ID: 993973284

View in Genome Browser
Species Human (GRCh38)
Location 5:94445742-94445764
Sequence TGAACTAGGTATTTAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993973284 Original CRISPR TGAACTAGGTATTTAGCATA TGG (reversed) Intronic
902798709 1:18816190-18816212 TTAACTAGTCATTTAGCATTAGG + Intergenic
904385952 1:30142282-30142304 TGGGCTAGGGCTTTAGCATATGG - Intergenic
904966075 1:34373893-34373915 TGAACACGGTACTAAGCATATGG - Intergenic
905610084 1:39342872-39342894 AGAAATAGGTCTTTTGCATATGG - Intronic
906874946 1:49527359-49527381 AGAAATTGGTATTTAGAATAAGG + Intronic
908920901 1:69190488-69190510 AGAACTTGGTATTTATCTTATGG + Intergenic
909107080 1:71424907-71424929 TTAACTAGGTTTTCTGCATATGG - Intronic
909372666 1:74902096-74902118 TTAACTTGTTATTTAGCATTAGG - Intergenic
909395447 1:75166642-75166664 TGAACTAGGAAAATTGCATATGG - Intergenic
909571123 1:77111648-77111670 TTAACTCGTTATTTAGCATTAGG - Intronic
909763242 1:79320749-79320771 TTAACTAGTCATTTAGCATTAGG + Intergenic
911638103 1:100258433-100258455 TTAACTAGTCATTTAGCATTAGG + Intergenic
911892035 1:103383221-103383243 TTAACTAGTCATTTAGCATTAGG - Intergenic
912026997 1:105189605-105189627 TTAACTCGTCATTTAGCATAAGG + Intergenic
912323402 1:108735737-108735759 TGAAGTAGCTATTGAACATATGG - Intronic
913551475 1:119920940-119920962 TGTACTAGGTATTCAGTAAAGGG - Intronic
915754188 1:158242539-158242561 TTAACTAGTCATTTAGCATTAGG - Intergenic
915875683 1:159609783-159609805 TTAACTCGTTATTTAGCATTAGG - Intergenic
915986910 1:160475404-160475426 TTAACTCGTTATTTAGCATTAGG + Intergenic
916467919 1:165090988-165091010 TTAACTCGTTATTTAGCATTAGG - Intergenic
920181709 1:204135918-204135940 TGAACCAGGTATCTTGGATAAGG + Intronic
920934705 1:210420545-210420567 TCAACTCGTTATTTAGCATTAGG - Intronic
921773832 1:219074042-219074064 TTAACTCGTCATTTAGCATAAGG - Intergenic
1063765271 10:9132781-9132803 TGAACTAGGCATTTGGAACATGG - Intergenic
1068301485 10:55147762-55147784 TTAACTCGTTATTTAGCATTAGG + Intronic
1068678706 10:59795573-59795595 TTAACTCGTTATTTAGCATTAGG + Intronic
1071259092 10:83903083-83903105 TTAACTAGTCATTTAGCATTAGG - Intergenic
1071769948 10:88717181-88717203 ACAACCAGGTATTTAGCAGATGG - Intergenic
1071863262 10:89698054-89698076 TGAAGTAGGTATTTAGTTTTTGG + Intergenic
1071991959 10:91108316-91108338 TTAACTCGTCATTTAGCATAAGG + Intergenic
1072573908 10:96682400-96682422 TGAAGTAGGCATTTGGCATGTGG - Intronic
1074560449 10:114530834-114530856 AGAAATAGGTATTTAGTAAAGGG + Intronic
1075069812 10:119313410-119313432 GGTGCTAGGTATTTTGCATATGG + Intronic
1075476260 10:122737035-122737057 TTAACTAGTCATTTAGCATTAGG + Intergenic
1075986019 10:126785823-126785845 TGAAATATGTATTTAGTATCTGG - Intergenic
1078372649 11:10762455-10762477 TGAACTAGGTTTTTAGGAAGAGG + Intronic
1079722756 11:23839459-23839481 TGAACTAGGGATTTGGGAAATGG + Intergenic
1080168334 11:29267706-29267728 TTAACTTGTTATTTAGCATTAGG - Intergenic
1080811495 11:35708802-35708824 TTAACTAGTCATTTAGCATTAGG - Intronic
1080813702 11:35732738-35732760 TTAGCTAGGTTTTTAGAATAGGG + Intronic
1081191658 11:40111123-40111145 TGAAATAGGTTATTTGCATATGG - Intergenic
1082123783 11:48408349-48408371 TTAACTCGTCATTTAGCATAAGG - Intergenic
1082241040 11:49870935-49870957 TTAACTCGTTATTTAGCATTCGG - Intergenic
1082269782 11:50157438-50157460 TGAACTCGTCATTTAGCATTAGG - Intergenic
1082311477 11:50654499-50654521 TTAACTAGTCATTTAGCATTTGG - Intergenic
1086642146 11:89172624-89172646 TGCCCCAGGTATTTACCATAAGG + Intergenic
1087293670 11:96345019-96345041 TGAACTCGTTATTTAGCATTAGG + Intergenic
1088042878 11:105409692-105409714 TTAACTCGTTATTTAGCATTAGG + Intergenic
1088951760 11:114578814-114578836 TGAACTAGGATTTTAGCAACTGG + Intronic
1092496730 12:9003803-9003825 TTAACTCGTTATTTAGCATTAGG + Intronic
1095065554 12:37767494-37767516 TTAACTCGTTATTTAGCATTAGG - Intergenic
1096036840 12:48479403-48479425 TTAACTAGTCATTTAGCATTAGG - Intergenic
1097468246 12:59954176-59954198 TTAACTAGTCATTTAGCATTAGG - Intergenic
1098475590 12:70898043-70898065 TTAACTAGTCATTTAGCATTAGG - Intronic
1101509245 12:105377891-105377913 TGAATGAGGTATTTAGCAAATGG + Intronic
1106573823 13:30956115-30956137 TTAACTAGTCATTTAGCATTAGG + Intronic
1106905061 13:34398553-34398575 TTAACTAGTCATTTAGCATTAGG + Intergenic
1108952117 13:56107359-56107381 TGATCTAGGTATAAAGCATTCGG + Intergenic
1109400633 13:61823415-61823437 TTAACCATGTATTTAGCCTATGG - Intergenic
1109400920 13:61827812-61827834 TTAACTTGTTATTTAGCATTAGG + Intergenic
1110025753 13:70537115-70537137 TTAAATAGGAACTTAGCATAAGG + Intergenic
1110585712 13:77189209-77189231 TAAACAAAGTTTTTAGCATATGG + Intronic
1110678770 13:78283280-78283302 TTAACTCGTCATTTAGCATAAGG + Intergenic
1111345139 13:86942111-86942133 TTCATGAGGTATTTAGCATATGG - Intergenic
1111345864 13:86953486-86953508 TTAACTAGTCATTTAGCATTAGG + Intergenic
1114716173 14:24827270-24827292 TGAAATACATATTTAGCATAGGG + Intronic
1115005745 14:28482180-28482202 TGAACTAATTATATGGCATAAGG + Intergenic
1116010150 14:39342118-39342140 TTAACTAGTCATTTAGCATTAGG + Intronic
1117235645 14:53771802-53771824 TGAGCCAGGAACTTAGCATATGG - Intergenic
1118123977 14:62878238-62878260 TTAACTAGTCATTTAGCATTAGG - Intronic
1118634226 14:67733012-67733034 TGAACTCGTCATTTAGCATTAGG - Intronic
1119800323 14:77438694-77438716 TGAAATAGGTATTTAGCTCTTGG - Intronic
1122002244 14:98668532-98668554 TTAACTATGTACATAGCATAAGG + Intergenic
1125906039 15:43393546-43393568 TTAACTCGTTATTTAGCATTAGG + Intronic
1125951106 15:43752586-43752608 TGAATTTGGTATTTATCATTTGG + Intronic
1126275883 15:46880370-46880392 TATTCTTGGTATTTAGCATAGGG - Intergenic
1127540074 15:59928782-59928804 TAAACTAGGTAAATAGCACAAGG - Intergenic
1128365952 15:67003123-67003145 TGAACTAGGTAATTGGGCTAAGG + Intergenic
1134101334 16:11453989-11454011 TGTACTGGGTCCTTAGCATAGGG - Intronic
1135912667 16:26575420-26575442 TTAACTAGTCATTTAGCATTAGG - Intergenic
1139102364 16:63784138-63784160 TCAACTCGTCATTTAGCATAAGG + Intergenic
1139116683 16:63962800-63962822 TGAACACAGTATTTGGCATATGG + Intergenic
1139715288 16:68808544-68808566 TGAACCAGGTTTTTAGGAAATGG - Exonic
1143239541 17:5432141-5432163 TGAAGCAGGTATGTATCATAGGG - Intronic
1146709626 17:35029791-35029813 TTAACTCGTTATTTAGCATTAGG + Intronic
1148257488 17:46148487-46148509 TGAACTAATTATTTAACATAAGG + Intronic
1151614019 17:75196320-75196342 TGAACTCGTCATTTAGCATTAGG - Intergenic
1153368830 18:4290220-4290242 TATACTAGGTATTATGCATACGG + Intronic
1153381486 18:4444807-4444829 TGAACTAGATACTTCACATAAGG + Intronic
1153831143 18:8923794-8923816 TGAACTCGTCATTTAGCATTAGG - Intergenic
1154318267 18:13323655-13323677 TGAACAAAGTATTCAGCATATGG + Intronic
1156665486 18:39400726-39400748 TTAACTCGTTATTTAGCATTAGG - Intergenic
1156740720 18:40324505-40324527 TTAACTAGTCATTTAGCATTAGG + Intergenic
1158174082 18:54634543-54634565 TTAACTAGTCATTTAGCATTAGG + Intergenic
1163164917 19:15489504-15489526 TTAACTCGTTATTTAGCATTAGG + Intronic
1164321063 19:24147628-24147650 TTAACTCGTTATTTAGCATTAGG + Intergenic
1164405364 19:27939895-27939917 GGAACCAGGCATTAAGCATAGGG + Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1167103477 19:47418015-47418037 TGAATGAGGCATTTAGCACAGGG + Intronic
926460665 2:13125896-13125918 TGAATGAGGTCTTTAGCAAATGG - Intergenic
926486826 2:13472095-13472117 TGAACTCGTCATTTAGCATTAGG + Intergenic
926499920 2:13641470-13641492 TGAACTCGTCATTTAGCATTAGG + Intergenic
926803292 2:16681646-16681668 TTAACTAGTCATTTAGCATTAGG + Intergenic
926992210 2:18692299-18692321 TTAACTCGTTATTTAGCATTAGG + Intergenic
927239211 2:20905551-20905573 TCAACTCGTTATTTAGCATTAGG + Intergenic
927316592 2:21690317-21690339 TTAACAAGGTGTTTTGCATAGGG + Intergenic
928631850 2:33201519-33201541 TTAACTCGTTATTTAGCATTAGG - Intronic
929584821 2:43107014-43107036 TGAACTAGGTATTTGTCCTCGGG + Intergenic
930328638 2:49953883-49953905 TGAAGTAGGTATTTGTCCTAAGG - Intronic
930919683 2:56737531-56737553 TGACCAGGGTATTTTGCATACGG - Intergenic
930964844 2:57309228-57309250 TTAACTCGTTATTTAGCATTAGG - Intergenic
931280724 2:60789218-60789240 TTAACTCGTCATTTAGCATAAGG - Intronic
