ID: 993971341

View in Genome Browser
Species Human (GRCh38)
Location 5:94423178-94423200
Sequence CTGGGGGGTTGGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 10, 3: 112, 4: 965}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993971325_993971341 27 Left 993971325 5:94423128-94423150 CCTATAGTTTTCGGCTCTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG 0: 1
1: 0
2: 10
3: 112
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993971341 Original CRISPR CTGGGGGGTTGGAGGGATGA AGG Intronic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183839 1:1324096-1324118 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183880 1:1324192-1324214 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900204717 1:1427059-1427081 GGGGGGAGATGGAGGGATGAAGG - Intronic
900402619 1:2478781-2478803 CTGTGGGGTAGGAGGGATCCAGG + Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900459911 1:2798110-2798132 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459941 1:2798199-2798221 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900459977 1:2798295-2798317 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460024 1:2798439-2798461 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460066 1:2798575-2798597 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460101 1:2798679-2798701 CTGGGGGGCTGGGGAGCTGAGGG - Intronic
900460116 1:2798727-2798749 CTGGGAGGCTGGGGGGCTGAGGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900825183 1:4920630-4920652 CTGGGGGCTTGAACAGATGATGG + Intergenic
900993071 1:6106816-6106838 ATGGAGGGGTGGAGGGATGGAGG + Intronic
900993112 1:6106928-6106950 GTGGAGGGGTGGAGGGATGGAGG + Intronic
900993132 1:6106984-6107006 GTGGAAGGATGGAGGGATGATGG + Intronic
900993146 1:6107036-6107058 ATGGAGGGATGGAGGAATGATGG + Intronic
900993191 1:6107192-6107214 ATGGAGGGATGGAGGGATGATGG + Intronic
900993197 1:6107211-6107233 ATGGAGGGATGGAGGGATGATGG + Intronic
900993209 1:6107260-6107282 ATGGAGAGATGGAGGGATGATGG + Intronic
900993232 1:6107366-6107388 ATGGAGAGATGGAGGGATGATGG + Intronic
900993245 1:6107409-6107431 ATGGAGGGATGGAGGGATGATGG + Intronic
900993296 1:6107634-6107656 ATGGAGGGATGAAGGGATGATGG + Intronic
900993311 1:6107702-6107724 ATGGAGAGATGGAGGGATGATGG + Intronic
900993321 1:6107746-6107768 ATGGAGAGATGGAGGGATGATGG + Intronic
900993327 1:6107765-6107787 ATGGAGGGATGGAGGGATGATGG + Intronic
900993346 1:6107851-6107873 ATGGAGGGATGGAGGGATGATGG + Intronic
900993378 1:6107963-6107985 ATGGAAGGATGGAGGGATGATGG + Intronic
900993386 1:6107989-6108011 GATGGGGGATGGAGGGATGAAGG + Intronic
900993407 1:6108047-6108069 ATGGAGGGATGGAGGGATGGAGG + Intronic
900993409 1:6108055-6108077 ATGGAGGGATGGAGGGATGATGG + Intronic
900993413 1:6108074-6108096 ATGGAGAGATGGAGGGATGATGG + Intronic
900993427 1:6108131-6108153 ATGGAGGGATGGAGGAATGATGG + Intronic
900993446 1:6108193-6108215 GTGGAGAGATGGAGGGATGATGG + Intronic
900993456 1:6108236-6108258 ATGGAGGGATGGAGAGATGACGG + Intronic
900993535 1:6108591-6108613 GTGGAAGGATGGAGGGATGAAGG + Intronic
900993622 1:6108914-6108936 ATGGAGGGATGGAGGGATGAAGG + Intronic
901393450 1:8963396-8963418 GTGGAGGGGTGGAGGGGTGAGGG - Intronic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
902497466 1:16883702-16883724 TTGGGGGGTGGGAGGGGGGAAGG + Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902635680 1:17733643-17733665 GTGGAGGGTTAGAGGGATGGAGG - Intergenic
902838391 1:19060583-19060605 GTGGGGGGTGGGGGGGATGGTGG - Intergenic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903474994 1:23613411-23613433 CTAGGGGGCAGGAGGGATGAGGG + Intronic
903662008 1:24984106-24984128 CTGGGTGGGTTCAGGGATGAGGG + Intergenic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
903754959 1:25654135-25654157 GTTGGGGGATGAAGGGATGAAGG - Intronic
903868163 1:26412952-26412974 ATGGGGGGTTGGGGGAATAAGGG - Intronic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
904487969 1:30840116-30840138 ATGGGTGGGTGGATGGATGATGG + Intergenic
904507162 1:30966969-30966991 TTGGGGGGTTGGTGGGTTGGGGG - Intronic
904810471 1:33160305-33160327 CTTGGGGGTAGGAGGGATGAGGG + Intronic
904933290 1:34107632-34107654 GTGGGTGGGTGGATGGATGAAGG + Intronic
905170422 1:36106633-36106655 CTGGGGGTTGGGAGTGATGGAGG + Intronic
905178932 1:36155227-36155249 CTGGGAAGGTGGATGGATGATGG - Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905301469 1:36989018-36989040 CTGGGGAGGTGGTGGGTTGAAGG - Intronic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905441680 1:38000140-38000162 CAGCGGGGGTGGGGGGATGAGGG - Intronic
906259739 1:44377949-44377971 TTGAGGGGTTGGAGGGGTGATGG + Intergenic
906683636 1:47748460-47748482 CTGGGAGGCTGGAGAGATGAGGG + Intergenic
907111352 1:51929189-51929211 GTGGGGAGTTAGAGGGATGATGG - Intronic
907303275 1:53501190-53501212 CTGGTGGGCTGAAGGGATGGGGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907778140 1:57538857-57538879 CTGGAGGGTTGGAGAGTTGTAGG - Intronic
908316842 1:62941038-62941060 CAGGAGGGTTGGAAGGGTGATGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
910169127 1:84359015-84359037 CCTGGGGGTTGGAGGGAGCATGG + Intronic
912319128 1:108693350-108693372 CGGGTGGGGTGGGGGGATGAGGG + Intronic
912366359 1:109137036-109137058 CTGGTGAGTTTGAGGGGTGAAGG + Intronic
912410924 1:109480287-109480309 CTGGTGGGTGGGAGGATTGAGGG - Exonic
912419192 1:109531956-109531978 CTGGGTGGGTGGAGGGATACAGG - Intergenic
912431503 1:109630566-109630588 TTGGGGGGTTGGGGGGATGGGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
914351361 1:146842974-146842996 ATGGGTGGGTGGATGGATGATGG + Intergenic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
915017307 1:152746015-152746037 GTGGGGGGCAGGAGGGATCATGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915378754 1:155422017-155422039 ATTAGGGGTTGGAGGGAGGATGG - Intronic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
915519126 1:156431036-156431058 CTGGGGGGTTGATGGGAGGGGGG + Intergenic
915553039 1:156646299-156646321 CTGGTGGGTTGGAGAAATCATGG + Intronic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
915755013 1:158250947-158250969 ATGGGGGTTAGGAGTGATGACGG + Intergenic
915895155 1:159806382-159806404 TTGGGTGGTTGGATGGCTGATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916982181 1:170150165-170150187 CTAGGCAGTTGGAGGGAGGAAGG - Intronic
917454798 1:175177090-175177112 CTGGGAGGTAGGGGGGATGGTGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
919365126 1:196650308-196650330 CACGGGGGCTCGAGGGATGAGGG - Intergenic
919766663 1:201131871-201131893 ATTGGGGGTTGGAGAAATGATGG + Intergenic
919775551 1:201191978-201192000 CTGAGGGGTGGGTGGGATGGGGG + Intronic
919857303 1:201714582-201714604 CTGGGGGCTTGGGGCTATGAGGG - Intronic
919858307 1:201720480-201720502 CAGGTGGGTTGGTGGGGTGAAGG - Intronic
919927718 1:202200914-202200936 CTGGCGGGTTGGAGGGGAGCTGG + Intronic
919935156 1:202246162-202246184 GTGGAGGGATGGAGGGATGGGGG - Intronic
919935202 1:202246283-202246305 GTGGAGGGATGGAGGGATGGGGG - Intronic
920205391 1:204287406-204287428 TTTGGAGGTTGAAGGGATGAGGG + Intronic
920273946 1:204789967-204789989 CTGGTGGGTGGCAGGGAGGAAGG + Intergenic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922672785 1:227525624-227525646 GTGGGGGGCTAGAGGGATGTGGG - Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922794948 1:228335309-228335331 GTGGGGGGATGGGGGGATGGGGG + Intronic
923000795 1:230004963-230004985 CTGCGGGGTTGGGGGTGTGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923450891 1:234116473-234116495 ATGGGGGGTGGGAGGGAGGGTGG - Intronic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924795769 1:247291261-247291283 CTGGGGTGATGGAGGGGTGAGGG - Intergenic
924938400 1:248791722-248791744 CTGGGAGGTTGCAAGGATGATGG - Intergenic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1062947492 10:1472528-1472550 CTGGGGACTTGGAGGTATGCTGG + Intronic
1062974364 10:1672583-1672605 CGCGGGGCTTGGAGGGAGGAAGG - Intronic
1064498727 10:15944587-15944609 CTGGGGTGCTGGAGGGATTGAGG - Intergenic
1064643313 10:17435703-17435725 ATGGGGGGTTGGGGGGGTGGGGG + Intronic
1064670961 10:17713500-17713522 CTCGGGGGTGGGAGGGGTGTGGG - Intronic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1066004527 10:31134238-31134260 AGGGGGGGTGGGGGGGATGAGGG + Intergenic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1067053466 10:43038327-43038349 CTGGGAGGGTGGAGGGAGGCGGG + Intergenic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067945534 10:50686065-50686087 GTGGGTGGTGGGAGGGATCAGGG - Intergenic
1068079525 10:52302707-52302729 CTAGGGGGATGGAGGGACGGAGG - Intergenic
1068866203 10:61897730-61897752 GTGGGGGGGTGGATGGCTGAGGG + Intergenic
1069337203 10:67366204-67366226 GTCGGGGGTTGGGGGGCTGAGGG + Intronic
1069776090 10:70928098-70928120 CTGGGGGTTTAGAGAGAGGAGGG + Intergenic
1069935071 10:71909797-71909819 CTTGGAGGTTAGAGGGAAGATGG + Intergenic
1070630455 10:78081034-78081056 CTGGAGCGATGGTGGGATGAGGG + Intergenic
1070749983 10:78958384-78958406 CTGGGTGTTTGGGGGAATGAAGG - Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1070828813 10:79406400-79406422 CAGGGGGGTCGCAGGGAGGAAGG + Intronic
1070877167 10:79825715-79825737 CTGGGGAGTTGGGGAGACGATGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071461189 10:85897863-85897885 GTGGGGGGTTGGGGAGATGGTGG - Intronic
1071518676 10:86315658-86315680 GTGGGAGGATGGATGGATGAAGG - Intronic
1071633959 10:87235161-87235183 GTGGGTGGTGGGAGGGATCAGGG - Intronic
1071647407 10:87367378-87367400 GTGGGTGGTGGGAGGGATCAGGG - Intronic
1071766655 10:88673899-88673921 CTGGGGTGATGGAAGGATGCTGG - Intronic
1072174328 10:92901890-92901912 CTGGGGGGTTGGTGGGGGGTGGG + Intronic
1072539893 10:96390331-96390353 ATAGGGGGATGGAGGGATCAAGG + Intronic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1072799185 10:98380984-98381006 CTGGGGGCTTGGAGGAACCAAGG + Intergenic
1072881841 10:99235906-99235928 TTGGGGGGGTGGTGGGAGGAAGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073615452 10:104990571-104990593 CTGGGGAGTTGGAGGGGTTCAGG - Intronic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1075090752 10:119442902-119442924 ATGGATGGTTGGATGGATGATGG + Intronic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076461334 10:130649472-130649494 CTGGGTGGATGGAGGTATCATGG - Intergenic
1076581892 10:131517375-131517397 CTCTGGGGCTGGATGGATGAGGG + Intergenic
1076658422 10:132039396-132039418 CTTGGGGGTTGCAGGTATGGGGG - Intergenic
1076760997 10:132605574-132605596 CTGGTGGGATGGTGGGATGGTGG + Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077283139 11:1754427-1754449 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077283161 11:1754504-1754526 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283171 11:1754529-1754551 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077297710 11:1833915-1833937 CTGGGGGGCTGCAGAGGTGAGGG + Intronic
1077895103 11:6448334-6448356 TTGTGGGGTTGGGGGGGTGAGGG - Intergenic
1079071928 11:17354514-17354536 TTGGGGGGTCGGAGGGAGAAGGG - Intronic
1079108373 11:17588901-17588923 CTGTGGGGTTGCAGGATTGAGGG - Intronic
1079949339 11:26782934-26782956 CAATGGGGTGGGAGGGATGAAGG - Intergenic
1080291190 11:30673602-30673624 TTGGGGGGTTGGAGCCAAGATGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080596514 11:33778334-33778356 CTGGGGGCTGGGATGGATGGTGG + Intergenic
1081215531 11:40392122-40392144 CTAGGGGTTTGTGGGGATGAGGG + Intronic
1081615438 11:44587969-44587991 CTGGGTGGATGCAGGGATGGAGG - Intronic
1081629960 11:44682340-44682362 ATGGGTGGATGGATGGATGATGG - Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081872677 11:46390726-46390748 CTAGGGGCTTGGAGGGAGGGCGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083201252 11:61122356-61122378 GTGGGTGGGTGGATGGATGATGG + Intronic
1083302301 11:61745499-61745521 ATTGGGGGTGGGAGGGAGGAAGG - Exonic
1083707754 11:64528117-64528139 CTGGTTGGTTGAAGGGATCATGG - Intergenic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084413445 11:69016884-69016906 GTGGGTGGATGGATGGATGATGG - Intergenic
1084596322 11:70119011-70119033 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596366 11:70119214-70119236 ATGGGTGGGTGGAGGAATGATGG + Intronic
1084596393 11:70119309-70119331 ATGGGTGGGTGGATGGATGATGG + Intronic
1084776320 11:71379143-71379165 ATGGGGTGATGGATGGATGATGG + Intergenic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085406878 11:76268703-76268725 ATGGGTGGATGGATGGATGATGG - Intergenic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085464273 11:76713500-76713522 GTGGGAGGGTGGATGGATGATGG + Intergenic
1085690327 11:78658997-78659019 GTGGGTGGATGGATGGATGAAGG - Intronic
1085759016 11:79225798-79225820 ATGATGGTTTGGAGGGATGATGG + Intronic
1085810726 11:79678609-79678631 ATGGCGGGATGAAGGGATGAAGG - Intergenic
1086418973 11:86619038-86619060 ATGGCGGGTTGGGGGGAAGAAGG - Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1086730716 11:90245616-90245638 TTGGGAGGCTGGATGGATGATGG - Intergenic
1087096138 11:94320098-94320120 GTTGTGGGTTGGAGGGATGGGGG + Intergenic
1087619230 11:100523302-100523324 CTTGGGGGTAGGAGTGATGTGGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089202497 11:116732845-116732867 CTGGAGGGTAGGAAGCATGAAGG + Intergenic
1089541991 11:119194836-119194858 CTGGGGGATTGGAGAGTTGGAGG - Intronic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090562647 11:127949168-127949190 GTGGGAGGTTGGAGGGAGGGAGG - Intergenic
1090856367 11:130612382-130612404 CTCTTGGGGTGGAGGGATGAGGG - Intergenic
1090984484 11:131753742-131753764 TGGGGTGGTTGGAGGGGTGAGGG + Intronic
1091036653 11:132240034-132240056 ATGGAGGGATGGACGGATGATGG - Intronic
1091187346 11:133658421-133658443 GTGGGTGGATGGATGGATGATGG + Intergenic
1091212938 11:133879244-133879266 TAGGGTGGTTGGAGGGGTGAGGG - Intergenic
1091585199 12:1811882-1811904 CTGGGGAGTGGGAGGGGTGGGGG + Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092079521 12:5703786-5703808 TTGGGAGGTTGAAGGGCTGATGG - Intronic
1092128388 12:6091281-6091303 ATGGGGGGTGGGTGGGAGGAGGG + Intronic
1092954543 12:13537700-13537722 CTGGGTGGCTGGAGGGGTTAGGG - Exonic
1093046859 12:14456557-14456579 CTGGTGGGTTGGGTGGATGCTGG - Exonic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1094079702 12:26520001-26520023 CTGGGAGGTAGGTGGGAGGATGG + Intronic
1095118643 12:38385897-38385919 CTGGGAGGCTTGAGGGATCATGG - Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096385932 12:51195575-51195597 GTGGAGGGGTGGAGGGATGGAGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096580168 12:52579937-52579959 CTTGGGGGTTCCAGTGATGAGGG - Intergenic
1096789060 12:54034025-54034047 AGGGGGGGTTGGGGGGAAGAGGG - Intronic
1097053449 12:56237082-56237104 CTGGTGGGTGGCATGGATGAGGG + Intronic
1097169099 12:57102558-57102580 CAGGCAGGTGGGAGGGATGAAGG - Intronic
1097861917 12:64526455-64526477 CTGGGGGTTGGGAGGGGTTAGGG - Intergenic
1097926936 12:65139276-65139298 TTTGGGGGATGGAGGGATGGGGG - Intergenic
1098186922 12:67906545-67906567 CTGGGGGTTTGGGGAGATGTTGG - Intergenic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101212326 12:102546878-102546900 CTGAGGGGTTCCAGGGATGTGGG + Intergenic
1101240651 12:102834847-102834869 CTGAGAGGTTGGAGGAATGGAGG + Intergenic
1101662043 12:106774605-106774627 CTGGCGGGTTGGAGGCAGGACGG + Intronic
1102191681 12:110993470-110993492 CTGGGGTGAGGGAGGGGTGAGGG - Intergenic
1102596140 12:113993902-113993924 GTAGGGGGTGGGAGGGAGGAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103012784 12:117470068-117470090 ATGGGTGGATGGATGGATGAAGG - Intronic
1103012814 12:117470277-117470299 ATGGGTGGATGGATGGATGAAGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103444843 12:120988060-120988082 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444860 12:120988123-120988145 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444893 12:120988249-120988271 GTGGGTGGGTGGATGGATGATGG - Intronic
