ID: 993980700

View in Genome Browser
Species Human (GRCh38)
Location 5:94540124-94540146
Sequence CAGTTTGCCCAGAGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 13, 3: 71, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993980700_993980702 -10 Left 993980700 5:94540124-94540146 CCTTTTTCTCTCTGGGCAAACTG 0: 1
1: 0
2: 13
3: 71
4: 431
Right 993980702 5:94540137-94540159 GGGCAAACTGGTTGAATGAATGG 0: 2
1: 20
2: 29
3: 73
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993980700 Original CRISPR CAGTTTGCCCAGAGAGAAAA AGG (reversed) Intronic
900687334 1:3957109-3957131 CAGTTTGCCCATCTAGAAATTGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902790859 1:18766922-18766944 CAGTTTCCCCAACTAGAAAATGG - Intergenic
902800761 1:18828586-18828608 CAGTTTTCCCATCTAGAAAATGG + Intergenic
903346739 1:22689934-22689956 CAGTTTCCCCAGTGTAAAAAGGG - Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903975902 1:27150017-27150039 CTATTTTCCCAAAGAGAAAAAGG + Intronic
903980131 1:27180248-27180270 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
904824309 1:33264698-33264720 AAGGAGGCCCAGAGAGAAAATGG + Intronic
906225827 1:44120349-44120371 AAGCTTGCCCAGAGAGAGCAGGG + Intronic
906650616 1:47509949-47509971 CATTTTACCCAGAGAGATAAAGG + Intergenic
907532973 1:55120350-55120372 CATCTACCCCAGAGAGAAAAAGG - Intronic
909283566 1:73787846-73787868 AAGTTAGCCAAGAAAGAAAATGG + Intergenic
909825048 1:80117229-80117251 CAGTCTGCACAGAAAGAAAGAGG + Intergenic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
911131819 1:94396230-94396252 CAGTTTCCCCAGTTAGTAAAGGG + Intergenic
912175253 1:107147642-107147664 CTCTTTGCCAAGAGACAAAAGGG + Intronic
912507188 1:110164391-110164413 CAGTTTGTTCAGAGATAAAATGG + Intronic
912816987 1:112837395-112837417 TAGTATGCCCAGAGAGAGCACGG - Intergenic
912901030 1:113648664-113648686 CAGTTTTCCCACCTAGAAAATGG + Intronic
913000811 1:114578875-114578897 CAGTTTTCCCAGCTAAAAAATGG + Intronic
913221839 1:116666741-116666763 CGGATTCCCCAGAGAGAACAGGG + Exonic
915758505 1:158286948-158286970 CAACTTGCCCAGAGAGGTAAAGG - Intergenic
916568195 1:166000900-166000922 CAGTTTGCCCAGCTACAAAATGG + Intergenic
917434079 1:175000902-175000924 TAGTTTGCTCAGTTAGAAAATGG + Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917647918 1:177047174-177047196 CACCCAGCCCAGAGAGAAAAGGG + Intronic
917928075 1:179805624-179805646 CAGCTTGAGCAGAGAGAAACTGG - Intronic
919156628 1:193774565-193774587 AAGCTTGCCAAGAGAGAGAAAGG - Intergenic
919786830 1:201263447-201263469 CAGTTTCCTCAGACATAAAATGG - Intergenic
920061699 1:203231225-203231247 CAGTTTACACAGATAGTAAATGG - Intronic
920157838 1:203969878-203969900 CAGTCTGCACAGAGAGAGAGAGG + Intergenic
921491960 1:215788250-215788272 CCATGTTCCCAGAGAGAAAAGGG - Intronic
921845903 1:219881728-219881750 CAGTTTGCCCTGTGAAATAATGG - Intronic
923036207 1:230286904-230286926 CAGTTTCCCCAGGGGTAAAATGG - Intergenic
924296790 1:242595402-242595424 CAGTTTGCACAGAGAGGAAGAGG - Intergenic
1062774440 10:134532-134554 CTGTTTGCGCAGAGATGAAACGG + Exonic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1063585348 10:7347263-7347285 CAGGTTGCCCAGCAAGAAAGAGG - Intronic
1063602574 10:7495745-7495767 CATTTTACCCAGAGAGAAACAGG + Intergenic
1065252294 10:23827915-23827937 CTGTTTGCCCAGGGAAAGAATGG + Intronic
1065840761 10:29699002-29699024 CAGTGTGCTCAGAGACAAATTGG + Intronic
1065875948 10:29997094-29997116 CAGTTACCCCACTGAGAAAAGGG + Intergenic
1066585548 10:36930425-36930447 CAGTTTGTGTAGAGAGACAATGG - Intergenic
1066977022 10:42378512-42378534 CGGTTTGCACAGAGAGATAAAGG + Intergenic
1067271874 10:44798734-44798756 CAGTCTTGCCAGAGAGTAAAGGG + Intergenic
1069821249 10:71230003-71230025 CAGTTTGCCCAGCCATAAAAGGG - Intronic
1070144409 10:73763413-73763435 CAGAGTGCCAAGAGTGAAAAAGG - Intronic
1070752933 10:78974389-78974411 CAGATTACACAGGGAGAAAAAGG + Intergenic
1070806928 10:79276171-79276193 CAGTTTGCTTAGAGGTAAAAAGG - Intronic
1070909466 10:80105104-80105126 CATTTTTCCCAGTTAGAAAACGG + Intergenic
1073811544 10:107157521-107157543 CATTTTGCAAAGAGAAAAAAGGG + Intronic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1074764464 10:116690635-116690657 TAGGTACCCCAGAGAGAAAAAGG - Intronic
1075344596 10:121673021-121673043 GAGTTTGCCCAGAGGGCAAGAGG + Intergenic
1075574342 10:123567988-123568010 TGGTTGGCCCAGAAAGAAAATGG - Intergenic
1076654175 10:132011293-132011315 CAGTTTGCAGAGAGAGAAAGAGG - Intergenic
