCAGG + Intergenic
1159235660 18:65669865-65669887 CACTCTGTGCCTTTTGTGTGGGG - Intergenic
1159320179 18:66838268-66838290 CAGTATGTGCAGTATGTGAGAGG + Intergenic
1159405094 18:67991202-67991224 TCAAATGTGCATTTTGTGTCTGG - Intergenic
1159761685 18:72434698-72434720 GCGTATGTGCATCTTGTTTCGGG - Intergenic
1160276160 18:77438459-77438481 CAGTATTTGTATTTTGTTTGTGG + Intergenic
1160422874 18:78759860-78759882 CAGTATTTGTCTTTTGAGTCTGG + Intergenic
1161167058 19:2793713-2793735 CACTGTGTGACTTTTGTGTCTGG + Intronic
1161639582 19:5412833-5412855 CAATATGTGGCCTTTGTGTCTGG - Intergenic
1161863534 19:6817358-6817380 CAATATTTGCATTTTTTGGCTGG - Intronic
1163094570 19:15047365-15047387 CACTATGTGATTTTTGTGTCTGG - Intergenic
1163779058 19:19236269-19236291 AAATATGTGTCTTTTGTGTCTGG + Intronic
1164490252 19:28704631-28704653 TTGTATGTGCATTTTGTGCTGGG - Intergenic
1165084394 19:33333442-33333464 CAGTATTTGCTTTTTGCGACTGG - Intergenic
1165262869 19:34635944-34635966 CCGTGTGTGCAGTTTGTGCCCGG + Intronic
1167446266 19:49539363-49539385 CAATAGATGCTTTTTGTGTCTGG - Intronic
1168600047 19:57710033-57710055 CAGTCTGTGCACTTTTGGTCAGG + Intronic
1202668875 1_KI270709v1_random:30302-30324 CAATAGGTGCCTTTTGTGCCTGG - Intergenic
927347474 2:22062630-22062652 CAATATGTACATTTTCTGACTGG + Intergenic
927728599 2:25449095-25449117 CAGTACGTACTTTTTTTGTCTGG + Intronic
929688109 2:44051986-44052008 AATTATGTGCATCTTGTGTGTGG + Intergenic
930649394 2:53949639-53949661 CAGTATTTGTCTTTTGTGACTGG - Intronic
930792781 2:55351962-55351984 CAATACGTGCCTTTTGTGACTGG - Intronic
932711982 2:74072843-74072865 CAGTATTTGTCCTTTGTGTCTGG + Intronic
933454755 2:82507203-82507225 CAGTATGTGAATTTTGGGGTGGG + Intergenic
935093641 2:99922463-99922485 CAGTATGTGCCTTAAGTTTCTGG - Intronic
936704309 2:115053357-115053379 CAATATGTGACCTTTGTGTCTGG - Intronic
937392235 2:121499312-121499334 CAATATTTGGCTTTTGTGTCTGG - Intronic
937518918 2:122687043-122687065 CAGTATTTGTTTTCTGTGTCTGG - Intergenic
937609488 2:123842807-123842829 CAGTCTGTGCCTTTTATGTGGGG - Intergenic
938338286 2:130518341-130518363 CAGTATTTTCCTTTTGCGTCCGG - Intergenic
938351552 2:130602408-130602430 CAGTATTTTCCTTTTGCGTCCGG + Intergenic
939803729 2:146746575-146746597 CAGAATGTACAATTTTTGTCTGG + Intergenic
941338689 2:164278087-164278109 CAGTATTTGTTTTTTGTGCCTGG + Intergenic
942165321 2:173235484-173235506 CAATATGTGACCTTTGTGTCTGG - Intronic
942761781 2:179407343-179407365 CATTATGTGCATTTTGCTTGGGG - Intergenic
943113132 2:183632297-183632319 CAGAATGTGTATTGTGTGTAAGG - Intergenic
943317172 2:186404087-186404109 CAGTATTTGCCTTCTGTGACTGG + Intergenic
943780811 2:191821633-191821655 AATTCTGTGAATTTTGTGTCCGG - Intergenic
944029271 2:195214278-195214300 CAGTATCAGCATTTTGGGGCTGG + Intergenic
944349782 2:198713304-198713326 CAGCATTTGCATTTTGGGCCAGG - Intergenic
945213903 2:207413101-207413123 CATTTTGTGCATTTCCTGTCTGG - Intergenic
946756017 2:222948449-222948471 CTGTATGTGCATTTTTTTTCTGG + Intergenic
946988825 2:225304262-225304284 CAGTGTGAGCCTTTTGTGTCTGG - Intergenic
947631921 2:231659315-231659337 CAATATGTGGTCTTTGTGTCTGG - Intergenic
947650600 2:231783053-231783075 CAGTATGTACAGTATGTGTCTGG + Intronic
947816821 2:233042973-233042995 CAGAATTTGCATTTTTTGACAGG - Intergenic
947831060 2:233142154-233142176 CAGTCTCTGCATTTGGTGGCAGG + Intronic
948043390 2:234923067-234923089 CCATATGTACCTTTTGTGTCTGG - Intergenic
948285171 2:236778629-236778651 CAGTATTTGCTTTCTGTGTCTGG + Intergenic
948656817 2:239481367-239481389 CAGTGTTTGCATTTTGTGCCTGG + Intergenic
948993567 2:241566744-241566766 CGGCTTGTTCATTTTGTGTCTGG - Intronic
1168878767 20:1188591-1188613 TAGTATGTGTATTGTGTGTATGG - Intronic
1169101372 20:2952814-2952836 CAATATTTTCATTTTGTGACTGG + Intronic
1170413188 20:16112538-16112560 CATTCTGTGCATTTTGTCACTGG - Intergenic
1170503665 20:17001535-17001557 CAGTATGTAGCTTTTGTGTATGG - Intergenic
1170878392 20:20272554-20272576 CAGTATGTGCAGGGGGTGTCTGG - Intronic
1171226387 20:23445027-23445049 GAGTATGAGCATTGTGTGTGTGG - Intergenic
1172128652 20:32640887-32640909 CAGTATGTGATCTTTGTGACAGG + Intergenic
1172855426 20:37998275-37998297 CATTTTGTGCATTTTGTTTTGGG + Intronic
1173461121 20:43244156-43244178 CAATATGTGCTTTTTGTGTCTGG - Intergenic
1174799454 20:53550897-53550919 AATTATGTGGTTTTTGTGTCTGG - Intergenic
1175175780 20:57111082-57111104 CAGTATTTGTACTTTGTGACTGG + Intergenic
1175386743 20:58600984-58601006 CAATATTTGCCTTTTGTGACTGG + Intergenic
1175389613 20:58618671-58618693 CAGTTTGTTGATTTTGTGTTGGG + Intergenic
1179982666 21:44904566-44904588 TAGTATGTGTGCTTTGTGTCTGG - Intronic
1180577070 22:16786950-16786972 AAGTATTTGAATTTTTTGTCAGG - Intronic
1180759660 22:18190843-18190865 CAATATATTCCTTTTGTGTCTGG - Intergenic
1180769973 22:18375144-18375166 CAATATATTCCTTTTGTGTCTGG - Intergenic
1180776355 22:18487522-18487544 CAATATATTCCTTTTGTGTCTGG + Intronic
1180809082 22:18744891-18744913 CAATATATTCCTTTTGTGTCTGG + Intergenic
1180827913 22:18878099-18878121 CAATATATTCCTTTTGTGTCTGG - Intergenic
1180900804 22:19370623-19370645 AAGTATCTGCATTTTCTGTAAGG + Intronic
1181072004 22:20349869-20349891 CAATATATTCCTTTTGTGTCTGG + Intergenic
1181195078 22:21178814-21178836 CAATATATTCCTTTTGTGTCTGG + Intergenic
1181214367 22:21313960-21313982 CAATATATTCCTTTTGTGTCTGG - Intergenic
1181524822 22:23475573-23475595 CAATATATTCCTTTTGTGTCTGG - Intergenic
1181626394 22:24125067-24125089 CAGTATTTGTCTTTTGTGACTGG - Intronic
1181626781 22:24127574-24127596 CAGTATTTGCCTTTTGTGACTGG - Intronic
1181975419 22:26725621-26725643 CAGTATTTATCTTTTGTGTCTGG + Intergenic