1104437444 12:128767105-128767127 GCTGGGGGTGGGAGGGATGAAGG + Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104778430 12:131404735-131404757 GTGGGTGGGTGGATGGATGATGG - Intergenic
1104778450 12:131404809-131404831 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778506 12:131405026-131405048 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778521 12:131405088-131405110 TTGGGTGGATGGATGGATGATGG - Intergenic
1104778535 12:131405139-131405161 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778550 12:131405194-131405216 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104778581 12:131405310-131405332 ATGGGTGGATGGATGGATGATGG - Intergenic
1104896088 12:132164541-132164563 GTGGGTGGGTGGACGGATGATGG - Intergenic
1104896304 12:132166644-132166666 GTGGGTGGATGGATGGATGATGG - Intergenic
1104896432 12:132167125-132167147 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104963693 12:132499704-132499726 CTGGGGGGCTGCAGGGCTGGGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106184697 13:27399140-27399162 CTGGGCTGGTGCAGGGATGAAGG + Intergenic
1106325797 13:28688244-28688266 CTGGGGGGTGGGAGGGCTGGGGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1108462332 13:50678804-50678826 CCCGGGGGTGGGAGGGATGGTGG + Intronic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1109351532 13:61188586-61188608 CTAAGGGATTGGAGGGGTGATGG + Intergenic
1111951153 13:94710780-94710802 GTTGGGGGTTGGGGGGCTGAGGG + Exonic
1112821251 13:103338805-103338827 CTGGCGTGGTGGAGGGATGAAGG - Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1114164590 14:20207820-20207842 CTGGGAGGTTGGGGAGATGTTGG - Intergenic
1114220175 14:20689337-20689359 CTGGCAGGTTGAAGGGAAGAAGG + Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1115172910 14:30528979-30529001 CTGGGGGCTTGGAGGGTTTATGG + Intergenic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116436129 14:44897251-44897273 CGGGGGGGTTGGGGGGAGGGGGG + Intergenic
1117252045 14:53947938-53947960 CTGGGGGGTTGGAGGGGTGGGGG + Intergenic
1117312571 14:54542639-54542661 CTGGGAGGATGGAGGGATTGGGG - Intergenic
1117327278 14:54681181-54681203 TTGGGGGGTTGGGGGGCTGGGGG - Intronic
1117455049 14:55888620-55888642 ATGGGGTGTTGGAGGGATTGGGG - Intergenic
1117567881 14:57014973-57014995 GTGGGGGGTTGGGGGGGTGCAGG - Intergenic
1118722247 14:68602471-68602493 GTGGGTGGGTGGATGGATGATGG + Intronic
1118859527 14:69651702-69651724 TTGGGGGGTAGGAGGCATTAAGG + Intronic
1119364950 14:74084024-74084046 GTGGGCGGATGGAGAGATGAGGG + Intronic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1121016781 14:90553707-90553729 CTGGGGCCTTGGAGGCATGGCGG + Intronic
1121077890 14:91084530-91084552 CTAGGGGGTGGGAGGGATGGAGG - Intronic
1121096573 14:91221537-91221559 GTGGGTGGATGGAGGGATGGAGG + Intronic
1121285139 14:92729314-92729336 GTGGGGGGTTGCATGGATAATGG - Intronic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121710754 14:96037999-96038021 CTGGGAGGTGGCAGGAATGATGG + Intergenic
1121735452 14:96214679-96214701 CTTGGAGGCTGGAGAGATGAGGG - Intronic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1121799349 14:96760716-96760738 CTGGGTGGGTGGATGAATGATGG + Intergenic
1122207459 14:100155116-100155138 GTGGAATGTTGGAGGGATGATGG - Intronic
1122349277 14:101078140-101078162 CTGGGGGGGGGGGGGGGTGAGGG + Intergenic
1122646817 14:103200093-103200115 CTTGGAGGTTGGAGGCAAGATGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122958315 14:105083072-105083094 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958337 14:105083153-105083175 ATGGGTGGATGGATGGATGATGG - Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124438994 15:29673811-29673833 CTTGGGGGTTGGAAGCAAGATGG + Intergenic
1124759884 15:32440219-32440241 GTGGGGGGCGGGAGGGATGGCGG - Intergenic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1124975134 15:34523611-34523633 GTGGGGGGCGGGAGGGATGGCGG - Intergenic
1125537896 15:40453080-40453102 CTGTCGGGTTGGAAGGATGGGGG + Intronic
1125765143 15:42130645-42130667 CTGGGGGGTCTGAGGCATGGAGG - Intergenic
1125770948 15:42165598-42165620 CTTGGGGATTGGAAGGATGAGGG - Intronic
1127557737 15:60104566-60104588 TTGGGGGGTTGGGGGGTTGGGGG + Intergenic
1128324010 15:66711808-66711830 CTGGAGGGCTGGAGGGCTGGAGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128654667 15:69451980-69452002 CTTGGGGGAAGGAGGGATTATGG - Intergenic
1128793557 15:70449691-70449713 ATGGGTGGTTAGAGGGATGGAGG + Intergenic
1128793601 15:70449815-70449837 GTGGAGGGATGGAGGGATGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1129149892 15:73681962-73681984 GTGGGGGGTGGGAGGGATAGAGG + Intergenic
1129170701 15:73805836-73805858 CTGGTGGGTGGGAGGGTGGATGG - Intergenic
1129210559 15:74065631-74065653 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129403452 15:75299698-75299720 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1129727759 15:77910268-77910290 GTGGGGGGTGGGAGGGATGGCGG - Intergenic
1129840118 15:78738592-78738614 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130246442 15:82254301-82254323 CTGAGAGGTTGGAGAGGTGAAGG - Intronic
1130282546 15:82531235-82531257 GTGGAGGGTGGGAGGGATGGCGG + Intergenic
1130643936 15:85706939-85706961 GTGGGGGACTGGAGTGATGATGG - Intronic
1131232588 15:90670529-90670551 TTGGGGAATTGGAGGCATGAGGG + Intergenic
1131969388 15:97876494-97876516 CTGGTGGGTTGGTGGGTTGGTGG - Intergenic
1132034032 15:98465176-98465198 CTAGGGGGTTGGAGGGTGAAGGG + Intronic
1132185218 15:99797656-99797678 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1132232354 15:100193459-100193481 CTGGGGCCTTGGAGGCATGGCGG + Intronic
1132310204 15:100851908-100851930 GTGGGGGGTTGGGGTGATGTTGG + Intergenic
1132431770 15:101766899-101766921 GTGGGGGGTGGGAGGGATGGAGG - Intergenic
1132667430 16:1088636-1088658 CTGGAAGGTTGGCGGGATGCAGG + Intergenic
1132681900 16:1145869-1145891 CCTGAGGGTTGGAGGGGTGACGG + Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133204868 16:4227230-4227252 GTGGGTGGATGGATGGATGAAGG + Intronic
1133305433 16:4805198-4805220 AGGGGGGATTGGAGGGGTGAGGG + Exonic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133976177 16:10601257-10601279 GCTGGGCGTTGGAGGGATGAAGG + Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134106984 16:11492310-11492332 ATGGGTGGGTGGATGGATGATGG - Intronic
1134112502 16:11524152-11524174 TTGGGGGGTTGGGGGGTGGATGG - Intergenic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134224406 16:12380392-12380414 GTGGGTGGGTGGATGGATGAGGG - Intronic
1134224790 16:12381607-12381629 GTGGGTGGGTGGATGGATGATGG - Intronic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1134798658 16:17064855-17064877 CTTGGGGGCTGGAGTGGTGAGGG - Intergenic
1134820024 16:17239468-17239490 GTGGGTGGATGGATGGATGATGG - Intronic
1135621807 16:23962332-23962354 GTGGGGGTTGGGACGGATGAGGG - Intronic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1136071417 16:27789822-27789844 ATGGGTGGATGGATGGATGAAGG + Exonic
1137386122 16:48044101-48044123 ATGGGTGGTTGGATGGATGGTGG - Intergenic
1137676774 16:50307573-50307595 CTGGTGGGGTATAGGGATGAGGG + Intronic
1138033575 16:53580286-53580308 CTGGGGGTTGGGAGTGCTGAAGG - Intergenic
1138249934 16:55494078-55494100 CTGGCTGGCTGGATGGATGATGG - Intronic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138511825 16:57513145-57513167 CTGGGCGGTTAGAGAGGTGAAGG + Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139413553 16:66786903-66786925 CTGGGTGGTTGTAGGGCTCAAGG - Intronic
1139660338 16:68416442-68416464 CAGGAGGGTAGGAGGGATTAGGG - Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1140274518 16:73496799-73496821 CTGGGGGGTGGGAGTGAGGGAGG + Intergenic
1140697249 16:77547402-77547424 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141155380 16:81593370-81593392 CTGGGGGGTTGGAGGGCGGGGGG + Intronic
1141271781 16:82547493-82547515 CTGGGGAGCGGGAGGGATCAAGG + Intergenic
1141483748 16:84325084-84325106 ATGGATGGATGGAGGGATGAAGG - Intronic
1141642383 16:85348866-85348888 CTCGGGGGCTGGAGGGAGGGAGG - Intergenic
1142399756 16:89852633-89852655 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399781 16:89852713-89852735 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399796 16:89852753-89852775 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399811 16:89852793-89852815 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399841 16:89852873-89852895 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399870 16:89852953-89852975 CCGGGGGGTGAGAGGGAGGATGG - Intronic
1142539572 17:647666-647688 GTGAGGGGTAGGAAGGATGAGGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1143352842 17:6301593-6301615 CTGGAGGGTGAGAGGCATGAGGG - Intergenic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144276438 17:13672844-13672866 CTAGGGGGTTGGAATGATCAAGG - Intergenic
1145959649 17:28879960-28879982 CTGGGGCCTTGGGTGGATGAGGG + Exonic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1147444236 17:40465101-40465123 CTGGGTGGCTGCAGGGCTGAAGG + Intergenic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1148215263 17:45830650-45830672 CTGGGGGGCCTGAGGGATGGAGG + Intronic
1148251941 17:46089479-46089501 GTGGGAGATTGGAGGGATGGTGG - Intronic
1148346110 17:46904498-46904520 ATGGGTGGCTGGACGGATGATGG + Intergenic
1148695023 17:49553622-49553644 TGAGGGGGTGGGAGGGATGATGG - Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1151013725 17:70531022-70531044 GTGGGGGGGTGGAGGGGTGGAGG + Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151351306 17:73533678-73533700 CTGGGGGGGTGGGGGGGTGGGGG - Intronic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1151813927 17:76461732-76461754 CTGGGGGGCTGGATGGCTGTTGG + Intronic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151870533 17:76833627-76833649 GTGAGGGGTTGGGGGGATGGTGG + Intergenic
1151885800 17:76922759-76922781 CAGGAAGGTTGGAGGGATGGAGG + Intronic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152012566 17:77727373-77727395 CTGAGGGGCTTGAGTGATGATGG - Intergenic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152401008 17:80066105-80066127 CTGGGTGGTTTTAGGAATGAAGG - Intronic
1152443163 17:80322139-80322161 AGGGGGGGTGGGGGGGATGAGGG - Intronic
1152473658 17:80503879-80503901 AGGGAGGGGTGGAGGGATGATGG + Intergenic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152550811 17:81029032-81029054 CTGGGGGGATGGGGGGGTGGCGG - Intergenic
1152565578 17:81098965-81098987 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565583 17:81098973-81098995 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565588 17:81098981-81099003 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152630396 17:81408382-81408404 CTGGGGGGTGGGAGGCAGGTGGG - Intronic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1153083368 18:1254872-1254894 TTGGGGGGTGGGCGGGATGTGGG + Intergenic
1153120683 18:1722835-1722857 CTGGGGCCTTGGAGGGTTGGGGG - Intergenic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1154336704 18:13471642-13471664 TGGGGAGGGTGGAGGGATGACGG + Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1155083122 18:22430085-22430107 TTGGTGGGATGGAGGGGTGAAGG + Intergenic
1156352356 18:36311996-36312018 CTGGGAGGCTTGAGGGTTGAAGG - Intronic
1156403855 18:36765123-36765145 GATGGGGGTTGGAGGGAGGAAGG + Intronic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157751515 18:50182836-50182858 GTGGGGGGTTGGGGGGTTGTAGG + Intronic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1158483468 18:57843556-57843578 GAAGGGGGCTGGAGGGATGAGGG + Intergenic
1159183190 18:64937158-64937180 ATGGGGGGTTGGGGGGAGTAGGG - Intergenic
1159906517 18:74097393-74097415 TTGGGGGGTTGGGAGGATGAGGG + Intronic
1160290019 18:77583717-77583739 GTTGGGGGTTGGAGGGCTGGGGG + Intergenic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160526551 18:79542048-79542070 GTGGGTGGATGGATGGATGAAGG - Intergenic
1160536497 18:79597272-79597294 ATGGCGGGTTTGAGGGATGGGGG + Intergenic
1160706086 19:531083-531105 CTGAGGGGTGGGAGGGGCGAGGG - Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160816660 19:1039138-1039160 CTTGGGGGATGGGGGGATCAAGG + Intergenic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1160969724 19:1762240-1762262 CAGGAGGGTTGGAGGGCTGGCGG - Intronic
1161105286 19:2440809-2440831 CTGGATGGGTGGACGGATGATGG - Intronic
1161129826 19:2581304-2581326 CCGCGGGGGTGGAGGGGTGATGG + Intronic
1161218240 19:3105391-3105413 TTGGGGGGTTGGGGGGAAGGGGG + Intronic
1161227674 19:3154644-3154666 ATGGGTGGGTGGATGGATGATGG + Intronic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161287293 19:3475445-3475467 GTGGGTGGGTGGATGGATGATGG + Intronic
1161287572 19:3476892-3476914 GTGGGTGGGTGGATGGATGATGG + Intronic
1161329175 19:3678274-3678296 ATGGAGGGGTGGAGGGATGGAGG + Intronic
1161329178 19:3678282-3678304 GTGGAGGGATGGAGGGATGGAGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1161569511 19:5022827-5022849 GGGGGGGCTTGGAGGGATGTGGG + Intronic
1161681463 19:5681764-5681786 ATGGGTGGATGGATGGATGATGG - Intronic
1161934492 19:7363260-7363282 CTGGGTGGATGAATGGATGACGG + Intronic
1162085912 19:8249017-8249039 ATGGGTGGATGGATGGATGATGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162929732 19:13951957-13951979 TGGGCGGGTTGGTGGGATGATGG - Intronic
1162954535 19:14090868-14090890 CGTGGGGGTGGGAGGGAGGAAGG - Intronic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163508329 19:17720913-17720935 CTGGTGGGAAGGAGGGATCAAGG - Intronic
1163571277 19:18083788-18083810 ATGGTGGGGTGGATGGATGATGG - Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1164656543 19:29925987-29926009 CTGGGGGGAGGAAGGGATGGTGG + Intronic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1164919625 19:32079080-32079102 CTTGGAGGTGGGAGGTATGATGG - Intergenic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165148833 19:33749430-33749452 GTGGGGAGATGGGGGGATGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165699320 19:37925469-37925491 CAGGAGAGTGGGAGGGATGAGGG + Intronic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1165787119 19:38468309-38468331 ATGGTTGGTTGGATGGATGAGGG - Intronic
1165815367 19:38638723-38638745 CTAGGGGGTTGGGGGAATGCAGG + Intergenic
1165901751 19:39172594-39172616 CTGAGGGGTTTGGGGGAGGAAGG - Intronic
1165922122 19:39305661-39305683 TTGGGGGGATGGAGGGACTACGG + Intergenic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166047695 19:40238995-40239017 GTGGGAGGTGGGAGGGAGGAGGG + Intronic
1166053393 19:40274463-40274485 TTGGGGAGTTGGGGGAATGAGGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166381481 19:42357390-42357412 CTGGGGGGCCTGAGGGATGGAGG - Exonic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1167042071 19:47028285-47028307 CTGGGGGGCTGGGGGGTTGACGG - Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167669029 19:50839081-50839103 CTGGGGGGTTTAAGGGAGGTGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1168152026 19:54454501-54454523 GTGGGGGATTTGAGGGCTGAGGG - Exonic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168370629 19:55831104-55831126 CGGGGGGGTGGGGGGGATGGGGG - Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925347763 2:3182906-3182928 CTGGATGGGTGGATGGATGATGG - Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
927622873 2:24680576-24680598 TGGGGGGATTGGAGGGATGTTGG + Intronic
927675632 2:25103830-25103852 CTGGGGGGTGGCAGGGGAGAGGG + Intronic
928259438 2:29753582-29753604 CTAGGGAGTTGGAGGGATTAAGG + Intronic
929215617 2:39408658-39408680 GTGGGGGGTTGGGTGGGTGAAGG + Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930243200 2:48957105-48957127 TGGGGTGGTTGGAGAGATGATGG + Intergenic