1076714352 10:132355778-132355800 CCCTTTCTCCAGAGAGAAAAGGG + Exonic
1077424049 11:2466215-2466237 CAGTTTCCCCAGCTACAAAATGG - Intronic
1078465629 11:11547961-11547983 CAAGTTGCTCAGAGAGTAAATGG + Intronic
1078472793 11:11605163-11605185 CACTTTCCCCAGACAGGAAACGG - Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1080010768 11:27457142-27457164 CAGTTTGCTCAGTGATAAAATGG + Intronic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1080810734 11:35701843-35701865 CAGTTTGCACAGAGAGAGAGAGG + Intronic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081896681 11:46593335-46593357 CAGTTTACCCACCCAGAAAAAGG + Intronic
1081940151 11:46934743-46934765 CAGTTTCCCTAGTTAGAAAATGG + Intergenic
1083243312 11:61405882-61405904 CAGTTTTCCCTTAGAGAAAATGG - Intronic
1083376444 11:62226639-62226661 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1085902587 11:80719455-80719477 CAGTTTGTGTAGAGAGACAATGG + Intergenic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1087397370 11:97617180-97617202 CAGGGTGCCAAGTGAGAAAATGG - Intergenic
1087440989 11:98183620-98183642 CAGTTTCACCAGGGTGAAAATGG + Intergenic
1087464952 11:98492563-98492585 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1088583681 11:111338792-111338814 CAGTTTCAGCAGAGATAAAAAGG + Intergenic
1089489020 11:118870131-118870153 TAGTTTGCCTGGAGAGAAACAGG + Intergenic
1090008999 11:123029208-123029230 CAGTTTGATCACAGACAAAATGG + Intergenic
1090165095 11:124538085-124538107 CAGATTCCCCAGTGAGAACAGGG - Intergenic
1090266825 11:125358701-125358723 CAGTTAGCCCAGGGAGAGGAAGG - Intronic
1091679629 12:2517590-2517612 GTCTTTACCCAGAGAGAAAAGGG - Intronic
1092143443 12:6199664-6199686 TAGTTGCCCCAGAGGGAAAAAGG - Intergenic
1092322342 12:7489724-7489746 CAGTTTGCTCAGAAGAAAAATGG - Intronic
1093686837 12:22066109-22066131 CAGTTACCCCTGAGAGATAATGG + Intronic
1093854346 12:24081857-24081879 GAGTTTGCCATGAGAGAAAGCGG - Intergenic
1094239950 12:28211196-28211218 CAGTTTGAACAGAGAAAAAGAGG + Intronic
1094316738 12:29144468-29144490 CAGTTTGCACAGGGAGAGACAGG + Intergenic
1095540722 12:43305730-43305752 CAGTTATCCCAGAGAAAAATAGG + Intergenic
1096439781 12:51631198-51631220 CAGATGGCACAGATAGAAAAGGG - Intronic
1097247673 12:57615498-57615520 CAGTTTGCCCTGAAACCAAAAGG - Exonic
1097453894 12:59772134-59772156 CTTTCTGCCCAGAGATAAAAAGG + Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1100210639 12:92395108-92395130 CAGTTTGGCCAGATAAGAAATGG + Intergenic
1100220476 12:92499652-92499674 GAGATTTCCAAGAGAGAAAATGG + Intergenic
1100385807 12:94103696-94103718 CAGTTTTCCCAAAGGTAAAATGG + Intergenic
1101079516 12:101168898-101168920 TGGTTTGTCCAGAGAGTAAAGGG + Intronic
1101501985 12:105312564-105312586 CACTTTTCCCAGAGTCAAAATGG - Intronic
1101569925 12:105944353-105944375 CAATCTCCCCACAGAGAAAATGG + Intergenic
1101702977 12:107192893-107192915 CAGTTTTCCCACTGATAAAATGG + Intergenic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1102410139 12:112710328-112710350 CAGTTTGCCCAGGAAGAACGGGG - Intronic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1102783021 12:115581894-115581916 CAATTTCCTCAGAGAGGAAAAGG + Intergenic
1102792406 12:115658294-115658316 GAGTTGGCCCAGGGAGGAAATGG + Intergenic
1103916299 12:124377364-124377386 CGGTTTCCCCATAGAGAAAACGG + Intronic
1104129880 12:125883284-125883306 AAGTTTGCCAAGATAGAAACTGG - Intergenic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1104360967 12:128132842-128132864 CGGATTTCACAGAGAGAAAAAGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104800443 12:131551952-131551974 CAGGTTGGACAGAGAAAAAAGGG + Intergenic
1104896695 12:132168347-132168369 CAGTTTCCCCTGAGTGAAACGGG + Intergenic
1106624223 13:31403613-31403635 CAGTTTGCATAGAGAGAAAGAGG - Intergenic
1107111623 13:36704227-36704249 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1108101152 13:46957636-46957658 CAGTTTTCCCAGTTATAAAATGG + Intergenic
1108204235 13:48072026-48072048 CAGTTTGCACACGGAGAAAGAGG - Intronic
1109388776 13:61667045-61667067 CAGATTGCACAGAGAGAAAGAGG + Intergenic
1109617186 13:64850918-64850940 CATTTTTACCTGAGAGAAAAGGG - Intergenic
1110257157 13:73444972-73444994 CAGTTTGCCCAGGGAGAGGGAGG - Intergenic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1112549243 13:100404231-100404253 CAGTTTGCACAGGGAGAAGGAGG + Intronic
1113304856 13:109066388-109066410 CAGTTTCAGCAGAAAGAAAATGG - Intronic
