ID: 993978866

View in Genome Browser
Species Human (GRCh38)
Location 5:94516955-94516977
Sequence CAGGCATGCACTACCATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168222
Summary {0: 206, 1: 5145, 2: 16861, 3: 47810, 4: 98200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993978866_993978872 5 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978872 5:94516983-94517005 CCAGCTACTTAGGAGGCCTGAGG 0: 2
1: 42
2: 304
3: 1181
4: 5196
993978866_993978873 9 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128
993978866_993978869 -2 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978869 5:94516976-94516998 TGTAATCCCAGCTACTTAGGAGG 0: 2524
1: 109296
2: 239559
3: 264215
4: 478659
993978866_993978875 28 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978875 5:94517006-94517028 CAGGAGAATCGCTTGAACCCAGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
993978866_993978867 -5 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978867 5:94516973-94516995 GCCTGTAATCCCAGCTACTTAGG 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993978866 Original CRISPR CAGGCATGCACTACCATGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr