ID: 993978868

View in Genome Browser
Species Human (GRCh38)
Location 5:94516974-94516996
Sequence TCCTAAGTAGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1091027
Summary {0: 2491, 1: 108364, 2: 239729, 3: 264770, 4: 475673}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993978868_993978875 9 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978875 5:94517006-94517028 CAGGAGAATCGCTTGAACCCAGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
993978868_993978877 15 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978877 5:94517012-94517034 AATCGCTTGAACCCAGGAGGCGG 0: 15103
1: 56539
2: 96024
3: 126350
4: 89213
993978868_993978873 -10 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128
993978868_993978876 12 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978876 5:94517009-94517031 GAGAATCGCTTGAACCCAGGAGG 0: 23932
1: 88155
2: 151333
3: 195450
4: 141377
993978868_993978878 18 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978878 5:94517015-94517037 CGCTTGAACCCAGGAGGCGGAGG 0: 7267
1: 43573
2: 103113
3: 139830
4: 139583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993978868 Original CRISPR TCCTAAGTAGCTGGGATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr