ID: 993987893

View in Genome Browser
Species Human (GRCh38)
Location 5:94618862-94618884
Sequence GAGGCTAGGAAGGAAGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993987885_993987893 1 Left 993987885 5:94618838-94618860 CCGAAGTTTCTGCCTCCCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 218
Right 993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG 0: 1
1: 0
2: 2
3: 38
4: 367
993987883_993987893 4 Left 993987883 5:94618835-94618857 CCTCCGAAGTTTCTGCCTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 248
Right 993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG 0: 1
1: 0
2: 2
3: 38
4: 367
993987882_993987893 14 Left 993987882 5:94618825-94618847 CCGGGCGGTACCTCCGAAGTTTC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG 0: 1
1: 0
2: 2
3: 38
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993987893 Original CRISPR GAGGCTAGGAAGGAAGCGGC TGG Intronic
900466437 1:2827798-2827820 GAAGGAAGGAAGGAAGGGGCAGG + Intergenic
900744349 1:4351137-4351159 GGGGCCCGGAAGGCAGCGGCAGG + Intergenic
900948523 1:5844653-5844675 GAGACTTGGAATGAAGCGGGTGG - Intergenic
901072782 1:6530892-6530914 GAGGCTAGGACTGAAGCCGCAGG - Intronic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
901804027 1:11726486-11726508 TTGGCTCGGAAGGAAGCTGCTGG - Intergenic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
903211029 1:21818827-21818849 GAGGCCAGGAAAGAAGGGGCAGG - Intronic
903674621 1:25056058-25056080 GAGGGTAGGAAGAAACGGGCAGG + Intergenic
904475696 1:30763460-30763482 CAGGCTAGGAAGGCAGCAGGAGG - Intergenic
904611643 1:31729086-31729108 GAGGCCAGGGAGGCAGCGCCTGG - Intronic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
907286115 1:53380970-53380992 GAAGGAAGGAAGGAAGGGGCTGG - Intergenic
907638478 1:56160198-56160220 TAGGTTTGGAAGGAAGAGGCAGG - Intergenic
908617709 1:65941155-65941177 GAGGATAGGAATGAAGCCTCAGG + Intronic
910452574 1:87361980-87362002 GAGGACAGGAAGGAGGTGGCGGG - Intergenic
910674414 1:89802219-89802241 CAGGCTAGGAAAGAAGTGGAGGG + Intronic
911133724 1:94417985-94418007 GAGCCCAGGAAGGAGGCGGACGG - Intergenic
911152214 1:94606759-94606781 AAGGCGAGGAAGGAAGCAGAGGG + Intergenic
911372504 1:97010936-97010958 GAGGGAAGGAAGGAAGGGTCTGG - Intergenic
912490424 1:110059761-110059783 GAGGCCAGCAAGGAAGGGGAAGG - Intronic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
915534450 1:156526596-156526618 GATCCTAGGAGGGAAGAGGCAGG + Exonic
915734687 1:158077396-158077418 GAGGCTGGGAAGCAAGAAGCGGG + Intronic
916208703 1:162340662-162340684 GAGGATAGGAAGGAAATGGGAGG + Intronic
917189587 1:172400417-172400439 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
917189597 1:172400444-172400466 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
920035115 1:203060515-203060537 GAGGATGGGAAGGAAGGGGCAGG - Intronic
920255637 1:204652276-204652298 GAGGCAAGGAGGAAGGCGGCGGG - Intronic
921325413 1:213983099-213983121 GAGGCTAGGAAGGGCGGGCCGGG + Intergenic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
922550389 1:226490173-226490195 GAGGCTGGGAAGCAAACAGCAGG + Intergenic
922795743 1:228338606-228338628 GAGGCTGGGAGGGCAGCTGCGGG - Intronic
922876309 1:228942545-228942567 GAGGCATGGAAGTCAGCGGCAGG - Intergenic