1182580839 22:31309842-31309864 CAGTATTTGTTTTTTGTGACTGG + Intergenic
1183980119 22:41534436-41534458 CACTGTGTGGCTTTTGTGTCTGG - Intronic
1184414798 22:44346050-44346072 CTGGATGTGCATTTTGTGATGGG + Intergenic
1184901485 22:47449049-47449071 CCGTATGTGCATTATGTTTGGGG + Intergenic
1185013867 22:48332243-48332265 TGGTATGTGCATGTGGTGTCTGG - Intergenic
1203231803 22_KI270731v1_random:116328-116350 CAATATATTCCTTTTGTGTCTGG - Intergenic
1203278011 22_KI270734v1_random:104097-104119 CAATATATTCCTTTTGTGTCTGG - Intergenic
949330351 3:2915921-2915943 AAGTATTTGCTTTTTGTGACTGG - Intronic
949941957 3:9162056-9162078 CAGTATTTGTCTTTTGTGACTGG - Intronic
950900948 3:16496968-16496990 AAGAATGTACTTTTTGTGTCTGG - Intronic
951119205 3:18904646-18904668 CAGTATGTACTCTTTGTGTCTGG - Intergenic
953586839 3:44209197-44209219 CAGTATGTGGTCTTGGTGTCTGG - Intergenic
953836092 3:46345542-46345564 CAATATGTACCTTTTATGTCTGG + Intergenic
954591073 3:51782295-51782317 CAATATGGGCCTTTTGTGTCTGG + Intergenic
954728094 3:52633272-52633294 CAGTATTTGTATTTTGTGACTGG + Intronic
954887219 3:53886089-53886111 CCTTGTGTGCATTATGTGTCTGG - Intronic
955329301 3:58033690-58033712 CAGTATGTACTCTTTTTGTCTGG + Intronic
956808513 3:72841478-72841500 CAGTATGTGTTCTTTTTGTCTGG - Intronic
956889633 3:73599338-73599360 TAGTATTTGCCTTTTGTGACTGG - Intronic
959825378 3:110788819-110788841 CACTCTGTGCCTTTTGTGTGGGG + Intergenic
961705044 3:128778021-128778043 CAGTATTTTTATTGTGTGTCAGG + Intronic
961765505 3:129207321-129207343 CAGTATTTTCCTTTTGTGACTGG + Intergenic
964547585 3:157851455-157851477 CTGTATGTTGATCTTGTGTCTGG + Intergenic
964905058 3:161709239-161709261 CAGTATGTGCCTTTTATTTTGGG - Intergenic
965794229 3:172422191-172422213 CAGTATATCCTTTTTGTGCCTGG + Intergenic
968264279 3:197350590-197350612 CAGTATTTGCCTTTTGTGACTGG + Intergenic
968933155 4:3594817-3594839 CAGAATTTCCATTTTGTTTCAGG + Intergenic
969105032 4:4800791-4800813 CAATATGTGCATTTTTGGTCTGG - Intergenic
969924087 4:10569377-10569399 CAGTGTGTGCATTTGGGGACGGG - Intronic
970880269 4:20920441-20920463 CAGAATGTTCATAATGTGTCTGG - Intronic
971982328 4:33768561-33768583 CAGTTTGTGCATGCTGTGTGTGG + Intergenic
973265478 4:48206068-48206090 CAATATGTTACTTTTGTGTCTGG - Intronic
974437230 4:61871509-61871531 CAGTATGTGCCTTTAGTGACCGG - Intronic
975936689 4:79589721-79589743 CAGTATTTGGTTTTTGTTTCTGG - Intergenic
976119775 4:81767174-81767196 CAGTATGTGAATTTGGGGGCTGG - Intronic
976698920 4:87947813-87947835 CAGCATGTGCATTTGGGGTGAGG + Intergenic
976797762 4:88953721-88953743 CAGTATGTGTCTTTTTTGACTGG + Intronic
977121168 4:93103697-93103719 CAGTATGTGCATTTACTGAGAGG + Intronic
977342742 4:95779967-95779989 GAGTATGTACTTTTTGTGTCTGG - Intergenic
977674823 4:99735395-99735417 CACTATTTACCTTTTGTGTCAGG + Intergenic
