ID: 993978873

View in Genome Browser
Species Human (GRCh38)
Location 5:94516987-94517009
Sequence CTACTTAGGAGGCCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3136
Summary {0: 2, 1: 41, 2: 209, 3: 756, 4: 2128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993978868_993978873 -10 Left 993978868 5:94516974-94516996 CCTGTAATCCCAGCTACTTAGGA 0: 2491
1: 108364
2: 239729
3: 264770
4: 475673
Right 993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128
993978866_993978873 9 Left 993978866 5:94516955-94516977 CCGGGCATGGTAGTGCATGCCTG 0: 206
1: 5145
2: 16861
3: 47810
4: 98200
Right 993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG 0: 2
1: 41
2: 209
3: 756
4: 2128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993978873 Original CRISPR CTACTTAGGAGGCCTGAGGC AGG Intronic
Too many off-targets to display for this crispr