930802729 2:55459597-55459619 CTTGGAGGTTGGAGGCAAGATGG - Intergenic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931088174 2:58857148-58857170 CAGGAGGGATGGAGAGATGAAGG + Intergenic
931235891 2:60412457-60412479 CTGGGGCCTGGGAGGGATGGGGG - Intergenic
931241972 2:60461792-60461814 CCGGGGGCTGGGAGGGAGGAGGG + Exonic
931867978 2:66432482-66432504 GTGGGGGGGTGGGGGGATGGGGG + Intergenic
932006903 2:67936527-67936549 CTGGGGGGATGGGGGGCTAAGGG + Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
932795855 2:74695509-74695531 GTTGAGGGTTGTAGGGATGAGGG - Intergenic
933316908 2:80726743-80726765 GTGGGGGGTGGGGGGGATGTAGG - Intergenic
934040524 2:88124378-88124400 TTTGGGGGTTGGAGGGTGGAGGG + Intronic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934706433 2:96484837-96484859 GTGGAGGGTAGGAGGGAAGATGG - Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934884764 2:98014618-98014640 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
934884775 2:98014649-98014671 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
934884788 2:98014688-98014710 CTGGTGGGTTGGTGGGCTGGTGG - Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935153671 2:100463115-100463137 TTGGGGGGTGGGTGGGGTGAGGG - Intergenic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935315971 2:101834197-101834219 ATGGAGGGATGGAGGGATGGAGG - Intronic
935315974 2:101834205-101834227 ATGGAGGGATGGAGGGATGGAGG - Intronic
935639384 2:105276328-105276350 CTTGGGGGTAGAAAGGATGACGG + Intronic
935671560 2:105561065-105561087 ATGGGGAGTGGGAGGGATGGGGG - Intergenic
935782293 2:106518909-106518931 GTGGAGGGATGGAGGGATGGAGG - Intergenic
935969784 2:108519526-108519548 CTGGGGGGTGGGAGGGTTTGGGG + Intergenic
936501128 2:113067180-113067202 ATGGATGGTTGGATGGATGATGG + Intergenic
936956991 2:118032435-118032457 ATGGGTGGATGGATGGATGAAGG + Intergenic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937246804 2:120498985-120499007 CCATGGGGTTGGAGGGGTGAAGG + Intergenic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
938018171 2:127885327-127885349 CTGGGGAGTTGGGGAGACGATGG + Intronic
938316707 2:130334416-130334438 CTGGGGGGCTGGGAGGATTATGG - Intergenic
939005574 2:136782622-136782644 TTGGGGGGTTGGGGAGATGTTGG + Intronic
939644136 2:144675632-144675654 CTGGAGGGTTGGAGGAGTTATGG - Intergenic
939785756 2:146509751-146509773 CTGGGGTGCTGGTGGGGTGATGG - Intergenic
939875027 2:147568223-147568245 ATGGAGGGATGGAGGGATGAAGG + Intergenic
940737332 2:157468074-157468096 CTGGGGTGGTGCAGGGATTAAGG - Intronic
943219624 2:185089001-185089023 GTGGGGGGTTGGGGGGATGGGGG + Intergenic
945128164 2:206536447-206536469 GTGGTGGGTTGGAGAGATGTAGG + Intronic
945162462 2:206906471-206906493 CGGGTGGGTCGGAGGGATGTAGG + Intergenic
945341137 2:208656304-208656326 ATGGAGGGATGGAGGGATGGAGG - Intronic
945889155 2:215409896-215409918 CTCGGGGGTAGGAGGCATGAGGG + Intronic
945977520 2:216282421-216282443 ATGGGGGTTGGGAGGGATGGTGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
947185819 2:227454416-227454438 CTGGAGGGTGAGAGGGATGGAGG + Intergenic
947532822 2:230923599-230923621 CTGGGGGGTTGGAGTGGGGCTGG + Intronic
948218931 2:236253902-236253924 CTGGGTGGGTGCAGGGATGCCGG + Intronic
948274396 2:236697008-236697030 GTGGGGGACTGGATGGATGATGG + Intergenic
948421795 2:237864487-237864509 CGGGGGAGGTGGATGGATGAGGG + Intronic
948617768 2:239212569-239212591 ATGGGGGGCAGAAGGGATGAGGG - Intronic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
949065863 2:241990054-241990076 ATGGGTGGATGGATGGATGATGG - Intergenic
1168857564 20:1019565-1019587 GTGGTGGATTGGAGGGTTGATGG - Intergenic
1169085275 20:2822253-2822275 CTGGGGGGTTGGGGGATTGGGGG - Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172294956 20:33802970-33802992 CATGGGGCTTAGAGGGATGATGG + Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172619029 20:36307408-36307430 ATGGAGGGATGGAGGGATGAAGG - Intronic
1172619031 20:36307416-36307438 ATGGAGGGATGGAGGGATGGAGG - Intronic
1172619034 20:36307424-36307446 CCGGAGGGATGGAGGGATGGAGG - Intronic
1172780171 20:37431943-37431965 GTGGAGGGTTGGATGGAGGAAGG - Intergenic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1172981125 20:38942630-38942652 CTGGGGAGTTGGGGGAAGGACGG + Intronic
1173087703 20:39940081-39940103 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1173573537 20:44094624-44094646 CTTGGGGGATGGAGGGATATTGG - Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174548207 20:51342263-51342285 GTGGGGGGTTGGAGGGGCGCCGG + Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1175133330 20:56805881-56805903 CTTGGAGATTGGAGGGATGTGGG - Intergenic
1175279444 20:57793410-57793432 GTCGGGGGTGGGAGGGGTGAGGG + Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175667273 20:60871142-60871164 CTGGGTGGTTGCAGGGTGGAGGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175934555 20:62509077-62509099 GTGGAGGGGTGGAGGGATGGAGG - Intergenic
1175934588 20:62509167-62509189 GTGGAGGGTTGGAGGGGTGGAGG - Intergenic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934710 20:62509497-62509519 ATGGAGGGGTGGAGGGATGGTGG - Intergenic
1175934736 20:62509559-62509581 GTGGAGGGGTGGAGGGATGGAGG - Intergenic
1175934934 20:62510093-62510115 ATGGAGGGGTGGAGGGGTGAAGG - Intergenic
1175934980 20:62510231-62510253 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175935009 20:62510307-62510329 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1175935166 20:62510730-62510752 ATGGAGGGGTGGAGGGATGGAGG - Intergenic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1175984113 20:62755592-62755614 ATGGAGGGAGGGAGGGATGATGG - Intronic
1175984211 20:62755868-62755890 ATGGAGGGAGGGAGGGATGATGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176103563 20:63375527-63375549 CTGGTGGGGTGCAGGGCTGATGG - Intronic
1176103613 20:63375691-63375713 CTGGTGGGGTGCAGGGTTGATGG - Intronic
1176316733 21:5252954-5252976 TTGTGGGGTTGGGGGGATGGGGG - Intergenic
1178019877 21:28395995-28396017 TTGGGGGGTTGGAGGGTCCATGG - Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178882802 21:36462187-36462209 CTGGGCGGTTGTCAGGATGAGGG + Intronic
1179149727 21:38799542-38799564 GTTGGGGGTCGGAGGGATAATGG + Intergenic
1179178020 21:39022687-39022709 CTGGGGCATTGGAGGGATTAGGG - Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179452520 21:41475577-41475599 GTGGGGTGAGGGAGGGATGAGGG + Intronic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179864905 21:44210824-44210846 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1179907012 21:44427673-44427695 CTGGGGGGTTGCCGGGATGTGGG + Intronic
1180009716 21:45041357-45041379 CTGGGGGGTTGGTGGGGGGGCGG - Intergenic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180067889 21:45421724-45421746 CTGGGAGGTGGCAGGAATGAGGG - Intronic
1180085999 21:45508171-45508193 CTGGGGAGATGGATGGATGGTGG + Intronic
1180654493 22:17408198-17408220 CTGGGGGGTGAGGGGGCTGAGGG - Intronic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180966287 22:19789490-19789512 GTGGGGGGTTGGCAGGATGAGGG + Intronic
1181002465 22:19994314-19994336 ATGGGTGGGTGGAGGGATGGTGG + Intronic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181528302 22:23502351-23502373 ATGGGAGGATGGAGGGATGGGGG - Intergenic
1181528438 22:23502752-23502774 ATGGAGGGGTGGAGGGGTGAAGG - Intergenic
1181528523 22:23502970-23502992 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1182144791 22:27990727-27990749 CTCGGGGGTGGGTGGGTTGAGGG + Intronic
1182249921 22:28992156-28992178 GCGGGGGGTTGGGGGGAAGAGGG - Intronic
1183095257 22:35548104-35548126 CAGGGAGGTTGGGGGGAAGAAGG + Intronic
1183101389 22:35586211-35586233 CTATGGGGTTGGAGGGATTAAGG - Intergenic
1183214801 22:36472659-36472681 CTGGGGGGTTAAGGGGGTGAGGG + Intronic
1183226152 22:36551283-36551305 ATGGGGGGATGGATGGATGACGG - Intergenic