978218621 4:106240480-106240502 TTTTATGTGGATTTTGTGTCAGG - Intronic
978775374 4:112500493-112500515 CAATATTTTCCTTTTGTGTCTGG - Intergenic
979651012 4:123131580-123131602 CAGTATGTGTCTTTTGTAACTGG + Intronic
979837168 4:125385346-125385368 CAATATCTGAATTTTGTGTGAGG - Intronic
980020436 4:127703087-127703109 CAGTAGGTAATTTTTGTGTCTGG + Intronic
981471241 4:145137930-145137952 CCGTATCTGCCTTTCGTGTCTGG + Exonic
981521388 4:145666100-145666122 CAGTATTTGTCTTTTGTGACTGG + Intergenic
981948849 4:150381449-150381471 CAATATGTGGCTTTTATGTCTGG + Intronic
982932336 4:161424666-161424688 CAGTCTCTACATTTTGAGTCTGG - Intronic
983326577 4:166265421-166265443 CAGTATTTGTATTCTGTGCCTGG + Intergenic
983882151 4:172945159-172945181 CAGTATGTGCTCTTTTTGTCTGG - Intronic
985388513 4:189469936-189469958 CAGTATTTTCCTTCTGTGTCTGG + Intergenic
986829033 5:11555316-11555338 CAGTTTGTGTATTTTGCTTCAGG + Intronic
986830334 5:11570001-11570023 TAGTATGTGCATCTTGTCTTAGG - Intronic
987039124 5:14045493-14045515 CAGTATTTGTATTTTGTGAATGG - Intergenic
987517526 5:18932447-18932469 AAGAACGTGTATTTTGTGTCAGG - Intergenic
987848373 5:23317509-23317531 CGATATGTGTTTTTTGTGTCTGG - Intergenic
989441978 5:41483020-41483042 CAGTATTTGTTTTTTGTGACTGG + Intronic
990707996 5:58551858-58551880 CTGAAGGTGCATTTTGTTTCAGG - Intronic
990833204 5:59984066-59984088 CTGTATGTACTTGTTGTGTCTGG - Intronic
991226147 5:64275250-64275272 CATAATGTGGACTTTGTGTCAGG + Intronic
991668189 5:69021312-69021334 CAATATGTGGGTTTTCTGTCTGG + Intergenic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
994894094 5:105679119-105679141 CAGTATGAACATATTTTGTCTGG - Intergenic
996022269 5:118604422-118604444 CAGGATATGAATTTTGTGTAAGG - Intergenic
996677947 5:126198177-126198199 AAGTCTCTTCATTTTGTGTCTGG - Intergenic
998356657 5:141543256-141543278 AAGTATGTGCCCTTTGTGTCTGG - Intronic
998533998 5:142912300-142912322 CAGTATGTGCTCTTTTTGTCTGG - Intronic
999006805 5:147990080-147990102 CAGTATTTGCCTTCTGTGACTGG - Intergenic
999033851 5:148325029-148325051 CAATATGTGCTTTTTGTGTCTGG + Intronic
1000017644 5:157292137-157292159 CAATATGGACCTTTTGTGTCTGG + Intronic
1000142547 5:158419642-158419664 CAATATTTGTTTTTTGTGTCTGG + Intergenic
1000490634 5:161908815-161908837 CAATATGTGGTCTTTGTGTCTGG - Intergenic
1000863254 5:166482170-166482192 AAGTATGTGCATTATTTTTCAGG - Intergenic
1002119178 5:176988412-176988434 CAATATGTGCCTTTTATGTCTGG - Intronic
1002451953 5:179324034-179324056 CAATATTTGCCCTTTGTGTCTGG - Intronic
1002543336 5:179920967-179920989 AAGTATGTGCAATTTGGGTGCGG - Intronic
1002633017 5:180593470-180593492 CAGTGTTTGTCTTTTGTGTCTGG + Intergenic
1003331587 6:5133854-5133876 TAATATGTGGCTTTTGTGTCAGG + Intronic
1004120022 6:12812248-12812270 CAGTATGTGACTTTTGTGTCTGG + Intronic
1006222269 6:32501326-32501348 CAGTATGTGACTTTTGTGACTGG + Intergenic