931633813 2:64324253-64324275 TGAACTAAGTAGTTACCATGTGG + Intergenic
933124756 2:78590750-78590772 TGCAGTAGGTATTGAGCAAAGGG + Intergenic
933802144 2:85969828-85969850 TTAACTAGTCATTTAGCATTAGG - Intergenic
934785291 2:97000750-97000772 TGCATTAGGTATTTGTCATAAGG + Intronic
935562895 2:104576896-104576918 TGAGCTGGGTATTGAGCACAAGG - Intergenic
935667918 2:105529195-105529217 TTAACTCGTTATTTAGCATTAGG + Intergenic
935808783 2:106775000-106775022 AGAACTAGGTAGTGAGTATATGG - Intergenic
935938626 2:108214732-108214754 TGAACTCGTCATTTAGCATTAGG - Intergenic
940902693 2:159140654-159140676 TGAACTAGGAGTTCAGCAGATGG + Intronic
942073001 2:172332171-172332193 TGAACTGGGTATGAAGCAAAGGG + Intergenic
943002698 2:182348806-182348828 TGAACTAAAAATTTAGAATAAGG - Intronic
943018887 2:182548706-182548728 TGAACTAGGGAATTACCAAAGGG - Intergenic
943089362 2:183355689-183355711 TGAACTTGTTATTTAGTAGAGGG + Intergenic
944610455 2:201399910-201399932 AGAATTAGGTATTTAAGATATGG + Intronic
947320445 2:228911697-228911719 TAATCTTGGTACTTAGCATAAGG - Intronic
947703742 2:232257580-232257602 TGAACAAAATATTTTGCATACGG + Intronic
948572158 2:238924544-238924566 AGAAGTAGGTATTTAGGAGAAGG + Intergenic
1172651570 20:36506510-36506532 TGACCTATGTATTTTGGATAAGG - Intronic
1173052944 20:39582584-39582606 GGAACTTTGTATATAGCATAAGG - Intergenic
1174255718 20:49253435-49253457 TGGACTAGGTAAATAGCAGAGGG + Intronic
1177044324 21:16150577-16150599 TTAACTAGTCATTTAGCATTAGG + Intergenic
1177577262 21:22974973-22974995 TTAACTAGTCATTTAGCATTAGG + Intergenic
1179011308 21:37558272-37558294 TGTACTAGGTATTATGCATGGGG - Intergenic
1180822620 22:18841415-18841437 TTAATTACGTATATAGCATAGGG - Intergenic
1182109200 22:27710918-27710940 TGAACTAGGTAAAGAGCAGAAGG - Intergenic
1203218080 22_KI270731v1_random:19535-19557 TTAATTACGTATATAGCATAGGG + Intergenic
1203324019 22_KI270737v1_random:99976-99998 TGAACTCGTCATTTAGCATTAGG + Intergenic
949523388 3:4878173-4878195 TTAACTCGTTATTTAGCATTAGG - Intronic
949645382 3:6087573-6087595 AGAATTAGGTATTTTGCATATGG - Intergenic
950257318 3:11516227-11516249 TTAACTAGTCATTTAGCATTAGG - Intronic
950603264 3:14055324-14055346 TTAACTCGTCATTTAGCATAAGG + Intronic
950908457 3:16561208-16561230 TGAAGTATGGATTTTGCATATGG - Intergenic
951089083 3:18551253-18551275 GGAAATAGATATCTAGCATATGG + Intergenic
951261755 3:20518001-20518023 TGAACTGTATATTGAGCATATGG + Intergenic
951774907 3:26299103-26299125 TTGACTAGGTATTTTGGATAAGG + Intergenic
952839719 3:37635730-37635752 TTAACTAGTCATTTAGCATTAGG + Intronic
953231742 3:41071514-41071536 TGCACTAGGCATTTAGAAGAGGG - Intergenic
954513077 3:51145329-51145351 TTAACTCGTTATTTAGCATTAGG + Intronic
957226433 3:77454392-77454414 TGAGTCAGGGATTTAGCATAAGG - Intronic
