ID: 993978019

View in Genome Browser
Species Human (GRCh38)
Location 5:94506197-94506219
Sequence ACTATGTAAGGCATTCATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993978019_993978024 26 Left 993978019 5:94506197-94506219 CCCGCATGAATGCCTTACATAGT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 993978024 5:94506246-94506268 TACAATTTTTCAAGCACTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 230
993978019_993978025 29 Left 993978019 5:94506197-94506219 CCCGCATGAATGCCTTACATAGT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 993978025 5:94506249-94506271 AATTTTTCAAGCACTGTTGGAGG 0: 1
1: 0
2: 0
3: 34
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993978019 Original CRISPR ACTATGTAAGGCATTCATGC GGG (reversed) Intronic