1113704406 13:112417120-112417142 TAGTTTTCCCAGATACAAAATGG + Intronic
1113968746 13:114172010-114172032 CAGTTTGCACAGAGAAAAAGAGG + Intergenic
1114237356 14:20834626-20834648 CAGTTAAACGAGAGAGAAAAAGG + Intergenic
1114912355 14:27216578-27216600 CAGTTTGCATAGAGAGAAAGAGG + Intergenic
1115130211 14:30045675-30045697 CAGTTTGCACACAGAGAGAGAGG - Intronic
1115543477 14:34444049-34444071 CATTTTGCACAGGGAGAAAGCGG - Intronic
1116104008 14:40476316-40476338 CCGTTGGTCCAGAGAGAACATGG - Intergenic
1116233399 14:42247437-42247459 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1116576737 14:46584951-46584973 CAGTTTACATAGAGAGAAAGAGG + Intergenic
1116726210 14:48563992-48564014 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1118241782 14:64066819-64066841 CAGTTTCCCCATCGATAAAATGG - Intronic
1118472295 14:66085779-66085801 CAGCATGCAAAGAGAGAAAAAGG + Intergenic
1118612979 14:67555802-67555824 CTGCTTGGCCAGAGAGAAAGGGG - Intronic
1118729484 14:68656415-68656437 CAGTTACCCCATTGAGAAAAGGG - Intronic
1118857447 14:69634979-69635001 CAGTTTGCCTAAAAAGATAATGG + Intronic
1119740467 14:77010756-77010778 CAGTTTCCCCACAAAGAAAATGG - Intergenic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1120046327 14:79811237-79811259 CACTTTGACCAAAGAGATAATGG + Intronic
1121793272 14:96714852-96714874 CAGTTGACCCTTAGAGAAAACGG + Intergenic
1122090835 14:99339033-99339055 CGGCTTGCCCAGATAGTAAATGG - Intergenic
1122265417 14:100544534-100544556 CAGTGTGTTCACAGAGAAAATGG + Intronic
1122945021 14:105004284-105004306 CTGTTTGCTCAGAAACAAAAAGG + Intronic
1123989265 15:25671293-25671315 CAGTTTTCTCTGAGAGAAAGTGG + Intergenic
1124476187 15:30037033-30037055 CAGTTTCCCCAGTCATAAAATGG + Intergenic
1125184707 15:36916898-36916920 CAGTTTCCCCAACCAGAAAATGG - Intronic
1125684407 15:41555268-41555290 TACTGTGCCCAGAGAGAGAAAGG + Intergenic
1126734197 15:51715243-51715265 CATATTTCCCAGAGACAAAAGGG - Intronic
1127567971 15:60212191-60212213 CAGTTTACACAGTGAAAAAAGGG - Intergenic
1127940396 15:63689461-63689483 CAGAATGCCAAGAGAGGAAATGG + Intronic
1127972169 15:63970187-63970209 CACTTTACCCTGAGAGATAAGGG - Intronic
1129115613 15:73363858-73363880 CAGTTTTCCCATTTAGAAAATGG - Intronic
1129509117 15:76107489-76107511 CAGTTTGCTCATATGGAAAATGG - Intronic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1130156411 15:81354406-81354428 CTGTTTGCCCAGTGTGAAATAGG + Intronic
1132132808 15:99299075-99299097 CATTTTGCCAAGATAGCAAACGG - Intronic
1132378614 15:101349526-101349548 GAATTTTCCCAGAGAGCAAATGG + Intronic
1133878357 16:9756890-9756912 CAGGTTCCCTAGAGAGAAAACGG - Intronic
1134556403 16:15169332-15169354 CAGTTTGCACAGTGAAAGAAGGG - Intergenic
1134600773 16:15531911-15531933 CAGGATGCCCAAAGAGAAATGGG + Intronic
1134916983 16:18081045-18081067 CAGTTTGCACAGTGAAAGAAGGG - Intergenic
1135304776 16:21358675-21358697 CAGTTTTCAAAGAGACAAAAAGG - Intergenic
1135823022 16:25701452-25701474 TAGTTTCCCCATAGAGAAAGAGG + Intronic
1136301517 16:29337801-29337823 CAGTTTTCAAAGAGACAAAAAGG - Intergenic
1136406899 16:30053373-30053395 CAGTTTCCCCAAACAGGAAAGGG + Intronic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136702998 16:32160367-32160389 CAGTTTAGCAAGTGAGAAAAGGG - Intergenic
1136764702 16:32767229-32767251 CAGTTTAGCAAGTGAGAAAAGGG + Intergenic
1136803397 16:33103155-33103177 CAGTTTAGCAAGTGAGAAAAGGG - Intergenic
1137372111 16:47917067-47917089 CTGTTTTCCCAGTGAGAAAATGG + Intergenic
1140408700 16:74728112-74728134 CAGTTTCCCCAGCTATAAAATGG + Intronic
1140947152 16:79779604-79779626 GAGATTGCCCAGAAAGAGAAAGG - Intergenic
1141485593 16:84337757-84337779 CAGTCAGACGAGAGAGAAAAAGG + Intergenic
1141750921 16:85957354-85957376 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1141756742 16:85996399-85996421 CAGTTTCCCCATACATAAAATGG - Intergenic
1142063220 16:88044498-88044520 CAGTTTTCAAAGAGACAAAAAGG - Intronic
1203067058 16_KI270728v1_random:1029354-1029376 CAGTTTAGCAAGTGAGAAAAGGG + Intergenic
1143587986 17:7860922-7860944 CACTTTGGCGAGGGAGAAAAAGG + Exonic
1146125881 17:30231134-30231156 CAGTTTCCCCAGCATGAAAATGG + Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1146954744 17:36930964-36930986 CACCCAGCCCAGAGAGAAAAAGG - Intergenic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1147245221 17:39115789-39115811 CAGTTTCCCCACTGAGAAAATGG - Intronic
1147952934 17:44117151-44117173 CAGACTGCCCAGAGAGATTAAGG + Intronic
1149496421 17:57120965-57120987 GAGTTTGCACAAATAGAAAATGG - Exonic
1149537481 17:57443769-57443791 CAGTTCCTCCAGAGACAAAAGGG + Intronic
1150382673 17:64733087-64733109 CAGTTTCCCCAGGTATAAAATGG + Intergenic
1151303310 17:73244931-73244953 CATTTCTCCCACAGAGAAAAGGG + Intronic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1152666670 17:81574372-81574394 CTGTTTCCCCAGGGAGGAAAGGG - Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1153925974 18:9835269-9835291 CAAACTGCCCCGAGAGAAAACGG + Intronic
1154365264 18:13702206-13702228 CAGTTTGCACAGGGAGAGAGAGG - Intronic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1154399167 18:14018737-14018759 CAGCCTGCCATGAGAGAAAAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155803551 18:30138985-30139007 CAGTTTACACAGAGAGAAAGAGG + Intergenic
1156019369 18:32582008-32582030 CAGTTTCCCCAGAGGTAAAATGG - Intergenic
1156985313 18:43344109-43344131 CAGTTTTCCCAGAGATAGAGTGG + Intergenic
1157013428 18:43680606-43680628 CAATTTGAACAGAGAGAAAGAGG + Intergenic
1157471325 18:47991290-47991312 CAGATTCCCCAGAGAAAAAAGGG + Intergenic
1157542542 18:48521935-48521957 CAGTTTCCCCAGGGAGAGAATGG + Intergenic
1157819046 18:50752057-50752079 CAGCTTACCCTGAGAGTAAAGGG + Intergenic
1158641399 18:59207013-59207035 CAGTTTGCCCAGGAAGATAGGGG - Intergenic
1159211777 18:65332361-65332383 CAGTTTTTCCAGCCAGAAAACGG + Intergenic
1159693847 18:71528133-71528155 CAGTATGGAAAGAGAGAAAACGG - Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160879026 19:1311196-1311218 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1160966487 19:1749058-1749080 CAGTTTGCACTGTGGGAAAATGG - Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1161217356 19:3101095-3101117 CAGTTTGACAGAAGAGAAAACGG - Intronic
1161543868 19:4867998-4868020 CAGTTTGGCCATAGGGGAAATGG - Intergenic
1161739019 19:6009002-6009024 CAGTTTTCTCAGGTAGAAAATGG + Intronic
1162078006 19:8201760-8201782 CAGTTTCCCAAGAAAGAAAAAGG + Intronic
1162205242 19:9050858-9050880 CAGTTTGCCCAGATATAGCATGG + Intergenic
1162599630 19:11658070-11658092 CAGTATGCCCTGAGAGAGAGAGG + Intergenic
1163042807 19:14615059-14615081 CAGTTTGCCCAGGTATAAAATGG - Intergenic
1163913843 19:20220951-20220973 CATTTTACCAAGAGAAAAAAGGG + Intergenic
1163984950 19:20937512-20937534 CAGTTTGTCCAAAAATAAAATGG - Intronic
1164237068 19:23346521-23346543 CAGTTAAACAAGAGAGAAAAAGG - Intronic
1164461195 19:28449521-28449543 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1165438248 19:35808645-35808667 CAGTTTCCCCATCTAGAAAATGG - Intronic
1165614492 19:37187755-37187777 CAGCTTGAACACAGAGAAAAGGG + Intronic
1166187009 19:41146797-41146819 CAGTTTCCCCAGTGGTAAAATGG - Intergenic
1166912708 19:46171540-46171562 TAATTTGCCCTGACAGAAAATGG - Intergenic
1167388172 19:49176936-49176958 CACTTTCCACAGAGAGAAACTGG - Intronic
1168238812 19:55079168-55079190 CAGTTTGCCCATCCATAAAATGG + Intronic
925483097 2:4298177-4298199 CAGTTTAAACAGAGATAAAATGG + Intergenic
925719445 2:6813303-6813325 CAGTCTGCCCACAGAGCAAGGGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926500628 2:13648847-13648869 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
926607293 2:14910158-14910180 CTGTTCTCCAAGAGAGAAAATGG + Intergenic
926924611 2:17974877-17974899 CATCTTACCCAGAGATAAAAAGG + Intronic
928296938 2:30091781-30091803 AATTTTGGCAAGAGAGAAAAAGG - Intergenic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
928719047 2:34098034-34098056 CAGAATACCCAGAGAGAAAGTGG - Intergenic
929057354 2:37889895-37889917 CAGATAGCCCAGAAGGAAAATGG - Intergenic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929179518 2:39020549-39020571 CAGCCTCCCCAAAGAGAAAAGGG - Intronic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929891906 2:45925268-45925290 CAGCATGCTTAGAGAGAAAAGGG - Intronic
930075483 2:47402670-47402692 CAGTTTGCTTAGAAAGAAAAAGG + Intergenic
930390055 2:50749375-50749397 CTTTTTTCCCACAGAGAAAAGGG + Intronic
931229130 2:60359230-60359252 CATTATTCCAAGAGAGAAAAAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
931984019 2:67724216-67724238 CAGTCTGCAAAGAGAGAAAAAGG + Intergenic
933168231 2:79097550-79097572 CAGTTAAACAAGAGAGAAAAAGG + Intergenic
933781389 2:85804384-85804406 CAGTTTCCTCAGAGTTAAAAGGG - Intergenic
934725542 2:96615579-96615601 CAGTTTTCAGAGAAAGAAAAAGG + Intronic
936373818 2:111924299-111924321 CAGTTTGCTCACAGGGAAAGTGG - Intronic
936870642 2:117131530-117131552 AAGTTTGCCCACAGTGAAGAAGG - Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
937711589 2:124985792-124985814 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
938462842 2:131509156-131509178 CAGGCTGCCCAGAGAGAGAGTGG - Intergenic
939496811 2:142935237-142935259 CAGTTAAACAAGAGAGAAAAAGG + Intronic
940202667 2:151168344-151168366 GAGTTGCCCCAGAGAAAAAAGGG + Intergenic
940569166 2:155408102-155408124 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
941373388 2:164696087-164696109 CAGTTTGCTCAGACATAAAAAGG + Intronic
941531377 2:166675423-166675445 CAGTTTGCACAGAGAAAAAGAGG + Intergenic
944524953 2:200609461-200609483 CTGCCTCCCCAGAGAGAAAAAGG - Intronic
946297197 2:218794541-218794563 CAGTTTGCCCAGGGAGAGGGAGG + Intronic
946993006 2:225357195-225357217 CAGTTTGATCAGAGAAAAATGGG - Intergenic
947288881 2:228549481-228549503 CAGTATACCCAGAGAGAGAGAGG + Intergenic
947785205 2:232811940-232811962 CAGTTTGCCCATCCATAAAATGG - Intronic
948797383 2:240411944-240411966 CAGGTTGCCAAGAGGGAATAGGG + Intergenic
1169737111 20:8849024-8849046 CAGTTTGTCCTGGGAGAGAATGG + Intronic
1169952366 20:11059315-11059337 CATTTTGCCCACTAAGAAAATGG - Intergenic
1170247860 20:14244147-14244169 CAGTTTCCCCAGCTACAAAATGG - Intronic
1170253103 20:14308133-14308155 CAGCTTGCCCAGAGCTAAACTGG + Intronic
1170933085 20:20786713-20786735 AAGTTTGCCTAGGAAGAAAATGG + Intergenic
1172112040 20:32552712-32552734 CACTGTGCCCAGCCAGAAAAAGG - Intronic
1174528179 20:51190215-51190237 CAGTTTCTCCAGCGATAAAATGG + Intergenic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175066024 20:56289532-56289554 CAGTTTGCCCATCGATACAATGG - Intergenic
1175642175 20:60639936-60639958 AACTTTGCCCAGAGAAAAGACGG - Intergenic
1177533935 21:22399988-22400010 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1177543086 21:22520787-22520809 CAGCTTGCACAGAGAGAAGGAGG - Intergenic
1177944674 21:27452960-27452982 CAGTAAGCTAAGAGAGAAAATGG + Intergenic
1179213409 21:39346813-39346835 CAGTTTTCCCAAAAGGAAAAAGG - Intronic
1179841940 21:44082212-44082234 CAGTTCGGTCAGAGAGAGAAGGG + Intronic
1180914023 22:19472733-19472755 TAGTTTCCCCATAGATAAAAGGG - Intronic
1181870842 22:25898101-25898123 CAGTTTGCTCAGAGGTAAAGTGG - Intronic
1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG + Intergenic
1182163070 22:28143086-28143108 CAGTTTCCACAGAGAGGGAAAGG - Intronic
1182352379 22:29706061-29706083 CAGTTTGCTCAGCTAGAAAACGG + Intergenic
1182786720 22:32914082-32914104 CAGTTTCCCCAAACACAAAATGG - Intronic
1183113425 22:35669949-35669971 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
1183553749 22:38508838-38508860 CAGTTGGCCCAGAAACACAAAGG - Intergenic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
1184799064 22:46749053-46749075 CAGTTTGCCCACCCACAAAATGG + Intergenic
1185059532 22:48599037-48599059 CGGCTTGCCCAGAGAGGACATGG - Intronic
1185280343 22:49967176-49967198 CAGTCTGCCCACAGAGCACAGGG - Intergenic
951208565 3:19949085-19949107 GAGTTTGCCCAGACGGAAATTGG + Intronic
951367460 3:21801569-21801591 CGTTTTGGCCAGAGAGAAAAAGG - Intronic
951628014 3:24687941-24687963 CATTTTGCCCAGAGAGAATTTGG + Intergenic
951841700 3:27041238-27041260 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
953260776 3:41337055-41337077 CAGTTTCCCCATCTAGAAAATGG - Intronic
953452871 3:43018714-43018736 CAATTTGTCCTGATAGAAAAAGG + Intronic
955321000 3:57974247-57974269 CAGTTTGCCCAGCTGTAAAATGG - Intergenic
955688020 3:61563907-61563929 GAGGATGCGCAGAGAGAAAAGGG - Intronic
956219206 3:66884207-66884229 CATTTTGCCCAGAGACAACTGGG - Intergenic
956350819 3:68334116-68334138 AAATTTGCCAAGAGAGTAAATGG + Intronic
958695714 3:97525797-97525819 CAGTCTGCCCAGAAACCAAATGG - Intronic
959978727 3:112490586-112490608 GTGTTTACCCAGGGAGAAAATGG - Intronic
960908495 3:122625109-122625131 CAGTTTGCTCAGCTAGAAATTGG - Intronic
961390011 3:126546820-126546842 CAGTTAGCCCATAGAGAAGTAGG - Intronic
961595745 3:128014784-128014806 CAGTTTTCACAGAGAGAGAAAGG - Intergenic
962257742 3:133883971-133883993 CAGCTGGCCCAGAGAAAAACTGG - Intronic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
963576166 3:147063069-147063091 CAGTCTGCACAGACAGAAAGAGG - Intergenic
963642169 3:147874330-147874352 CAGTTTGCTCATATATAAAATGG - Intergenic
963834796 3:150047467-150047489 CCATTTGCACGGAGAGAAAAGGG - Intronic
964744583 3:160000513-160000535 CAGTTTAGCAAGAGAGAGAAGGG - Intergenic
964833184 3:160909039-160909061 TAGGTTGCCAAGAGAGAACAGGG + Intronic
964855563 3:161141902-161141924 CAGTTTGCACAGAGAGAGAGAGG - Intronic
965354754 3:167659792-167659814 CAGTTTTCTCAGAGAGGCAATGG - Intergenic
965514944 3:169611185-169611207 CAGTTTCCCAAGAGACAGAATGG - Intronic
965614000 3:170574520-170574542 CAGTGTGCTCAGGAAGAAAAAGG - Intronic
965969724 3:174539946-174539968 CATTTTGCCAAGAGAGAATTAGG + Intronic
966350360 3:179027613-179027635 CACTTTGGCCTCAGAGAAAATGG + Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
968665813 4:1821850-1821872 CAGCTTGCCCAGACAGTGAAGGG - Intronic
970093956 4:12441520-12441542 CAGCCTGCCCACAGAGAAATAGG + Intergenic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
971238626 4:24867298-24867320 CAGTTTGCCCAGTCAGCAAGTGG + Intronic
971358713 4:25917050-25917072 CAGTTTGTCCACATATAAAATGG - Intronic
972103058 4:35446409-35446431 GATATTGCCCAAAGAGAAAAGGG + Intergenic
972275929 4:37557863-37557885 CAGTTTGCCCAGGAAGGCAAGGG - Intronic
972388452 4:38590199-38590221 CAGAACGCCCAGGGAGAAAATGG - Intergenic
973188680 4:47361982-47362004 TAATTTGCCTAGTGAGAAAATGG + Intronic
974189936 4:58491743-58491765 CAGTTTGCACAGAGAGAAACAGG + Intergenic
974225391 4:59036280-59036302 CAGTTAACACAGAAAGAAAAGGG - Intergenic
974649005 4:64730123-64730145 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
974958708 4:68673815-68673837 CAGTTAAACAAGAGAGAAAAAGG - Intergenic
974963791 4:68735767-68735789 CACTTTGCACAGGGAGAGAAAGG + Intergenic
975019505 4:69468961-69468983 CAGTTTGCACAGAGAAAAAGAGG - Intergenic
978644768 4:110916885-110916907 CAACTTGACAAGAGAGAAAAAGG + Intergenic
978951015 4:114559516-114559538 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
979352543 4:119661893-119661915 CAGTTTTCCCATATATAAAATGG + Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980618000 4:135258597-135258619 TATTATGCCCAGTGAGAAAAAGG - Intergenic
981567222 4:146114069-146114091 TAGCTTGCCCAGAGGGAGAAGGG + Intergenic
982399623 4:154952738-154952760 CAGTTTGCACAGGGAGAGAGAGG + Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
985303565 4:188514764-188514786 CTGTTTCCCCAGAGAGGAACTGG - Intergenic
986172831 5:5327579-5327601 CAGTTTCCCAAGAGAGAGCAGGG - Intergenic
987029818 5:13965280-13965302 CAGTTTATCCAGAGAATAAAAGG - Intergenic
987842109 5:23235079-23235101 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
988157803 5:27477225-27477247 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
988695182 5:33614783-33614805 CAGTTTGCCCATATACAAAGTGG + Intronic
989585873 5:43073570-43073592 CAGTTAAACAAGAGAGAAAAAGG + Intronic
989729824 5:44635587-44635609 CACTATGCCAAGGGAGAAAAGGG - Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990177623 5:53125699-53125721 CAGTTTCCCCAATTAGAAAATGG - Intergenic
990336169 5:54774860-54774882 CAGTTTGCACAGCGGCAAAAGGG + Intergenic
990524275 5:56609244-56609266 CAGTTTCCCCATATATAAAATGG + Intergenic
990662444 5:58031698-58031720 CAGTTTTACCAGAGATAAAGTGG + Intergenic
992105122 5:73444137-73444159 CTGTTTGCCTACAAAGAAAAGGG + Intergenic
992335301 5:75761245-75761267 TAGTTTGTCCAAAGACAAAAGGG - Intergenic
992909509 5:81381700-81381722 CAGTTTCCCCAGGGTGAAATGGG + Intronic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
995393468 5:111663673-111663695 CAGTTTGCTCAGGGAGAGGAAGG + Intronic
995581581 5:113607951-113607973 CAGTTTGCCCAGAGACAGAGAGG - Intergenic
996575428 5:124972679-124972701 CAGTTTGCACAGGGAGAGACAGG - Intergenic
998637568 5:143973029-143973051 AAGCTCACCCAGAGAGAAAAAGG + Intergenic
998869735 5:146540315-146540337 CAGGTTGCACAGGCAGAAAATGG + Intergenic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999359628 5:150972117-150972139 AGGTTTGCCCAGAGAGAGAGAGG + Intergenic
999362129 5:150994225-150994247 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
999650541 5:153763152-153763174 CTGTCTGCCTAGAGTGAAAAGGG + Intronic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1000344569 5:160304034-160304056 CAGGTGTCCCAGGGAGAAAATGG - Intronic
1000415679 5:160981135-160981157 CAGTTTGCACGCAGAGAGAAAGG - Intergenic
1000451324 5:161391621-161391643 AATCATGCCCAGAGAGAAAATGG + Intronic
1001596813 5:172903748-172903770 CAGTTTCCCCAGATGTAAAATGG - Intronic
1003455332 6:6276563-6276585 CAGTTTTCCCATATATAAAATGG - Intronic