1183261813 22:36800175-36800197 GTGGGGGGATGGATGGATGGTGG - Intergenic
1183303950 22:37072058-37072080 ATGGATGGTTGGATGGATGATGG + Intronic
1183304136 22:37073044-37073066 ATGGGTGGATGGATGGATGATGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183327495 22:37202388-37202410 CTGAGGCCTTGGAGGGATGGTGG + Intergenic
1183330250 22:37216182-37216204 TGGGGGGGTGGGAGGGATGGGGG - Intergenic
1183477111 22:38041725-38041747 CTGGGGGCTGGGAAGGATCATGG + Intronic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1184074202 22:42165687-42165709 CTTGGGAGTTGGAGGGGTCAAGG - Intronic
1184110005 22:42389012-42389034 CTGGGTGGGTGGAGGGTTGGGGG - Intronic
1184115441 22:42419209-42419231 CTGTTGAGTTGGAGGGATGGGGG - Intronic
1184293397 22:43509689-43509711 ATGGAGGGATGGAGGGATGAAGG - Intergenic
1184293411 22:43509734-43509756 ATGGAGGGATGGATGGATGAGGG - Intergenic
1184460774 22:44636701-44636723 GTGGGTGGATGGATGGATGATGG + Intergenic
1184786172 22:46673015-46673037 CTGCGGGGATGGGGGGATGGGGG + Intronic
1184826809 22:46958012-46958034 CTCGGGGGTTGGGGGAGTGATGG + Intronic
1185116540 22:48941324-48941346 CGGGGGGTTTGTAGGAATGACGG + Intergenic
1185222413 22:49635808-49635830 CTGGGGTGCTGCAGGGGTGAGGG + Intronic
1185244343 22:49765292-49765314 CTGGGGGGCTGCAGGGCTGGGGG + Intergenic
1185303850 22:50101129-50101151 CTGGGGGGTGGGAGGTCTGGGGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949325516 3:2859043-2859065 CAGGGAGGTTGGAGGAATGTTGG - Intronic
949777335 3:7647557-7647579 ATGGGGAGTTGGAAGTATGAGGG + Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950249428 3:11452014-11452036 TTGGGGGGTTGGGGGGTTGTGGG + Intronic
950340923 3:12243674-12243696 CTGGGGGTTAGGAGGGCTGTAGG + Intergenic
950761682 3:15235550-15235572 CTGGGGGGTGGGTGGGAGCATGG + Intronic
951202428 3:19890261-19890283 CTTGGGGGAGGGAGGGATTAAGG - Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951369319 3:21826024-21826046 GTGGGGGGTTGAGGGGAAGAAGG - Intronic
951642598 3:24852875-24852897 TTGGGGGGTTGTGGTGATGATGG + Intergenic
951889610 3:27556129-27556151 GTGGGGGGTGGGAGGGAGGGAGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953139152 3:40211401-40211423 CTGAGGTGTTGGAGGGTTCAGGG - Intronic
953216599 3:40924183-40924205 TTGGAGGGTGGGAGGGAGGAGGG + Intergenic
954569144 3:51626060-51626082 CGGCGGGGTTGGAGGGCTGGTGG - Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955142652 3:56285098-56285120 CTGGGGGGAGGTAGGGATGGGGG - Intronic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
955896896 3:63709981-63710003 CTTGTGGGTTGGAGGAATGTTGG - Intergenic
955911709 3:63864308-63864330 CTGGGGGGTGGGGAGGGTGACGG + Intergenic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957244516 3:77700835-77700857 GTGGTGGGTTGGGGGGATGGGGG + Intergenic
957295744 3:78330597-78330619 CTGGGGGGAGGTAGGGATCATGG + Intergenic
957343109 3:78926504-78926526 CTGGAGGGTTGGATGGATAATGG + Intronic
959199409 3:103226308-103226330 GTGGTGGGGTGGGGGGATGAGGG + Intergenic
959416140 3:106078057-106078079 GTAGGGGGTTGGGGGTATGAAGG + Intergenic
959905158 3:111703201-111703223 AAAGGGGGTTGGAGGGATGCAGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961161081 3:124726644-124726666 GTGGGGGGTTGGGGGGACGTGGG - Intergenic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961208313 3:125105214-125105236 GAGGGGGGATGGAGGGATGGGGG + Intronic
961384583 3:126516503-126516525 CTGGGGGGTGGGAGGGTAGGTGG - Intronic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
961780452 3:129317417-129317439 CTGGGGGGTGGCAGGGTTGCAGG + Intergenic
961872634 3:129999902-129999924 TTGGGGGGGTGGAGGGTGGAGGG - Intergenic
961961040 3:130855394-130855416 CCGTGGGGTTGGAGGGTTCACGG + Intronic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
966558829 3:181295596-181295618 CTGGGGGGTAGGATGGGTGGTGG - Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967364525 3:188670769-188670791 CTGAAAGGTTGGAAGGATGACGG + Intronic
968133785 3:196207824-196207846 CAAGGGGGTGGGCGGGATGAGGG - Intronic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968183666 3:196616023-196616045 GGGGAGGGTGGGAGGGATGAGGG - Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968650282 4:1757703-1757725 GTGGGGGGATGGGGGGATTATGG - Intergenic
968875424 4:3264646-3264668 CTGGGGAGTTGGGGAGATAATGG - Intronic
968938305 4:3624853-3624875 GTGGGGTCTGGGAGGGATGAGGG + Intergenic
968991549 4:3916769-3916791 GTGGGGGGTGGGGGGGTTGAGGG - Intergenic
969205430 4:5640386-5640408 GTGGGTGGTTGGATGGATGATGG + Intronic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970149669 4:13075655-13075677 CTGGGGGGGTGGGGTGCTGAGGG + Intergenic
970609212 4:17709684-17709706 CTGGGGTGTGGGAGGGCTGAGGG + Intronic
971201317 4:24511761-24511783 CTCGGGGCTTGGAGAGGTGAAGG - Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971753493 4:30679632-30679654 CTGGGGGCTCCTAGGGATGATGG + Intergenic
972963489 4:44482063-44482085 GTGGGGTGTTGCGGGGATGAGGG - Intergenic
973553791 4:52061317-52061339 TTGGGGGATTGCAGGGGTGAGGG + Intronic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975086843 4:70352046-70352068 GTGGGTGGTTGGGGTGATGAGGG - Intergenic
975359515 4:73451554-73451576 CTGGGAGGCTGCAGGGATGCAGG + Intronic
975685172 4:76913558-76913580 TTGGGGGGTTGGAGGAAGAAAGG - Intergenic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976009618 4:80471593-80471615 CAGGGGGGTTGGGGGGAGCAGGG + Intronic
976783230 4:88785731-88785753 CTGGGGGTTTTGAGAGATAAGGG + Intronic
976969222 4:91083408-91083430 CCGGGGGGTTGGCGGGGGGAAGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979496193 4:121385684-121385706 TTGGGAGGTTGAAGAGATGAGGG - Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981657126 4:147124576-147124598 CAGAGAGGTAGGAGGGATGAGGG - Intergenic
981753876 4:148119919-148119941 CTGAGTGGTTGGATGGATGAAGG + Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985709152 5:1418599-1418621 ATGGGTGGATGGATGGATGATGG - Intronic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985861107 5:2471340-2471362 CTGGGGGGTTGGGGGAAGGCTGG + Intergenic
985897415 5:2757011-2757033 CTGGAGGGACGGAGGGTTGAGGG - Intergenic
985987280 5:3526719-3526741 GTGGTGGGTTTGAGGGATGCTGG + Intergenic
986066491 5:4239740-4239762 CTGCTGTGTTGCAGGGATGAGGG - Intergenic
986309235 5:6539375-6539397 ATGGATGGTTGGATGGATGATGG + Intergenic
986763132 5:10898035-10898057 CTGGGGTGTTGGAGAGAGGCAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987104268 5:14621907-14621929 CTGGGGGGTCGGGGGCAGGAAGG + Intergenic
987154420 5:15074372-15074394 TTGAGGGGTTGGAGAGTTGAAGG - Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
987681502 5:21142899-21142921 CTGGAGGGTGGGTGGGATGTTGG + Intergenic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
988383475 5:30530447-30530469 CTGGGGGGATGAATAGATGAGGG - Intergenic
988813477 5:34807545-34807567 GTGGGGTGCTGGAGTGATGAGGG + Intronic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989169138 5:38457943-38457965 CTGGGGGGAGGGAAGAATGAGGG + Intronic
989598103 5:43176441-43176463 TTGGGGGGTTGGAGGTGTGATGG - Intronic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
990862452 5:60341855-60341877 GTGGTGGGGTGGAGGGCTGATGG - Intronic
990970246 5:61497994-61498016 CTGTGGGGGTCTAGGGATGAGGG + Intronic
991069534 5:62461224-62461246 GTGGGAGGTTGGGGGGATGGGGG + Intronic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992411524 5:76510392-76510414 CTTGGGGGATGCAGTGATGACGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993422783 5:87722026-87722048 CTGGGAGGTTGGAAGCAAGATGG + Intergenic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
993970830 5:94418442-94418464 TTGGGAGGATGGAGGGGTGAGGG - Intronic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994014629 5:94951117-94951139 CTGGACAGTTGGAAGGATGAGGG - Intronic
995014008 5:107289765-107289787 CCTGGGGGTTGGAGGGTTGGGGG + Intergenic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
996928050 5:128852413-128852435 GTGGGGGATTGGAGGGAGGGAGG + Intronic
998371489 5:141664864-141664886 GTGGGGGGTGGGGGTGATGAGGG - Intronic
998383380 5:141741734-141741756 CTGGGAGGTGGGAGGGAGGGAGG + Intergenic
998938158 5:147252749-147252771 ATAGTGGGTAGGAGGGATGAGGG - Intronic
998956435 5:147443476-147443498 GTTGGGGGTTGGGGGGGTGATGG + Intronic
999041670 5:148420642-148420664 CTAATGGGGTGGAGGGATGAGGG - Intronic
999543845 5:152605002-152605024 ATGGTGGGTTGGAGAGATGCTGG - Intergenic
999617407 5:153438870-153438892 CTAGGGGGATTGAGGGGTGATGG - Intergenic
999622209 5:153485100-153485122 TAGGGAGATTGGAGGGATGAGGG + Intergenic
1000339445 5:160266083-160266105 CTGGCGGGTCAGAGGGATCAAGG + Intronic
1000400290 5:160818999-160819021 CTGGGGGGTGGGAGTGGGGACGG + Intronic
1001382297 5:171312483-171312505 CTGGGGGGTGGGAGGCAGGGTGG + Intergenic
1001646297 5:173284563-173284585 GTGGATGGTTGGATGGATGAAGG - Intergenic
1001646376 5:173284928-173284950 GTGGATGGTTGGATGGATGAAGG - Intergenic
1001751465 5:174134706-174134728 ATGGGTGGATGGATGGATGATGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002053377 5:176584526-176584548 CTGGGGGCTGGGTGGGCTGAGGG + Exonic
1002363255 5:178690424-178690446 GTGGGGGGATGGGGGGATGCTGG - Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002888793 6:1317033-1317055 CTGGGGGGGAGGCGGGAGGAGGG - Intergenic
1003126318 6:3358857-3358879 ATCGGGGGCTGGAGGGATGGTGG + Intronic
1003598983 6:7500794-7500816 GTGGGGGGTGGTAGGGATGGTGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1004058885 6:12171153-12171175 CTTGGGAGAGGGAGGGATGAGGG - Intergenic
1004198970 6:13530535-13530557 CTGGGGGATTGCAGGCATGAAGG + Intergenic
1004492536 6:16129677-16129699 GTGCTGGGTTGGGGGGATGATGG - Intronic
1004585908 6:17000129-17000151 CTGGTTGGATGGATGGATGAAGG - Intergenic
1005054442 6:21716735-21716757 CAGGGGTGTTGGTGGGAGGATGG + Intergenic
1006363293 6:33599561-33599583 CCTGGGGGCTGGAGGAATGATGG - Intergenic
1006448070 6:34091002-34091024 CTGGGGGGCTGTGGGGCTGAAGG - Intronic
1006588728 6:35138595-35138617 GTGGGGGGTTGGGGGGTTGCAGG + Intronic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1006948383 6:37800837-37800859 CAGGGAGGATGGAGGGGTGACGG + Intergenic
1007482928 6:42162044-42162066 CTGGGTAGGTGGAGGGATGGAGG + Intronic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007755585 6:44097266-44097288 CTGGGGTGTTGGAGGGAACTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1010095650 6:72040914-72040936 TTGGGGGGTTGTAGGGTTGTAGG - Intronic
1011153650 6:84303940-84303962 GTGGGAAGTTGGAGGGAGGAGGG + Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1011595958 6:89016349-89016371 CTTGAGGGTTTGAGGGTTGAAGG + Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1013695057 6:112692209-112692231 CTCGGGGGCTGAAGGGATTAGGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013821940 6:114165045-114165067 CTGGGGTGTTTCAGGGATGCTGG + Intronic
1014340306 6:120197363-120197385 CTAAGGGCTTGGAGGAATGAGGG + Intergenic
1015569305 6:134604777-134604799 CTGTGGAGTTGGATGGATGGGGG - Intergenic
1015715694 6:136189730-136189752 CTGGAGGGATGGTGGGGTGACGG - Intronic
1016441138 6:144084740-144084762 TTGGAGGATTGGAGGGTTGAGGG - Intergenic
1017739955 6:157398023-157398045 CTGGGGAGCTGGGGGGCTGAGGG - Intronic
1018715487 6:166529417-166529439 GTGGTGGGGTGGAGGGATGGGGG + Intronic
1018764728 6:166924631-166924653 CTGGTAGGTTGGAGGGAGGGAGG - Intronic
1018868272 6:167761837-167761859 ATGGGTGGATGGAGGGATGGGGG - Intergenic
1018901872 6:168055755-168055777 CTGGGGGGCTGGTGAGATGCCGG - Exonic
1019000337 6:168744240-168744262 GTGGGGGGCTGAAGGGCTGAAGG + Intergenic
1019049135 6:169169966-169169988 CTGTGGGGTAGGAGGGGTGGGGG - Intergenic
1019103445 6:169650237-169650259 ATGGGGGGATGCAGAGATGAGGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019258639 7:67442-67464 CTGGAGGATTGCAGAGATGAGGG - Intergenic
1019398360 7:835858-835880 CAGGGGGGCTGGAGACATGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019503668 7:1379390-1379412 ATGAGTGGTTGGATGGATGATGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019785876 7:2977117-2977139 CTGGGGGGAGGCAGGGATGGAGG + Intronic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020270050 7:6589658-6589680 CTGGGGGGTACGGGGGAAGATGG - Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020428437 7:8095253-8095275 CTGGGGGGTGGGGGGGTTGGGGG + Intergenic
1020875935 7:13693841-13693863 CTGAGGGGTGGGAGTGGTGAAGG - Intergenic
1021128609 7:16883350-16883372 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1022050891 7:26670153-26670175 CTGGTGGGTAGGAGAAATGAAGG - Exonic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022802759 7:33791875-33791897 CTGGGGGGTGGGGGGTATCAGGG - Intergenic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023532252 7:41170383-41170405 CTTGGGGGCTGGTGGGATTAGGG + Intergenic
1023544772 7:41306828-41306850 CTAGGGGGTTGGAGAGAGGGTGG + Intergenic
1023965603 7:44961848-44961870 CTGAGGGGTCTGAGGGCTGAGGG + Intergenic
1024086322 7:45894504-45894526 CTATGGGGTTGGAGGGTTAAAGG - Intergenic
1024505424 7:50158240-50158262 ATGGGGGGTGGGAGGGATCCAGG - Intronic
1024580623 7:50797517-50797539 GTGGGGGGTTGGAGGGGGTAGGG + Intergenic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026475379 7:70730411-70730433 CTGAGGGATTGGGAGGATGAGGG - Intronic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026994365 7:74606172-74606194 CTAGGAGGTGGGAGGGAGGAAGG - Intergenic
1027229757 7:76265297-76265319 CTTGGGGGCTGGGGGGATCACGG + Intronic
1027231253 7:76274068-76274090 CCGGGGGCTGGCAGGGATGAAGG - Intronic
1027252506 7:76408172-76408194 GGAGGGGGTTGGAGGGATGGTGG - Intronic
1027271293 7:76520559-76520581 CTTGGGGATTGCAGGGATGATGG - Intergenic
1027321057 7:77010494-77010516 CTTGGGGATTGCAGGGATGATGG - Intergenic
1028821768 7:95219862-95219884 ATTTGGGGTTGGAGAGATGAGGG - Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029506766 7:100967743-100967765 CTGGGGTGCAGGATGGATGAAGG - Exonic
1030123436 7:106133053-106133075 TTGGGGGGGTGGCGGGGTGAGGG + Intergenic
1030207081 7:106961465-106961487 GTGAGGGGTTGGAGGCATCAAGG + Intergenic
1030638698 7:111979556-111979578 CTGGCGGGGTGGAGGGGGGATGG - Intronic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1031883001 7:127217995-127218017 CTGGGGGGTTGGATGGTAAATGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032100508 7:128972687-128972709 GTGGGGGGTTTCAGGGAAGAAGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033046736 7:137968884-137968906 CTAGGGGGTTGGAGAAAAGAAGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1034321621 7:150189025-150189047 CTGGGGTGTTGGAGGGAGCTTGG - Intergenic
1034436525 7:151065174-151065196 CTGGGCGGCTGTAGGGATTAAGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034771126 7:153778257-153778279 CTGGGGTGTTGGAGGGAGCTTGG + Intergenic
1034856864 7:154558093-154558115 GTGGGGGGGTGGAGGGGTAAAGG - Intronic
1034883646 7:154781049-154781071 ATGGGTGGATGGATGGATGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035147834 7:156838356-156838378 GTGGGGGCTTGGAGAGATGTTGG - Intronic
1035278867 7:157765082-157765104 ATGGGTGGTTGGATGGATGGAGG - Intronic
1035296974 7:157872813-157872835 CTGGCGGGGTAGAGGGGTGACGG + Intronic
1035363314 7:158328629-158328651 CTGGGTGGTGGGAGGAATGGGGG - Intronic
1035451773 7:158981294-158981316 CTGGGGGGTTGGGAGGCTCAGGG + Intergenic
1035482144 7:159195777-159195799 CTGGGGAGAGGGAGGGATGGGGG + Intergenic
1035520736 8:273730-273752 GTGGGGGGTTGGGGGACTGAGGG + Intergenic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036171972 8:6495995-6496017 CTTGGGGGTTGGGAGGGTGAGGG + Intronic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1036729658 8:11250984-11251006 CTGGGAGGTAGCAGGGTTGAGGG - Intergenic
1036823227 8:11955978-11956000 GTGGGGGGTTGGCGGGGCGAGGG + Intergenic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1038440941 8:27570315-27570337 ATGGATGGTTGGATGGATGAAGG + Intergenic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1039533205 8:38283397-38283419 GTGGGGGGTGGGAGGGAGAATGG - Intronic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1042927824 8:73984464-73984486 CTCTGGGGTTGCAGGGATGCGGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045399103 8:101793543-101793565 CTGTGAGGTTGAAGGCATGATGG + Intronic
1045412623 8:101933729-101933751 CTTGGGGGTTGGAGGCCTCAAGG + Intronic
1045472822 8:102527606-102527628 CTTGGGGGTTAGAGGCAAGATGG - Intergenic
1045544047 8:103112246-103112268 CTGGGGAGTTGCAGGGACAAAGG + Intergenic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047830192 8:128621182-128621204 CTGGGGGCTTGGAGGCCTGTGGG + Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048918182 8:139203926-139203948 TTGGGGGGTTGGGGGGTTGGGGG - Intergenic
1048918187 8:139203934-139203956 TTGGGGGGTTGGGGGGTTGGGGG - Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1049070405 8:140351217-140351239 GTGGGGGGCTGGAGGGGTGCGGG - Intronic
1049211759 8:141389967-141389989 CTGGGGTGCTGGCGGGATCAGGG + Intergenic
1049223525 8:141438753-141438775 ATGGGTGGTTGGATGGATGGAGG + Intergenic
1049223581 8:141438997-141439019 GTGGGTGGGTGGATGGATGAAGG + Intergenic
1049364284 8:142229217-142229239 GTGGGTGGATGGATGGATGATGG + Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049469101 8:142767447-142767469 GTGGGGGGTAGCAGGGAAGATGG + Intronic
1049478847 8:142810487-142810509 ATGAGTGGTTGGAGGGGTGAAGG - Intergenic
1049580518 8:143408610-143408632 CTAGGGGGTGGGAAGGCTGACGG - Intergenic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1051716675 9:19991938-19991960 CTTGGGGACTGGATGGATGAGGG + Intergenic
1052077864 9:24166446-24166468 GTAGGGGGTTGGATAGATGATGG - Intergenic
1053575076 9:39351393-39351415 CTGAGGAGTTGGGGGGATGGAGG - Intergenic
1053839582 9:42179328-42179350 CTGAGGAGTTGGGGGGATGGAGG - Intergenic
1054096641 9:60910076-60910098 CTGAGGAGTTGGGGGGATGGAGG - Intergenic
1054118044 9:61185702-61185724 CTGAGGAGTTGGGGGGATGGAGG - Intergenic
1054452897 9:65412906-65412928 GTGGGGTCTGGGAGGGATGAGGG - Intergenic
1054459172 9:65453469-65453491 CTGGCTGGGTGGATGGATGATGG + Intergenic
1054589711 9:66996862-66996884 CTGAGGAGTTGGGGGGATGGAGG + Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1056526541 9:87447833-87447855 CAGGGAGGTTGGAGGAATGCAGG - Intergenic
1056914069 9:90729778-90729800 CAGCGGGGTTGGGGGGTTGAGGG - Intergenic
1057181132 9:93031081-93031103 ATGGGTGGATGAAGGGATGATGG + Intronic
1057830936 9:98406463-98406485 CTGGGGTGCTGGAAAGATGACGG + Intronic
1057855448 9:98597610-98597632 CTTGGTGGTTGGAGGGCTCAAGG + Intronic
1059050801 9:110922984-110923006 GTTGGGGGTTGGGGGGCTGAGGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059252238 9:112895832-112895854 GTGGGTGGATGGATGGATGATGG - Intergenic
1059339613 9:113590338-113590360 GTGGGTGGGTGGATGGATGAAGG - Intronic
1059399854 9:114062072-114062094 CTGAGACGTTGGAGGGGTGAGGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061061989 9:128255120-128255142 GTAGGGGGTGGGAGGGATGGCGG - Exonic
1061218515 9:129235697-129235719 CTGGGACGCTGGAGGGATGAGGG - Intergenic
1061255643 9:129453319-129453341 ATGGAGGGATGGAGGGATGGGGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061399506 9:130360737-130360759 ATGGATGGTTGGATGGATGATGG - Intronic
1061491008 9:130944413-130944435 CTGGAGGGGTGGAGGGCTGGAGG + Intergenic
1061724477 9:132574443-132574465 TTGGGAGATTGGAGGGATGAAGG - Intergenic
1061808172 9:133148039-133148061 CGGGGGGGCTGAAGGGCTGAGGG - Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062092520 9:134685868-134685890 GTGGGTGGATGGATGGATGATGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062198325 9:135287012-135287034 CTGGGGGGCTGGAGCGCTGCAGG - Intergenic
1062201380 9:135304575-135304597 GTGGAGGGATGGAGGGCTGATGG + Intergenic
1062222985 9:135429127-135429149 CTGGGGGGTTAGAGGAACTAGGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062250990 9:135593155-135593177 CTCGGGGGCTGGGGGGTTGAGGG + Intergenic
1062365686 9:136207962-136207984 CCTGGGGGTTGGAAGGATGGGGG - Exonic
1062391670 9:136336358-136336380 CTGGGGGTGTGGAGGGATTCGGG - Intronic
1062402914 9:136380262-136380284 CTGGGGGGTTGGGGGCAGGGTGG + Intronic
1062405124 9:136392591-136392613 CTGGCTGGTGGAAGGGATGAGGG + Exonic
1062480283 9:136747878-136747900 CTGGAGGGTTGGAGGTCTGGGGG - Intronic
1062480364 9:136748194-136748216 CTGGAGGGTTGGAGGCTGGAGGG - Intronic
1062497763 9:136839644-136839666 TGGGGGTGTGGGAGGGATGATGG + Intronic
1062520837 9:136957243-136957265 GTGGGTGGATGGATGGATGATGG + Intronic
1062520958 9:136957636-136957658 GTGGGTGGATGGATGGATGAAGG + Intronic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1203398272 Un_KI270519v1:48383-48405 TGGGGTGGTTGGAGGGGTGAGGG + Intergenic
1185495218 X:549578-549600 GTGGGTGGATGGATGGATGAAGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185791069 X:2928671-2928693 CTGGGGGGTTGGGGGCGGGACGG + Intronic
1185867840 X:3639225-3639247 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185867868 X:3639297-3639319 GTCGGGGGGTGGATGGATGAAGG + Intronic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1185867951 X:3639516-3639538 GTGGGTGGGTGGATGGATGACGG + Intronic
1185867960 X:3639540-3639562 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186014871 X:5180109-5180131 TTGGGGAGTAAGAGGGATGAAGG + Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186401594 X:9265348-9265370 TTGGGGAGGTGGGGGGATGACGG + Intergenic
1186526953 X:10257577-10257599 CTGGGAGGGTAGAGGGATGTTGG + Intergenic
1186569389 X:10698240-10698262 CTGGATGGTTGCAGGGATGGGGG - Intronic
1186652818 X:11579034-11579056 GTGGGGGGATGGGGGGATGGGGG + Intronic
1186833290 X:13412415-13412437 CGGGGGAGTTGGAGGGGGGAAGG + Intergenic
1187122756 X:16425208-16425230 TTGGGTGGTTGGAGGGAAGGAGG - Intergenic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1187910850 X:24110063-24110085 TTGGGAGGTTGGGAGGATGAGGG - Intergenic
1188110195 X:26188403-26188425 CTGGGGGGATGGGGGAATAAGGG + Intergenic
1188393901 X:29656422-29656444 CTGGGGAGTTGGGGGAAGGATGG - Intronic
1188942910 X:36262350-36262372 GTGGGGGGTTGGTGGGAGGTAGG - Intronic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190415269 X:50174501-50174523 GTGGGGGATTGAAGGGATGATGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1192615122 X:72612315-72612337 CTGGGGGAATGGAGGGATTGGGG + Intronic
1193356518 X:80525412-80525434 TTGAGGGGTTTGAGGGATGAGGG - Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1195815733 X:108885176-108885198 CTGGGAGGTTGAAGGAATTAGGG - Intergenic
1195966033 X:110431246-110431268 CTGGGGGTTTGCAGTGATCATGG + Intronic
1196024804 X:111030563-111030585 ATGGGTGGGTGGATGGATGAAGG + Intronic
1196119075 X:112029122-112029144 ACGGGGGGTTGGAGGGAGGGTGG - Intronic
1196768111 X:119268074-119268096 CTGGGGGGTAGCAGCGAAGATGG - Intergenic
1197077556 X:122371402-122371424 CTGGGAAGGTGGAGGGTTGAGGG - Intergenic
1197618295 X:128718803-128718825 GTTGGGGGGTGGAGGGGTGAGGG - Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198540067 X:137628740-137628762 TTGGGGGATTAGGGGGATGATGG - Intergenic
1198767568 X:140094433-140094455 CTGGGGGGTTGGGGAGGGGAGGG + Intergenic
1199325910 X:146497989-146498011 TTGGGGGGTTGGGGGGAGGTGGG + Intergenic
1199672524 X:150159066-150159088 GTGGGGGGTTGGAGAGGTGAGGG - Intergenic
1199838638 X:151620492-151620514 CTCGGGGGTCGGAGGTTTGAAGG + Intronic
1200870840 Y:8096592-8096614 GTTGTGGGTTGGAGGGAGGAGGG - Intergenic
1201289470 Y:12408675-12408697 ATGGGTGGATGGATGGATGATGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202370994 Y:24195303-24195325 GTGGGGGGTGGGAGGGATGGCGG + Intergenic
1202499790 Y:25474814-25474836 GTGGGGGGTGGGAGGGATGGCGG - Intergenic