1006224482 6:32525567-32525589 CAGCAGGTGCCTTTTGTGTGAGG - Intronic
1006663387 6:35669367-35669389 CAGTATGTGCATTGTAGGCCAGG - Intronic
1007573958 6:42912716-42912738 CAGTATTTGTTTTTTGTGACCGG - Intergenic
1007759217 6:44122744-44122766 GAGTTTGTCCTTTTTGTGTCTGG - Intronic
1009351535 6:62685368-62685390 CAGGTTATGCATTTTTTGTCAGG - Intergenic
1010238501 6:73595461-73595483 TAGTATGTACCTTTTTTGTCTGG - Intronic
1010545907 6:77155841-77155863 TTGTATGTTGATTTTGTGTCTGG + Intergenic
1011574039 6:88774707-88774729 CAATATTTTCCTTTTGTGTCTGG - Intronic
1012696907 6:102395949-102395971 CAATATATGCTTTTTGTATCTGG + Intergenic
1012934471 6:105351791-105351813 CAGTGTTTGCATTCTCTGTCAGG - Intronic
1013694084 6:112680533-112680555 AAGGATGTGCATTTTGTTTCAGG + Intergenic
1013885740 6:114964061-114964083 CAATATGTGAATTTTGTGTCTGG + Intergenic
1013939338 6:115643291-115643313 CAGTATGTAATTTTTGAGTCTGG - Intergenic
1014207784 6:118675213-118675235 AAATATGTGGTTTTTGTGTCGGG - Intronic
1015728173 6:136320911-136320933 CAGTATGTATTTTTTCTGTCTGG - Intergenic
1016729441 6:147412773-147412795 CAGTATTTTCATTCTGTGCCTGG - Intergenic
1018603081 6:165567187-165567209 CAGTATTTATCTTTTGTGTCTGG - Intronic
1020421491 7:8011394-8011416 CAGTATTTTCCTTTTTTGTCTGG + Intronic
1021985413 7:26093563-26093585 CAGTATGTACTCCTTGTGTCTGG + Intergenic
1022229305 7:28398241-28398263 TAGTGTTTGCTTTTTGTGTCGGG + Intronic
1023098872 7:36692177-36692199 CACCATGTGCATTTTATGTGTGG - Intronic
1023384130 7:39638362-39638384 CAATATGTGGTTTTTGTGTCTGG + Intronic
1023898806 7:44458205-44458227 CATTATGTGGCCTTTGTGTCTGG - Intronic
1024230401 7:47359284-47359306 AAGTATGTGCTTTTTGTGGCTGG - Intronic
1024432591 7:49306703-49306725 CAGGATTTGTCTTTTGTGTCTGG + Intergenic
1024774526 7:52767321-52767343 CAGTATCTAAATGTTGTGTCTGG + Intergenic
1024862388 7:53860853-53860875 CAGTATCTGCAATGTGTATCAGG - Intergenic
1025923228 7:65934626-65934648 CAGTATTTGCTTTCTGTGCCAGG + Intronic
1027300208 7:76826418-76826440 AAGTGTGTGCATGTTGTGACGGG - Intergenic
1028239783 7:88405497-88405519 CAGCATGTACATTGTATGTCTGG - Intergenic
1028860142 7:95640076-95640098 CAGCATGTGCATTATGTTTTGGG - Intergenic
1030063970 7:105644987-105645009 CAGTATTTGTCTTTTGTGACAGG - Intronic
1031046541 7:116894748-116894770 TAGTATTTGCCTTTTGTGACTGG + Intronic
1031559340 7:123218935-123218957 CAATATGTGGCCTTTGTGTCTGG - Intergenic
1031752547 7:125595202-125595224 CAATATGCGACTTTTGTGTCTGG + Intergenic
1031841070 7:126740184-126740206 CAGTATGTTAATTGTGTGACTGG - Intronic
1031882932 7:127217399-127217421 CTGCATGTGCTTTTTCTGTCTGG - Intronic
1032978503 7:137253331-137253353 CAGTCTGGTCACTTTGTGTCTGG + Intronic
1033506850 7:142011924-142011946 TAATATGTGCATCTTGAGTCAGG - Intronic
1033831936 7:145265474-145265496 CAGTATTTGTATTTTGTGACTGG + Intergenic
1036171859 8:6494638-6494660 CAACATGTGCTTTTTGTGTCTGG - Intronic
1036294376 8:7523669-7523691 GAGTTTGGGCATTTGGTGTCTGG + Intergenic
1036328186 8:7797322-7797344 GAGTTTGGGCATTTGGTGTCTGG - Intergenic
1037291423 8:17353181-17353203 CAGTATTTTCTTTTTGTGACAGG - Intronic
1038309876 8:26438256-26438278 CAGTACTTTCTTTTTGTGTCTGG - Intronic
1038630154 8:29234406-29234428 CAGTATTTATTTTTTGTGTCTGG - Intronic
1038871205 8:31495597-31495619 TAATATGTGGTTTTTGTGTCTGG + Intergenic
1039445413 8:37627525-37627547 CAGTGTGTACTTTTTGTGTCTGG - Intergenic
1040625048 8:49138023-49138045 CATTGAGTGAATTTTGTGTCAGG - Intergenic
1041036943 8:53801868-53801890 CAGTATGTGCAGTGCGTGGCCGG - Exonic
1043164744 8:76889693-76889715 CAATATGTGCAATTTGTGATTGG + Intergenic
1043172575 8:76983748-76983770 CAGTGTGTGAATTTTGTGATTGG - Exonic
1043465679 8:80504641-80504663 CAGTATGTGCATATTCTCTTAGG - Intronic
1045085073 8:98673503-98673525 CAATATGTGACTTTTGTGTCTGG - Intronic
1047155889 8:122318166-122318188 CAGTATGTACACTGCGTGTCTGG - Intergenic
1047169040 8:122472408-122472430 TAGTTTTTGCATTTGGTGTCAGG - Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049033847 8:140059217-140059239 CAGTGTGTACTTTCTGTGTCTGG + Intronic
1050054918 9:1641856-1641878 CAGCATGTGTCTTTTGTGACTGG + Intergenic
1051463625 9:17352807-17352829 CAATATGTGACCTTTGTGTCTGG + Intronic
1052266896 9:26584765-26584787 CAGTATTTGTCTTTTGTGTCTGG + Intergenic
1052699398 9:31920194-31920216 CAGAAGGTCAATTTTGTGTCAGG + Intergenic
1052735667 9:32339883-32339905 CAGTATGTGCTTTTTCTGTTTGG - Intergenic
1053119639 9:35537033-35537055 CAGTATTTGTGTTTTGTTTCTGG + Intronic
1053536351 9:38930442-38930464 CAGTATTTCCTTTCTGTGTCTGG + Intergenic
1054456973 9:65436955-65436977 CAGAATTTCCATTTTGTTTCAGG - Intergenic
1054629783 9:67433506-67433528 CAGTATTTCCTTTCTGTGTCTGG - Intergenic
1055385529 9:75758050-75758072 CAATATTTGTTTTTTGTGTCTGG + Intergenic
1056082276 9:83107965-83107987 CAGTGTGTACTTTTTATGTCTGG - Intergenic
1056233403 9:84569468-84569490 CAGCATGGGCACTTAGTGTCTGG + Intergenic
1056301037 9:85242223-85242245 GAGTATGTGCTTTTAGTGTGTGG - Intergenic
1057100188 9:92351924-92351946 CAGTATTTGCCTTTTTTGACTGG + Intronic
1057332013 9:94124030-94124052 CAGTATTTGTCTTTTGTGACTGG + Intergenic
1058326824 9:103708836-103708858 CAGTATGTGTATGTTGGGGCAGG + Intergenic
1059049959 9:110913645-110913667 CAGAATGTGCTTTTTGTTTGTGG - Intronic
1059163337 9:112055898-112055920 CAGTATTTTCTTTTTGTGACTGG - Intronic
1062643693 9:137535171-137535193 CAGTGTGTGCTTTTTGTTGCTGG + Intronic
1186222473 X:7364632-7364654 CAGTATGAGCCTTTTGAGACTGG - Intergenic
1186449783 X:9662456-9662478 CAGTATTTGCCTTTTGTGGCTGG - Intronic
1186519829 X:10195742-10195764 CAATGTGTGGACTTTGTGTCTGG + Intronic