1003966925 6:11261298-11261320 CAGTTTTGCCATATAGAAAATGG - Intronic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1007353219 6:41290886-41290908 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1007356783 6:41325668-41325690 CTGTTTGTCCAGAGATAAAGGGG - Intergenic
1008765816 6:54913483-54913505 CAGTTTGCCCGAGTAGAAAATGG + Intronic
1008862022 6:56160322-56160344 CAGTTTTCCTACACAGAAAATGG - Intronic
1012239176 6:96852629-96852651 CAGTATTGCCAGAGAGAGAATGG - Intergenic
1012804716 6:103879295-103879317 CAGTTTGCACAGGGAGAAGGAGG - Intergenic
1013236811 6:108204098-108204120 CATTTTACCAAGAGAGGAAATGG - Intergenic
1014111603 6:117623839-117623861 CAGTTTGCACAGAGAAAAAGAGG - Intergenic
1014163227 6:118194731-118194753 CGGTTTGCACAGAGAGAGAGGGG + Intronic
1014738306 6:125120757-125120779 CAGTTTGCATAGAGAGAAAGAGG - Intronic
1015113295 6:129618825-129618847 CAGATTGCCAAAAGACAAAACGG - Exonic
1015783631 6:136898427-136898449 CTGATTTCCCTGAGAGAAAAAGG + Intronic
1016233434 6:141833020-141833042 CAGTTTGCACAGGGAGAGACAGG - Intergenic
1016708121 6:147137687-147137709 CTGTTTGAACAGAGAGTAAATGG + Intergenic
1016840905 6:148524601-148524623 ACATTTGCCCAGAAAGAAAACGG - Intronic
1018141771 6:160844909-160844931 CAGTTAGCCCAGAGAAAAGATGG - Intergenic
1019415132 7:923603-923625 CAGTTTGCCCAGCTATAAGAGGG - Intronic
1019892947 7:3961498-3961520 CAGTTTCCCTAAAGAGAAAGTGG - Intronic
1020257336 7:6509424-6509446 CACTGTGCCCAGAGAGGGAAAGG - Intronic
1020567915 7:9821276-9821298 CAGTTTGCTAAGTGTGAAAATGG - Intergenic
1021702971 7:23338166-23338188 CAGGTGGTCCAGAGAGAAAGAGG + Intronic
1021776997 7:24063932-24063954 CAGCCTACCCAGTGAGAAAATGG - Intergenic
1021891653 7:25192168-25192190 CAGTTTGTACAGAGAGAAAGAGG + Intergenic
1023489432 7:40722583-40722605 CATTTGGCTCAGACAGAAAATGG + Intronic
1024063883 7:45717398-45717420 CAGTTTTCCCACAAATAAAAAGG - Exonic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024146709 7:46524002-46524024 CAGTTTGCACAGAAAGACAGAGG - Intergenic
1024328839 7:48136226-48136248 CAGTTTACACAGACAGAAAGAGG + Intergenic
1024438050 7:49382005-49382027 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
1024599543 7:50968099-50968121 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1027437868 7:78184233-78184255 TCTTATGCCCAGAGAGAAAATGG - Intronic
1027707490 7:81552538-81552560 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1029172425 7:98640458-98640480 AAGTTTCCGCAGAGAGAAGACGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030068430 7:105678341-105678363 CTGTGTGCCCAGAGAAATAAAGG - Intronic
1030701787 7:112648271-112648293 CGGTTTCTCCAGTGAGAAAAAGG + Intergenic
1031014716 7:116560532-116560554 CCCTTTGCCCAGAAAGAAGATGG + Exonic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1032266412 7:130373098-130373120 CAGCAAGCCCAGAGAGATAATGG + Intergenic
1032346646 7:131122628-131122650 CAGTTTCCCATGAGAGAGAAAGG + Intronic
1033850206 7:145485813-145485835 TGGTTTGCACAGAGAGAAAGAGG + Intergenic
1033873947 7:145791789-145791811 CAGTTTCCCCAGGTAGGAAAAGG + Intergenic
1034532248 7:151703051-151703073 CTGCCTGCCCAGGGAGAAAAGGG + Intronic
1035843580 8:2839249-2839271 GAGCTTGTCCAGAGAGAGAACGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037017318 8:13924934-13924956 CAGTTTTCCCATAAACAAAAGGG + Intergenic
1037432767 8:18831095-18831117 CAGTTTGCCCATCTATAAAATGG + Intronic
1038616174 8:29097206-29097228 GAGTATTCCCAGAGACAAAAGGG + Intronic
1039104210 8:33972725-33972747 TAGTTTCTCCAGGGAGAAAAGGG - Intergenic
1039889558 8:41674818-41674840 TAGTTTGGCCAGAGCTAAAAGGG - Intronic
1040285947 8:46100466-46100488 AAGTTACCCAAGAGAGAAAACGG - Intergenic
1040414197 8:47182433-47182455 CCAATTGCCCAGAGAGAACAGGG - Intergenic
1042077381 8:65011164-65011186 GACTTTGCCAAGAAAGAAAAAGG - Intergenic
1042505790 8:69558377-69558399 TAGTTAGGCCAGAGAAAAAAGGG - Intronic
1042970887 8:74407854-74407876 CAGTTTGCCAGCAGAAAAAAAGG - Intronic
1043784152 8:84375925-84375947 CAGTTTGCAAGGAAAGAAAATGG - Intronic
1044668251 8:94652838-94652860 CAGTTTCCCTAGTGATAAAATGG - Intronic
1045558879 8:103241335-103241357 CAGGTTGCCAAAGGAGAAAATGG - Intergenic
1047283570 8:123466653-123466675 CAGTTTGCCAGGGGGGAAAAGGG - Intronic
1047859573 8:128950139-128950161 CATTTTGCACAGAGAGATTAAGG + Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048132556 8:131713824-131713846 CAGTTTTCTCATAAAGAAAATGG - Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048359519 8:133685721-133685743 CAGTTTGCTCATAGAAACAATGG + Intergenic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1049001017 8:139825734-139825756 CAGCTTGCCCGGAAGGAAAAAGG + Intronic