957308887 3:78493045-78493067 TTAACTCGTTATTTAGCATTAGG - Intergenic
958512758 3:95069388-95069410 TCAACTAGTCATTTAGCATTAGG - Intergenic
959027002 3:101250921-101250943 AGAACTTGGTATTGAGCAAATGG - Intronic
960172333 3:114476798-114476820 TGCACAAGATATTTATCATATGG - Intronic
963824997 3:149943912-149943934 TTAACTCGTTATTTAGCATTAGG + Intronic
963826705 3:149963474-149963496 AGTTCTAGGAATTTAGCATATGG - Intronic
965129473 3:164677646-164677668 TGAACTAGGTATATAGATTTTGG - Intergenic
966509694 3:180748104-180748126 TGAACTATGTATTTTTTATAAGG + Intronic
969248041 4:5948328-5948350 TGATCTAGGTATTGGGCATTAGG + Intronic
970240661 4:14005410-14005432 TTAACTCGTTATTTAGCATTAGG + Intergenic
970688664 4:18597228-18597250 TTAACTAGTTATTTAACATTAGG + Intergenic
970983620 4:22129852-22129874 TGAGCTAGGTATTTACCATCTGG - Intergenic
971788194 4:31132544-31132566 ATAACTAGGTAATTATCATATGG - Intronic
971798107 4:31254686-31254708 TGCATTAGGTATTTATCCTAAGG - Intergenic
972067517 4:34968345-34968367 TGAACTAGGCCTTTTGTATATGG + Intergenic
972779751 4:42276683-42276705 TTAACTAGTCATTTAGCATTAGG - Intergenic
972862952 4:43193585-43193607 TATACTAAGTATTCAGCATAAGG + Intergenic
973083442 4:46024770-46024792 TGAACTAAGGCTTGAGCATATGG + Intergenic
973097143 4:46216175-46216197 TTAACTAGTGATTTAGCATTAGG - Intergenic
973123119 4:46547775-46547797 TTAACTCGTTATTTAGCATTCGG - Intergenic
973952051 4:56025831-56025853 TGAACTATGTATCTATGATATGG - Intronic
974551867 4:63385206-63385228 TTAACTCGTCATTTAGCATAAGG - Intergenic
974579316 4:63774762-63774784 TGAACTCGTCATTTAGCATTAGG - Intergenic
974811260 4:66949192-66949214 TGAACAAGATATTAAGCAAAAGG - Intergenic
975096148 4:70459471-70459493 TTAACTAGTCATTTAGCATTAGG - Intronic
976578547 4:86706061-86706083 TCAACTAGCTAACTAGCATAAGG + Intronic
978985810 4:115010577-115010599 TTAACTCGTCATTTAGCATAAGG - Intronic
979465761 4:121036712-121036734 CGAACGAGGTATTTAGCTTTAGG + Exonic
981338637 4:143594776-143594798 TGCTCTAGGTATTGAGCATCAGG + Intronic
981594692 4:146406647-146406669 GGAACTAGGCATTGAGCAGATGG - Intronic
981916289 4:150037095-150037117 TGAATAAGTTATTTAGGATAAGG - Intergenic
983206281 4:164913418-164913440 TTAACTAGTCATTTAGCATTAGG - Intergenic
983400793 4:167263125-167263147 TTAACTCGTTATTTAGCATTAGG - Intergenic
983941849 4:173542170-173542192 TGACCTAGGTATTTACAATGGGG + Intergenic
984159560 4:176234597-176234619 TGTGCTAGGTATTGAGGATATGG - Intronic
985684438 5:1274408-1274430 TGAAGCAGGTCTTTAGCACAGGG + Intronic
988177939 5:27751621-27751643 TAAAATAGGCATTTAGTATATGG - Intergenic
988248339 5:28719743-28719765 TTAACTAGTCATTTAGCATTAGG + Intergenic
988824589 5:34922561-34922583 TGAACAAGGAATTTAGCAGATGG - Exonic
989846630 5:46152290-46152312 TTAACTAGTCATTTAGCATTAGG - Intergenic
990237185 5:53780886-53780908 TGATCTAGGTGCTTAACATAGGG + Intergenic
991556392 5:67899585-67899607 TTAACTATTTACTTAGCATATGG - Intergenic
991639946 5:68742199-68742221 TGAACTAGGGTTATAGCAGAGGG - Intergenic
992601601 5:78406423-78406445 TGGAATAGGTGTTTAGAATATGG + Intronic
992670351 5:79054169-79054191 TGAATAAGGTATTTATCTTAAGG - Exonic
993236479 5:85316737-85316759 TGAACAAGATATATGGCATAGGG + Intergenic
993778123 5:92028257-92028279 TTACCTAGTTATTTAGCAGATGG - Intergenic
993973284 5:94445742-94445764 TGAACTAGGTATTTAGCATATGG - Intronic
994093620 5:95829347-95829369 TTAACTCGTTATTTAGCATTAGG + Intergenic
996004310 5:118402956-118402978 TTAACTAGTCATTTAGCATTAGG + Intergenic
996171129 5:120293137-120293159 TTAACTCGTTATTTAGCATTAGG + Intergenic
996511623 5:124322789-124322811 TTAACTCGTCATTTAGCATAAGG - Intergenic
996631025 5:125632590-125632612 TTAACTCGTCATTTAGCATAAGG - Intergenic
998487463 5:142515688-142515710 TCAACTAGTCATTTAGCATTAGG + Intergenic
1000357185 5:160410459-160410481 TGAACTCGTCATTTAGCATTAGG - Intronic
1003203832 6:3989401-3989423 AGAACTAGGTATTAAACACATGG + Intergenic
1005648618 6:27865941-27865963 TGAACTAGTTATTTAATGTAGGG + Intergenic
1005791043 6:29300907-29300929 TTAACTAGTCATTTAGCATTAGG - Intergenic
1006714853 6:36110978-36111000 TGAACGAAGTATTAAGCATTGGG + Exonic
1007301852 6:40873689-40873711 AGAACTAGGGATTTATCATATGG - Intergenic
1008119367 6:47593416-47593438 TGAAATAGGTATTTATCTAAAGG + Intronic
1008817257 6:55583295-55583317 TTAACTAGTCATTTAGCATTAGG + Intergenic
1009495971 6:64346593-64346615 TTAACTAGTCATTTAGCATTAGG - Intronic
1010292282 6:74151326-74151348 TGAACTCGTTATTTAGCATTAGG - Intergenic
1011024908 6:82856966-82856988 TCAACTCGGCATTTAGCATTAGG - Intergenic
1011257489 6:85437995-85438017 TTAACTAGTCATTTAGCATTAGG + Intergenic
1011700957 6:89954399-89954421 TTAACTAGTCATTTAGCATTAGG + Intronic
1012103423 6:95121667-95121689 TTAACTAGTCATTTAGCATTAGG - Intergenic
1012509312 6:99984360-99984382 TTAACTAGTCATTTAGCATTAGG + Intronic
1012821634 6:104091463-104091485 TGAACTTGTCATTTAGCATTAGG - Intergenic
1013461846 6:110381875-110381897 TTAACTCGTTATTTAGCATTAGG - Intergenic
1014876622 6:126668885-126668907 TGAACAAGTTACTTTGCATATGG + Intergenic
1015167465 6:130214043-130214065 TGAAATAGGTATGTAACACAAGG - Intronic
1018141986 6:160847071-160847093 TTAACTAGTCATTTAGCATTAGG - Intergenic
1020793876 7:12659743-12659765 GGAGCTAGTTATTTTGCATAGGG - Intergenic
1021082229 7:16378210-16378232 TTAACTTGTTATTTAGCATTAGG + Intronic
1021917681 7:25451469-25451491 TTAACTCGTTATTTAGCATTAGG - Intergenic
1023108420 7:36785932-36785954 TGAATTTGGAATTTTGCATAAGG + Intergenic
1024129569 7:46336837-46336859 TTAACTCGTTATTTAGCATTAGG + Intergenic
1024899030 7:54295726-54295748 TTAACTAGTCATTTAGCATTAGG - Intergenic
1025578067 7:62672889-62672911 TGAACTCGTCATTTAGCATTAGG - Intergenic
1025594356 7:62905327-62905349 TTAACTAGTTATTTAACATTAGG - Intergenic
1027478688 7:78667490-78667512 TTAACTCGTTATTTAGCATTAGG + Intronic
1027698771 7:81442910-81442932 TTAACTCGTTATTTAGCATTAGG + Intergenic
1028809253 7:95065404-95065426 TGAACTAGCTATCTAGAAAAAGG - Intronic
1030792032 7:113741854-113741876 TGAACTCGTCATTTAGCATTAGG - Intergenic
1031372335 7:120983487-120983509 TGAACTCGTCATTTAGCATTAGG + Intergenic
1032537120 7:132673498-132673520 TTAACTAGCCATTTAGCATTAGG + Intronic
1032596580 7:133246861-133246883 TGAACCAGGTATTGGGAATATGG + Intergenic
1032974782 7:137209924-137209946 TGAACTCGTCATTTAGCATTAGG + Intergenic
1033162201 7:139007596-139007618 GGGACTAGGTACTTGGCATAGGG + Intergenic
1034062054 7:148101174-148101196 TGAACTCGTCATTTAGCATTAGG - Intronic
1036916355 8:12807752-12807774 TTAACTCGTTATTTAGCATTAGG + Intergenic
1037084117 8:14826038-14826060 TTAACTAGTCATTTAGCATTAGG + Intronic
1038103011 8:24400738-24400760 TTAACTAGTCATTTAGCATTAGG + Intronic
1038389806 8:27185818-27185840 TGAACATGGTGTTTAACATACGG - Intergenic
1039299617 8:36195355-36195377 TTAACTCGTCATTTAGCATAAGG + Intergenic
1039346747 8:36713185-36713207 TTAACTCGTTATTTAGCATTAGG - Intergenic
1039592508 8:38761381-38761403 TGCATTTGGAATTTAGCATAAGG + Intronic
1040809511 8:51436015-51436037 TGAACAAGGAATTTAGCAGATGG - Intronic
1041025684 8:53683521-53683543 TTAACTAGTCATTTAGCATTAGG - Intergenic
1041035030 8:53780641-53780663 TTAACTAGTCATTTAGCATTAGG + Intronic
1041638113 8:60166398-60166420 TTAACTAGTCATTTAGCATTAGG - Intergenic
1042507681 8:69578453-69578475 TTAACTCGTCATTTAGCATAAGG + Intronic
1043875480 8:85481608-85481630 TTAACTAGTCATTTAGCATTAGG + Intergenic
1044041129 8:87369826-87369848 TTAACTAGTCATTTAGCATTAGG + Intronic
1045560049 8:103252835-103252857 TGAAATAGGTATGTATCACAGGG - Intergenic
1045938567 8:107712064-107712086 TCAACTAGTCATTTAGCATTAGG + Intergenic
1045973873 8:108109483-108109505 TCAACTAGTCATTTAGCATTAGG + Intergenic
1046356249 8:113088751-113088773 TTAACTAGTCATTTAGCATTAGG - Intronic
1046402929 8:113730828-113730850 TGAACTGAGAATCTAGCATACGG + Intergenic
1048091353 8:131243879-131243901 TGTGCAACGTATTTAGCATATGG + Intergenic
1048131412 8:131701891-131701913 AGAAGTAGGTATGGAGCATAGGG + Intergenic
1048239088 8:132723452-132723474 TGAAAAAGGTATTCAGCAAATGG - Intronic
1048520561 8:135150413-135150435 TTAACTAGTCATTTAGCATTAGG + Intergenic
1048546040 8:135388184-135388206 TGAACTACGTATGTAAAATAAGG - Intergenic
1050969021 9:11845186-11845208 TGAACTCGTCATTTAGCATTAGG - Intergenic
1051120864 9:13750659-13750681 TGAACAAGGCTTTCAGCATATGG + Intergenic
1051514344 9:17911785-17911807 TTAACTCGTTATTTAGCATTAGG + Intergenic
1052412529 9:28140738-28140760 TTAACCAAGTAATTAGCATATGG - Intronic
1053568600 9:39279835-39279857 TTAACTAGTCATTTAGCATTAGG - Intronic
1053581058 9:39404540-39404562 AGAACGATGTCTTTAGCATAAGG - Intergenic
1053845550 9:42232597-42232619 AGAACGATGTCTTTAGCATAAGG - Intergenic
1054102645 9:60963344-60963366 AGAACGATGTCTTTAGCATAAGG - Intergenic
1054128545 9:61339172-61339194 TTAACTAGTCATTTAGCATTAGG + Intergenic
1054256423 9:62818206-62818228 TTAACTAGTCATTTAGCATCAGG + Intergenic
1058652995 9:107194636-107194658 TGAGCTTGTTAATTAGCATAAGG + Intergenic
1059918908 9:119135769-119135791 TTAACTAGTCATTTAGCATTAGG - Intergenic
1187611926 X:20952798-20952820 GGAGATAGCTATTTAGCATAAGG - Intergenic
1190431348 X:50380553-50380575 TGAATTAGGCATTTAGTATATGG - Intronic
1190548055 X:51550470-51550492 TTAACTAGTCATTTAGCATTAGG + Intergenic
1190625620 X:52335924-52335946 TCACCTAGGTATTAAGCCTATGG + Intergenic
1191114279 X:56835764-56835786 TTAACTTGTTATTTAGCATTAGG + Intergenic
1191605978 X:63063205-63063227 TTAACTAGTCATTTAGCATTAGG - Intergenic
1192074012 X:67972071-67972093 TTAACTCGTTATTTAGCATTAGG - Intergenic
1192322629 X:70104136-70104158 TTAACTCGTTATTTAGCATTAGG - Intergenic
1192920495 X:75700805-75700827 TGAACTCGTCATTTAGCATTAGG + Intergenic
1193002115 X:76574586-76574608 TTAACTCGTCATTTAGCATAAGG + Intergenic
1193007173 X:76633371-76633393 TCAACTAGTTATTTATCATTAGG + Intergenic
1193400172 X:81032865-81032887 TGAACTCGTCATTTAGCATTAGG - Intergenic
1193513550 X:82434959-82434981 TTAACTAGTCATTTAGCATTAGG + Intergenic
1193583429 X:83292303-83292325 TTAACTCGTCATTTAGCATAAGG - Intergenic
1193739169 X:85197597-85197619 TTAACTAGTCATTTAGCATTAGG + Intergenic
1193786567 X:85766991-85767013 TTAACTAGATATTTAACATTAGG + Intergenic
1194817679 X:98464257-98464279 TCAACAAAGCATTTAGCATATGG + Intergenic
1194828215 X:98589933-98589955 TGTACTAGGTATGGAGCCTAGGG + Intergenic
1196614921 X:117757277-117757299 TTAACTCGTTATTTAGCATTAGG + Intergenic
1201501427 Y:14647142-14647164 AGAATTATGTATTTGGCATATGG + Intronic
1201675328 Y:16575670-16575692 TTAACTAGTCATTTAGCATTAGG - Intergenic
1201709074 Y:16969757-16969779 TTAACTTGTCATTTAGCATAAGG + Intergenic
1202274743 Y:23104611-23104633 TGAAGTATGGATTTTGCATATGG - Intergenic
1202291284 Y:23316077-23316099 TGAAGTATGGATTTTGCATATGG + Intergenic
1202427735 Y:24738345-24738367 TGAAGTATGGATTTTGCATATGG - Intergenic
1202443056 Y:24931745-24931767 TGAAGTATGGATTTTGCATATGG + Intergenic