1186966237 X:14789011-14789033 CAGTATGTACATTTAGAGTCAGG + Intergenic
1186986758 X:15024890-15024912 TAGTATGTACCTTTTGTGACTGG - Intergenic
1187178947 X:16924654-16924676 CAATATGTGTCCTTTGTGTCTGG + Intergenic
1187820491 X:23282848-23282870 CAGTGGATGCATTTTGTTTCAGG - Intergenic
1187936408 X:24340561-24340583 CAGTATGTGGCCTTTGTGTCTGG - Intergenic
1188407919 X:29835047-29835069 CAGCATCTGGATTTTGTTTCTGG - Intronic
1188495011 X:30774536-30774558 CAATATGTGGCCTTTGTGTCTGG + Intergenic
1189742797 X:44138157-44138179 CAGTATGTGACCTTTGTATCTGG - Intergenic
1189823552 X:44894196-44894218 CAGTATCTGGTTTTGGTGTCAGG + Intronic
1189831552 X:44979618-44979640 CAGTTTGTGCTTTTTGTGCTAGG + Intronic
1190032805 X:46990943-46990965 CAATACGTGCCCTTTGTGTCTGG + Intronic
1190057304 X:47188626-47188648 CATTATGTGTTTTTTGTGTCTGG - Intergenic
1190083010 X:47371530-47371552 CAGTATGTACCTTTTGGGACTGG + Intronic
1190105532 X:47558224-47558246 CAGTATTTCTCTTTTGTGTCTGG + Intergenic
1190463480 X:50702541-50702563 CAGTATGTGTTGTTTTTGTCTGG - Intronic
1190493750 X:51007494-51007516 CACTATGTGCCTTTTGGGTCTGG + Intergenic
1190500407 X:51071335-51071357 CTGTATCTGCTTTTGGTGTCAGG - Intergenic
1190591169 X:52003091-52003113 CAGTATTTGCTTTCTGTGTCTGG + Intergenic
1191730297 X:64326881-64326903 CTGTATATGCATTTTTTTTCTGG - Intronic
1191934748 X:66414721-66414743 CAGTATTTGTATTATGTGCCTGG + Intergenic
1192115301 X:68404813-68404835 CAGTATTTGTCTTTTGTGACTGG - Intronic
1192542022 X:71982216-71982238 CAGTATATGGGCTTTGTGTCTGG - Intergenic
1193881578 X:86929392-86929414 CAGTATTTGCATTTTCTTCCTGG - Intergenic
1194142699 X:90224104-90224126 CAGTATTTGCTTTCTGTGGCTGG - Intergenic
1195066939 X:101245649-101245671 TAGTATTTGCCTTTTGTTTCTGG - Intronic
1195294484 X:103462304-103462326 CAGTCTGTGCATTGTCTGCCAGG - Intergenic
1195304675 X:103569250-103569272 CAATATTTGTCTTTTGTGTCTGG - Intergenic
1195326600 X:103763530-103763552 AAGTATGTGCATCTGGTGTGAGG + Intergenic
1195573074 X:106418140-106418162 CAATATTTGTTTTTTGTGTCTGG + Intergenic
1196323724 X:114375699-114375721 CGGTAAGTGCCTTTTGTGTCTGG - Intergenic
1196733127 X:118961445-118961467 CAATATGTGGTTTTTGTATCTGG - Intergenic
1197111699 X:122782563-122782585 CAGTATTTGCCTTTTGTGACTGG - Intergenic
1197362614 X:125525034-125525056 CAGTATTTGACTTTTGTGACTGG + Intergenic
1197928961 X:131676232-131676254 CAATATGTCCCTTTTGTTTCAGG - Intergenic
1197967895 X:132084652-132084674 CATTAAGTGCATTTTCTATCAGG - Intronic
1198814201 X:140569994-140570016 CAGTATGTACTTTTTTGGTCTGG - Intergenic
1198997396 X:142589490-142589512 CAGTATTTGCATGTTGAGGCTGG + Intergenic
1199050351 X:143229725-143229747 CAGCATTTGCATTCTGTGCCTGG + Intergenic
1199854197 X:151746563-151746585 CAGTATTTGTCCTTTGTGTCTGG + Intergenic
1200488456 Y:3793207-3793229 CAGTATTTGCTTTCTGTGGCTGG - Intergenic