1049232006 8:141489317-141489339 GGGGTTGCCCAGAGAGGAAAGGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049790627 8:144470861-144470883 CACTTTCCCCTGAGAGATAAGGG - Intronic
1050152917 9:2635009-2635031 CAGATTGCCCAGAGACCACAAGG - Intronic
1050801202 9:9616962-9616984 GAGTTAGCCCACAGAGTAAAGGG - Intronic
1051732411 9:20158872-20158894 CAGTTTTCCCAGATATATAATGG - Intergenic
1051908570 9:22126527-22126549 AAGTATACCCAAAGAGAAAAAGG - Intergenic
1052363040 9:27580444-27580466 CAGTTTCCCCAGCTACAAAATGG + Intergenic
1052689085 9:31792327-31792349 CAGATTTCACAGAGAGAAAATGG - Intergenic
1053320567 9:37094863-37094885 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1055798100 9:79998266-79998288 CAGCTTGTACACAGAGAAAATGG + Intergenic
1055805643 9:80089983-80090005 CAGTTTACCCAGGTACAAAAAGG - Intergenic
1056677585 9:88688175-88688197 CAGTTTGCACAGAAAGAGAGAGG - Intergenic
1056720599 9:89068350-89068372 CAGTTTACCCAGTAGGAAAATGG - Intronic
1059502748 9:114769100-114769122 CAATTTACCCAGAGAGAAAGTGG - Intergenic
1060128100 9:121069800-121069822 CACCTTGCCCAGCCAGAAAAAGG + Intergenic
1060164001 9:121393681-121393703 GAGTTTGGACTGAGAGAAAATGG + Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1060221947 9:121768785-121768807 GCATTTGCCCACAGAGAAAATGG - Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060533024 9:124359725-124359747 TGGTTGGCCCAGAGAGAAACCGG - Intronic
1061419001 9:130463270-130463292 CTCTGTCCCCAGAGAGAAAATGG - Intronic
1062343012 9:136102126-136102148 CAGCTGGCCCAGAGGGAAAGTGG + Intergenic
1186210755 X:7248151-7248173 CAGTTTGCAAAGACAGACAAAGG - Intronic
1186258873 X:7754416-7754438 AAGTTTGTACAGAGAGATAATGG + Intergenic
1186349198 X:8726463-8726485 CAGAATGCCCAGGGAGAAAGTGG - Intronic
1187037521 X:15557457-15557479 CATTTTACCAAGAGAAAAAAGGG + Intergenic
1187936923 X:24345301-24345323 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
1188212358 X:27441362-27441384 CAGTTTGTACAGAGAGAGAGAGG + Intergenic
1188692266 X:33144700-33144722 GAGTTTTCACAGAGAGCAAAAGG + Intronic
1188802592 X:34550141-34550163 CAGTTTGCACAGAGACAGAGAGG - Intergenic
1189172460 X:38923095-38923117 CAGTTTTCCCAACCAGAAAATGG - Intergenic
1189626573 X:42903457-42903479 CAGTTTCCCCAAAGAGACCACGG - Intergenic
1191857123 X:65636104-65636126 TAGATTGCCCAGGGAGAAACTGG - Intronic
1192282644 X:69701702-69701724 CAGTTAAACGAGAGAGAAAAAGG + Intronic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1193481760 X:82035905-82035927 CAGTTTGCACAGAGAGAGACAGG - Intergenic
1193508099 X:82367688-82367710 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1193699868 X:84747536-84747558 CAGTTTGCACGGGGAGAGAAAGG - Intergenic
1194051890 X:89079501-89079523 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1195502383 X:105616993-105617015 CAGTTTCCCCATACATAAAATGG + Intronic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196542740 X:116928642-116928664 TAGTTTGCACAGAAAGAAAGAGG + Intergenic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1196973623 X:121135976-121135998 CAGTTTGCACAGAGTTAAAGAGG + Intergenic
1197243238 X:124142433-124142455 CAGTTTGCACAGAGAGAAAGAGG + Intronic
1197278181 X:124504490-124504512 CAGGTTTCCAAGAGGGAAAATGG - Intronic
1197515962 X:127429307-127429329 CATTTTGCAAATAGAGAAAAGGG + Intergenic
1198151766 X:133917679-133917701 CATTTGTCCTAGAGAGAAAAAGG + Intronic
1198630116 X:138627826-138627848 CAGTATGCCCACATAGAAATTGG + Intergenic
1198797695 X:140416386-140416408 CACTTGGCTCAGAAAGAAAATGG + Intergenic
1199573938 X:149294804-149294826 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1200076558 X:153554184-153554206 GAGCTTGCCCTGGGAGAAAATGG + Intronic
1200438850 Y:3187775-3187797 CAGTTTGCACAGAGAAAGAGAGG + Intergenic
1200688097 Y:6275741-6275763 CAGGTTGCCAAAAGAGAACAAGG - Intergenic
1200734431 Y:6779045-6779067 CAGTTTGCACAGACAGAAAGAGG + Intergenic
1201047171 Y:9898959-9898981 CAGGTTGCCAAAAGAGAACAAGG + Intergenic
1201234403 Y:11895648-11895670 AAGTTTGCCCATAGTGAAAGAGG + Intergenic
1201325050 Y:12747693-12747715 CAGTTTTCTCTGGGAGAAAATGG + Intronic
1201863795 Y:18627816-18627838 AAGTATGCCCAGTGGGAAAAAGG + Intergenic
1201869527 Y:18692562-18692584 AAGTATGCCCAGTGGGAAAAAGG - Intergenic
1202585555 Y:26421933-26421955 CAGTTTGAACAGAAACAAAATGG + Intergenic