923691901 1:236202442-236202464 GACACTTGGAAAGAAGCGGCAGG - Intronic
924502940 1:244653432-244653454 GACGCCAGGCAGGAAGCGCCTGG - Intronic
924570399 1:245232844-245232866 GAGGAAAGGAAGGAAACCGCCGG - Intronic
1062904598 10:1171141-1171163 GAGGCTGGCACGGAAGGGGCTGG + Intergenic
1062906618 10:1183852-1183874 GAGGCCAGGAGGGAAGAGGATGG + Intronic
1063193585 10:3719410-3719432 CAGGCTGGGAACGAAGCAGCTGG + Intergenic
1063415491 10:5869651-5869673 GAGGCTGGGGAGGAACCGGCAGG + Intronic
1063487226 10:6431020-6431042 GAGGTTAGAAAAGAAGGGGCTGG - Intronic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1067299002 10:44992654-44992676 GCAGCTAGGAAGGAAAGGGCAGG + Intronic
1069899741 10:71700659-71700681 GAGGCTGGGAAGGGAGAGGAGGG + Intronic
1070427656 10:76304914-76304936 GAGGCTGAGAAGGCAGGGGCTGG + Intronic
1071511463 10:86264991-86265013 GTGGCTAGGAAGGAAAAGGCTGG - Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072545545 10:96434148-96434170 GAAGCTAGGAAGGAAATGTCAGG - Intronic
1072954251 10:99874869-99874891 GGGGCAGGGAAGGAAGTGGCAGG - Intergenic
1073137220 10:101226764-101226786 GAGGCGAGGAAGGAGCGGGCCGG + Exonic
1074024186 10:109616596-109616618 GAGGAGAGGAAGGAAACTGCAGG + Intergenic
1074115874 10:110457309-110457331 GAGGTTGGGAAGGCAGGGGCAGG - Intergenic
1074554520 10:114476143-114476165 GATGCTAGGGTGGAAGTGGCTGG + Intronic
1074967491 10:118504261-118504283 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1075894580 10:125983899-125983921 GAGGCCAGGCAGCAAGCAGCAGG + Intronic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1076071805 10:127496415-127496437 GATGCTGGGAAGTAAGTGGCTGG + Intergenic
1076543680 10:131230007-131230029 GAAGCAAGGAAGGGAGCAGCAGG + Intronic
1078447355 11:11414384-11414406 GAGGGTGGTAAGGAAGCGGGAGG - Intronic
1078729893 11:13964384-13964406 GAGCCTTGGACGGAAGCGGTGGG + Intronic
1079093142 11:17494561-17494583 GAGGCCAGGGAGAAAGCGGGAGG + Intronic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1080881480 11:36325328-36325350 GAGGGTTGGAAGTCAGCGGCAGG + Intronic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1082665977 11:55976771-55976793 GAGGCTAGGAAGAAAAGGGATGG - Intergenic
1082839037 11:57673482-57673504 TAAGCTAGGAAGGAAGTGGGAGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083809573 11:65096203-65096225 GAGGCTGGAAAGGAAGGGGACGG - Exonic
1083863802 11:65442444-65442466 CAGGCTATGAAGGAAATGGCTGG + Intergenic
1084461778 11:69300254-69300276 CAGGCCAGGCAGGAAGTGGCAGG + Intronic
1084808423 11:71596325-71596347 GACGCTAGGAAGGAAAGGGATGG + Intronic
1085530979 11:77191855-77191877 GAGGCTAGGAAGGCAATGGTGGG + Intronic
1089690289 11:120182889-120182911 GAGGCTGGGGAGGATGTGGCAGG + Intronic
1090052310 11:123390329-123390351 GAGGTGAGGAAGGAAGCAGATGG - Intergenic
1090498103 11:127234288-127234310 GGGGCTGGGTAGGAAGCTGCTGG + Intergenic
1091445701 12:543280-543302 GAGGCTGGGCAGAAAGGGGCCGG - Intronic
1092211180 12:6647335-6647357 GAGGGAAGGAAGCCAGCGGCTGG + Exonic
1092744372 12:11659829-11659851 GAGGTGAGGAAGGAAGAGGGAGG + Intronic
1094738753 12:33264470-33264492 GAGGGAAGGAAGGAAGGGGGAGG - Intergenic
1095208574 12:39466979-39467001 CAGGCTAAGAAGAAAGCTGCTGG - Intergenic
1096372801 12:51083195-51083217 GAGGCTCGGACGGGAGCGGTCGG - Intronic
1096869678 12:54585498-54585520 GAGGCTTGGAAGCAAGTGGAAGG + Intronic
1096889479 12:54753668-54753690 GAGGCTAGGAAGGAAGGATGAGG - Intergenic
1099169719 12:79349122-79349144 GAAGGTAGGAAGGAAGAGGAAGG + Intronic
1099169736 12:79349180-79349202 GAGGGAAGGAAGGAAGGGGAAGG + Intronic
1100738089 12:97560537-97560559 GAGGCTAATAATGAAGGGGCCGG + Intergenic
1101951663 12:109180974-109180996 GAGGCTGGAAAGGAAGAGGTAGG - Intronic
1102637290 12:114335593-114335615 CAGGCTGGGAAGGAAGAGGAGGG + Intergenic
1103509985 12:121467433-121467455 GAGGCGAGCCAGGAAGGGGCTGG + Intronic
1103512898 12:121487504-121487526 GAGGCTGCGATGGAAGCCGCAGG - Intronic
1104569528 12:129912669-129912691 GAGGGAAGGAAGGAAGCAGTGGG + Intergenic
1104937552 12:132374699-132374721 GAGGCTGGGAAGGCACCTGCTGG - Intergenic
1104983067 12:132582563-132582585 GGGGCTAGGAAGGATGAGGAGGG + Intronic
1106001873 13:25731249-25731271 GAAGGAAGGAAGGAAGCGGGAGG + Intronic
1106784736 13:33095383-33095405 GAGGCTAGGAAGGGTGTGGAGGG - Intergenic
1109839648 13:67905124-67905146 GACGCTAGGAAGAAAACGGGTGG + Intergenic
1111604404 13:90519503-90519525 GAGCCAAGGCAGGAAGTGGCTGG - Intergenic
1113341033 13:109426393-109426415 GAAGGAAGGAAGGAAGGGGCAGG - Intergenic
1118063858 14:62169108-62169130 GAGGATAGTAAGGAAGCAGGAGG + Intergenic
1118289690 14:64508036-64508058 GATACTGGGGAGGAAGCGGCAGG + Intronic
1119054697 14:71407483-71407505 GAGGGAAGGAAGGAAGGGGAGGG - Intronic
1119327976 14:73773374-73773396 GTGGGTAGGAAGGTAGAGGCTGG + Intronic
1119483693 14:74975086-74975108 AAGGACTGGAAGGAAGCGGCTGG - Intergenic
1119668220 14:76499517-76499539 GAAGCCAGGAAGGATGAGGCAGG - Intronic
1119680050 14:76585372-76585394 CAGGCTAGGAATGATGGGGCTGG - Intergenic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120044372 14:79789990-79790012 GAGGCCAGGAAGGCAGCAGAGGG + Intronic
1120044774 14:79793457-79793479 GAGGCTAGGAGGGAAGCACGAGG + Intronic
1120741236 14:88110969-88110991 GAGACTAGTAAGGGAGCAGCAGG + Intergenic
1120850125 14:89162514-89162536 GAGGAGATGAAAGAAGCGGCAGG - Exonic
1120974421 14:90236134-90236156 GGGGGTAGGAAGGAGGGGGCGGG - Intergenic
1121191425 14:92034120-92034142 GAGGCTAGAAAGGGAGCTGGAGG + Intronic
1121512845 14:94525432-94525454 GAGAAGAGGAAGGAAGGGGCTGG + Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121850283 14:97215585-97215607 GAAGCAAGGAAGGAAGGGGAGGG + Intergenic
1122632575 14:103113798-103113820 GAAGCCAGGAAGGGAGGGGCTGG - Intergenic
1122917549 14:104865847-104865869 CAGGCCAGGAGGGAGGCGGCCGG - Intronic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1124001848 15:25766701-25766723 GGTGCTGGGATGGAAGCGGCTGG - Intronic
1125510848 15:40291605-40291627 GAGGCTATGAAAGAAGCTGCGGG - Exonic
1125632877 15:41162361-41162383 GAATCTAGGAGGGAAGCGGGAGG - Intergenic
1126148263 15:45498258-45498280 GAGGATAGGAAGGAAACAGAAGG + Intronic
1126464712 15:48951234-48951256 GGGGGTAGGAAGGATGTGGCTGG - Intronic
1127592034 15:60434748-60434770 GAGGCTGGGAAGGAAATGGATGG + Intronic
1129187612 15:73919767-73919789 AATGCTATGCAGGAAGCGGCTGG + Intergenic
1129264221 15:74385439-74385461 CAGGCGAGGGAGGCAGCGGCTGG - Intergenic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130173327 15:81540633-81540655 GAGGCTAGGAAGAGTGCGGTGGG + Intergenic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132684463 16:1156520-1156542 GAGGCTTTGCAGGAGGCGGCAGG + Intronic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1134037564 16:11042413-11042435 GAGGACAGGAGGGAAGCTGCTGG + Intronic
1134065539 16:11225801-11225823 GAGGCTCAGAGGGAAGAGGCGGG - Intergenic
1134216171 16:12318491-12318513 GAGGATGGGAATGAAGCTGCCGG - Intronic
1134588904 16:15435630-15435652 GAGCCGAGGCAGGAAGCTGCCGG - Intronic
1134642881 16:15843392-15843414 GAAGAAAGGAAGGAAGAGGCCGG + Intronic
1136288761 16:29259303-29259325 GAGGCTGGGAAAGAAGTGGCAGG - Intergenic
1136559564 16:31031126-31031148 GAGGTTAGGAAGGATGTGGAAGG - Intergenic
1137414875 16:48266516-48266538 GAGGCAAGGAGGAAAGGGGCGGG - Intronic
1137706574 16:50539695-50539717 GAGGCCAGGAAGGCAGACGCAGG - Intergenic
1137775211 16:51048494-51048516 GAGGCTAGAAAGTCAGCAGCTGG - Intergenic
1138313341 16:56047034-56047056 GAGGCCAGGAAGGCAGTGGGAGG + Intergenic
1138448294 16:57078149-57078171 GAGGCAGGGAAGGAACAGGCAGG - Intronic
1138584424 16:57960815-57960837 GAGCCAAGGAAGGGAGAGGCAGG - Intronic
1139507079 16:67404167-67404189 TAAGTTAGGAAGGAAGCGGGAGG + Intronic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1142094485 16:88232209-88232231 GAGGCTGGGAAAGAAGTGGCAGG - Intergenic
1142128310 16:88421006-88421028 GGGGCTGGGAAGGAAGGGCCAGG + Intergenic
1142290915 16:89193260-89193282 GAGGTTAGGGAGGAGGGGGCCGG - Intronic
1142495827 17:305826-305848 GAGGGAAGGAAGAAAGGGGCTGG - Intronic
1143164229 17:4889936-4889958 GAGGCAGGGAAGGAAGAGGGAGG - Intronic
1143743956 17:8975960-8975982 GAGGCTTTGAAGGAAGCTGGAGG + Intergenic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1144422851 17:15113870-15113892 GAGGCTGGGGAGGTAGAGGCTGG + Intergenic
1145031272 17:19507113-19507135 GAGGCTAGGGAGGCTGAGGCAGG + Intronic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1147371714 17:39997215-39997237 GACACCAGGCAGGAAGCGGCGGG - Intronic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1147976163 17:44249457-44249479 GAGGGTGGGAAGGTAGGGGCGGG - Exonic
1148051610 17:44772445-44772467 GAGGCTGAGAAGGAAAAGGCAGG + Exonic
1148054862 17:44787876-44787898 GAGGCGAGCAGGGAAGGGGCAGG - Intergenic
1148153294 17:45409120-45409142 GAGGGCAGGATGGAAGCAGCGGG + Intronic
1148910559 17:50940182-50940204 GAGGGGAGGTAGGAAGAGGCTGG + Intergenic
1150678249 17:67263364-67263386 GAGACAAGGAAGAAAGTGGCCGG - Intergenic
1151791195 17:76307148-76307170 GGGGCTAGGAAGGAGGGGGTGGG + Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1152755049 17:82083729-82083751 GAGGCTAGGCAGGAGGCAGGTGG + Intronic
1153366756 18:4265463-4265485 GAAGGAAGGAAGGAAGGGGCTGG - Intronic
1155218297 18:23662540-23662562 GAGGCCCGGGAGGAAGCGGCGGG - Intronic
1155981685 18:32186834-32186856 GAGGCTAGGAAGGGAAGGGAAGG - Intronic
1157358352 18:46955515-46955537 GAAGGAAGGAAGGAAGCGTCAGG - Intronic
1157505324 18:48222181-48222203 GAGGCTAGGGAGGGTGCAGCAGG - Intronic
1157876126 18:51275259-51275281 CAGGATAGGAAGGGGGCGGCAGG - Intergenic
1158387981 18:57016201-57016223 GGGGCTGAGAGGGAAGCGGCCGG - Intronic
1158713190 18:59855167-59855189 GAAGGAAGGAAGGAAGGGGCTGG - Intergenic
1160560217 18:79751206-79751228 CAGGCTAGGGAGGGAGGGGCTGG + Intronic
1160667840 19:341424-341446 GGGGCAAAGAGGGAAGCGGCTGG + Intronic
1161139649 19:2639842-2639864 GAGGGAAGGAAGGAAGGGGAGGG + Intronic
1161781764 19:6297725-6297747 GAGCATAGGAAGGAAGCTGAGGG + Intergenic
1161994238 19:7702664-7702686 GAGGGAAGGAGGGAAGCGGGGGG + Intergenic
1162462358 19:10820629-10820651 GAGGTGGGGAAGGCAGCGGCAGG + Intronic
1163082364 19:14953255-14953277 GAGGCGAGGAGGGGAGGGGCGGG - Intronic
1163123589 19:15232457-15232479 GAGGCTGGGGAGGAAGAGGTTGG + Intronic
1163125631 19:15242960-15242982 GAGGCTTGGCAGGCTGCGGCGGG + Exonic
1163775126 19:19212980-19213002 GGGGCTGGGAAGTAAGGGGCTGG + Intronic
1164588734 19:29494628-29494650 GAGGGAAGGAAGGAAGGGGTGGG + Intergenic
1164588782 19:29494767-29494789 GAGGGAAGGAAGGAAGGGGTGGG + Intergenic
1164778355 19:30872295-30872317 GAGGCTAGGAAGAGAACGGTTGG - Intergenic
1165170830 19:33890474-33890496 GAGGATAGGAGGGAGGTGGCTGG + Intergenic
1165278971 19:34780661-34780683 GAGGGAAGGAAGGAAGGGGGAGG + Intergenic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165347423 19:35257641-35257663 CAGGCTAGGAGGAAAGAGGCCGG + Intronic
1165425374 19:35742616-35742638 GAGCCTGGGAAGGATGGGGCAGG + Exonic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1165743607 19:38217637-38217659 GAGGCCAGGGTGGAGGCGGCAGG - Intronic
1165792575 19:38500758-38500780 GATGCTGGGGAGGGAGCGGCTGG + Intronic
1166827874 19:45620798-45620820 GAGGCCAGGAAGGGAGGAGCAGG + Intronic
1167616420 19:50536805-50536827 AAGGGTGGGAAGGAAGGGGCTGG + Intronic
1168214047 19:54912240-54912262 TAGGCTCTGAAGGAAGGGGCTGG + Intronic
925447831 2:3942969-3942991 AAGGCTAGGGTGGACGCGGCAGG - Intergenic
926090327 2:10044821-10044843 GAGGGGAGGAGGGAAGAGGCTGG - Intronic
926136103 2:10337739-10337761 GAAGGTGGGAAGGAAGGGGCTGG - Intronic
926230834 2:11002676-11002698 GAGGAGAGGAGGGAAGGGGCTGG + Intergenic
926250878 2:11155106-11155128 GGGGCTAGGAGGGGAGGGGCGGG + Intergenic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926725487 2:15994246-15994268 GAGGAAAGGAAGGAAGGGGAAGG - Intergenic
929484568 2:42342254-42342276 TAGGCTAGGGTGGAAGAGGCAGG - Intronic
931097304 2:58955615-58955637 GAGGATAGAAAGGAAGGGGGAGG - Intergenic
931826284 2:66004146-66004168 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
933648191 2:84828986-84829008 GAGGCTAGGAAGTAAAAGGTGGG + Intronic
933772361 2:85752668-85752690 GAGCCTCGGAAGGGAGCGGCTGG + Intronic
933998990 2:87690872-87690894 GGGGCTAGGAAGGAAGTGGATGG - Intergenic
934085771 2:88508071-88508093 GAAGAAAGGAAGGAAGGGGCTGG + Intergenic
934124200 2:88870681-88870703 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
934791439 2:97065481-97065503 GGGGCTAGGAAGGAAGAGGATGG + Intergenic
934815001 2:97317062-97317084 GGGGCTAGGAAGGAAGAGGATGG - Intergenic
934822694 2:97391421-97391443 GGGGCTAGGAAGGAAGAGGATGG + Intergenic
935570760 2:104658647-104658669 GAAGGCAGGAAGGAAGCGGGCGG - Intergenic
935593747 2:104863909-104863931 GAGGCAAGGCCGGAGGCGGCCGG + Intergenic
935882581 2:107580431-107580453 GAGCATAGGAAGAAAGGGGCAGG + Intergenic
936294854 2:111260011-111260033 GGGGCTAGGAAGGAAGTGGATGG + Intergenic
937509843 2:122583065-122583087 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
938242780 2:129756185-129756207 AAGGGTAGGAAGGAAGAGGTGGG + Intergenic
941446255 2:165603507-165603529 GAGGAGAGGAAGGAAGTGGAAGG - Intronic
942104973 2:172624695-172624717 GAGAATAAGAAGGAAGGGGCAGG + Intergenic
942324607 2:174765407-174765429 GAGGCCTGGAAGGAACAGGCAGG - Intergenic
944295102 2:198052858-198052880 CAGGCTAGGAATGAAGGGGGAGG - Intronic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
946900662 2:224368499-224368521 CAGGCTAAGAAGGAAGCAGGAGG - Intergenic
947030207 2:225783503-225783525 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
947383916 2:229571536-229571558 GAGGTTAGAATGGAAGCTGCTGG - Intronic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948223825 2:236293490-236293512 GAGGCTGGGAGGTAAGCGGTTGG - Intergenic
948243457 2:236457797-236457819 GAGGCAAGGAAGGGAGCTTCTGG + Intronic
948539150 2:238674371-238674393 GAGGCTGGGAAGGGTGAGGCAGG - Intergenic
1169081390 20:2799582-2799604 GCTGCCAAGAAGGAAGCGGCGGG - Intronic
1169265702 20:4166206-4166228 GAGGCTTGGGATGAAGCTGCAGG + Intronic
1169524684 20:6411058-6411080 GAGGCTGGGAAGGATGGGGCAGG + Intergenic
1170879053 20:20278431-20278453 GAGGGAAGGAGGGAAGGGGCCGG + Intronic
1171185337 20:23120632-23120654 GAGACAAGGAAGGAAAGGGCAGG - Intergenic
1172029232 20:31969659-31969681 GAGGCTTGGAAGGAGGAGGGCGG - Intronic
1172350530 20:34235915-34235937 GAAGGAAGGAAGGAAGCGGGAGG + Intronic
1172486960 20:35304150-35304172 GAGGAGAGGAAGGAAGGGGACGG + Intronic
1173440055 20:43067990-43068012 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440086 20:43068064-43068086 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440096 20:43068086-43068108 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173784910 20:45785847-45785869 GAGACTAGGGAGGTAGCAGCGGG - Intronic
1174231011 20:49045758-49045780 GAGGAGAGGAGGGAAGCGGAAGG + Intergenic
1175364991 20:58447022-58447044 GAGCCTAGGGAGGATGCCGCTGG + Exonic
1175520535 20:59599888-59599910 GGGGCAAGGGAGGAAGCAGCAGG - Intronic
1176115506 20:63430255-63430277 GAGGCTGGGGAGGAGGCAGCCGG + Intronic
1176175534 20:63721635-63721657 AAGCCTAGGAAGGAAGAGGCTGG - Intronic
1176232896 20:64041053-64041075 GAGACTAGGAGAGAAGCCGCAGG + Intronic
1177090687 21:16763760-16763782 GAGGCTGGGAGGGTAGCAGCAGG + Intergenic
1178350518 21:31870058-31870080 AAGGGAAGGAAGGAAGCAGCTGG + Intergenic
1179080973 21:38170425-38170447 AAGACTTGGAAGGAAGTGGCAGG + Intronic
1179708500 21:43195900-43195922 GAGGTGGGGAAGGAAGGGGCGGG + Intergenic
1179987831 21:44931257-44931279 GAGGCGCGGGAGGAAGAGGCTGG - Intronic
1181130539 22:20729060-20729082 GAGCCTAGGGAGGTAGCAGCAGG - Intronic
1181328100 22:22066903-22066925 TAGACAAGGAAGGAAGCGGATGG - Intergenic
1181737476 22:24893063-24893085 GAAGGAAGGAAGGAAGCGGAGGG + Intronic
1182421589 22:30251081-30251103 GGGCCTAGGAAGGAAGCGGGGGG + Intergenic
1182877681 22:33706458-33706480 AAGGCTAGGAAAGAAGCCACAGG + Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1183815295 22:40295010-40295032 GAGGATAGAGAGGAAGCAGCTGG + Intronic
1184101586 22:42343970-42343992 GAGGCCCGGATGGAGGCGGCGGG + Intergenic
1184508209 22:44916904-44916926 GAGGCTTGGAAGGCAGCGCTTGG + Intronic
1184834497 22:47013133-47013155 GATCCTGGGAAGGAAGCGACTGG - Intronic
1185259800 22:49854971-49854993 GAGGCTAGGAAGGATTTGGTTGG + Intronic
1185298230 22:50064669-50064691 GCTGCTAGGAAGGAAGGGGCAGG + Intronic
949921084 3:9001073-9001095 GAGGCTAGGAAGGAAGGGGAGGG + Intronic
950113025 3:10432670-10432692 GAGGCTGGCAAGGAGGTGGCAGG + Intronic
950415621 3:12867509-12867531 GGGGCTAGGAAGGAAACACCAGG - Intronic
950701109 3:14747802-14747824 GAGGCTAGGAAGACAAAGGCAGG + Intronic
951242081 3:20298518-20298540 GAGGAGAGGAAGAAAGCAGCAGG - Intergenic
951809482 3:26683593-26683615 GAGGTTAGGAAGGCTGTGGCTGG + Intronic
952971253 3:38651586-38651608 AAGGCTAGGATAGAAGCTGCTGG + Intergenic
953004613 3:38966758-38966780 GAGGCTGGGAAGGATGTGGAGGG - Intergenic
953214006 3:40900940-40900962 GAGGCTGGGAAGGTAGTGGGTGG + Intergenic
953930783 3:47004767-47004789 GAGGCTAGGCAGGGAGGGGAAGG - Intronic
955911772 3:63864523-63864545 GAGCCCAGGAAGGAAGGGGGCGG - Intergenic
957043383 3:75354572-75354594 GATGCTAGGAAGAAAACGGGTGG - Intergenic
958450470 3:94266808-94266830 GAGGCTAGGTGGGAAGGGGAGGG - Intergenic
961537807 3:127580520-127580542 GAGGACAGGAAGGAAGGGGCAGG - Intronic
961673187 3:128549485-128549507 GAAGCCAGGCAGGAAGAGGCTGG + Intergenic
961713965 3:128846412-128846434 GGGGCTAGGAAGGAAACACCAGG + Intergenic
961785240 3:129343515-129343537 GGGGCTAGGAAGGAAACACCAGG - Intergenic
961873446 3:130003865-130003887 GAGGCTGGGAAAGAAGCAGAAGG + Intergenic
964327570 3:155563806-155563828 TAGGCTAGGAAGGGAGCTGAGGG - Intronic
964563961 3:158029399-158029421 GAAGCTGGGAAGGAAGAGGGAGG + Intergenic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
967991980 3:195138340-195138362 GAGACTAGGAGGGGAGAGGCTGG + Intronic
968542499 4:1175213-1175235 GAGGAGAGGAAGGAGGCGCCGGG + Intronic
968879521 4:3292152-3292174 GAAGGCAGGAAGGAAGGGGCAGG + Intergenic
969018761 4:4124363-4124385 GACGCTAGGAAGAAAAGGGCTGG - Intergenic
969100333 4:4763665-4763687 GCGGCTAGGAAGGAGGCAGCAGG - Intergenic
969728500 4:8939700-8939722 GAGACTGGGAAGGGAGCTGCAGG - Intergenic
969786532 4:9462151-9462173 GACGCTAGGAAGAAAAGGGCTGG + Intergenic
969789961 4:9486633-9486655 GACGCTAGGAAGAAAACGGGTGG + Intergenic
970824327 4:20253788-20253810 CCGGCGAGGAAGGAGGCGGCGGG + Exonic
971488623 4:27188010-27188032 GAGGCTAGGAAAAAGGAGGCTGG - Intergenic
974374799 4:61062214-61062236 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
978472568 4:109085981-109086003 GAGGCTACTAAGGAAGCCCCAGG + Intronic
981940917 4:150280781-150280803 GAGGCGAGGAAGGAAGCCACAGG - Intronic
982616548 4:157644431-157644453 CAGGAGATGAAGGAAGCGGCTGG - Intergenic
984261970 4:177453368-177453390 GAAGGGAGGAAGGAAGAGGCAGG - Intergenic
984533972 4:180949970-180949992 GTGGCTGGGAAGAAAGCTGCTGG - Intergenic
984875371 4:184363153-184363175 GGGGCTAGGATGGATGGGGCTGG + Intergenic
986240466 5:5955254-5955276 AAGGCAAGGAAGGAAGGGGAAGG - Intergenic
986294013 5:6422582-6422604 GAGGGAAGGAAGGAAGAGGGAGG + Intergenic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
986516806 5:8573088-8573110 GAGGCTGGGAGGGAAGCTGGAGG - Intergenic
987617226 5:20291955-20291977 GAGGCTAGGAAGGAAATTACGGG - Intronic
991025857 5:62028912-62028934 GGGGCTGTGAAGGAAGCTGCAGG - Intergenic
991606885 5:68411494-68411516 GAGGATGTGAAGGAAGCAGCAGG - Intergenic
992532628 5:77666861-77666883 GATGCTAGGTAGGAAGTGGTGGG + Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994349662 5:98729968-98729990 GGGGCTAGGAAGGAACCAGAGGG - Intergenic
996069393 5:119117569-119117591 GATGCTAGGAAGGGAGAGGTAGG + Intronic
999032181 5:148306331-148306353 GAGGCTAGGTGGGAAGGGGAGGG - Intergenic
1001739597 5:174041189-174041211 GAGGCCAGGAGAGAAGCTGCAGG - Intergenic
1002054548 5:176591247-176591269 GAGGCCAGGAAGACAGCAGCAGG + Exonic
1002720767 5:181260285-181260307 GGGGCAAGGAAGGAGGCGGGTGG + Exonic
1002785753 6:398726-398748 AAGCCTGGGAAGGAAGGGGCTGG - Intronic
1003084279 6:3049068-3049090 GAGGCCAGGGAGGAAGGCGCAGG + Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005519633 6:26588334-26588356 GAGGCTCGGAAGGCTGAGGCAGG - Intergenic
1005959359 6:30684868-30684890 GAGGCTGAGAAGGAGGAGGCGGG - Exonic
1006446325 6:34081740-34081762 GAGACAAGGAAGGAAACGGTGGG + Intronic
1006593348 6:35174113-35174135 GAGGCAAGGAAGGCAGGGGCAGG + Intergenic
1009519546 6:64664042-64664064 GAGGGATGGAAGTAAGCGGCAGG + Intronic
1013087626 6:106869825-106869847 GAAGCTAGGTAGGAAGTGGTGGG + Intergenic
1015151028 6:130037931-130037953 GAGGCTAGGAAGGGGGTGGGAGG - Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015751645 6:136566069-136566091 GAAGCTGTGAAGAAAGCGGCCGG + Intronic
1018875143 6:167815775-167815797 GAGGCAAGGAAAGACGGGGCTGG + Intergenic
1019262306 7:88398-88420 GTGACTAGGAAGGCAGCCGCTGG - Intergenic
1019606717 7:1913717-1913739 GAGGCTGAGAGGGAAGCAGCTGG + Intronic
1019894843 7:3975808-3975830 GTGGTTAGTTAGGAAGCGGCAGG + Intronic
1020426470 7:8071789-8071811 GTAGCTAGGAAGGAAGAAGCTGG - Intronic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1022663664 7:32388566-32388588 GATGCTAGAAAGGATGAGGCAGG + Intergenic
1023165760 7:37342361-37342383 GAAGCTAGGAAGGAGGTGGGAGG - Intronic
1023354414 7:39352890-39352912 GTGGCTGGGTAGGAAGGGGCAGG - Intronic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1026970147 7:74462840-74462862 GAGGCCCGGAGGGCAGCGGCAGG - Intronic
1028405895 7:90473381-90473403 GAGGCTAGCAAGGAAGGAGGAGG + Intronic
1028768832 7:94591706-94591728 GAGGCTAGAAAAGAAACGACAGG - Intronic
1028891619 7:95994403-95994425 CAGGCAAGGAAGGAAGTGGTTGG + Intronic
1029621375 7:101691893-101691915 GAAGGAAGGAAGGAAGGGGCCGG - Intergenic
1029708733 7:102288219-102288241 GAGGCCAGGAGGGAAGAGGTTGG - Intronic
1030279918 7:107762753-107762775 GAGGCTAAGATGGAAGCAGAGGG + Intergenic
1030326388 7:108223071-108223093 GAGGCTAGGATTTAAGAGGCAGG + Intronic
1032165831 7:129543924-129543946 GAGGCTGGGAAGGCAGCGTCTGG + Intergenic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1033126237 7:138709722-138709744 GAGGCTGGGGAGGAATCGTCGGG - Exonic
1034095624 7:148405193-148405215 GACCCCAGGAAGGAAGGGGCAGG + Intronic
1034164320 7:149014019-149014041 GAGAGAAGGAAGGAAGCGTCTGG - Intronic
1035081403 7:156219444-156219466 GATGCTGGGGAGGAAGCAGCAGG - Intergenic
1036544829 8:9757568-9757590 GGGGCTGGGAAGGAAGGAGCAGG - Intronic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1037759771 8:21734089-21734111 CAGGCTTGGAAGGAAGGGGTTGG - Intronic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1039064766 8:33598831-33598853 GAGGCCAGGAAGGGAGTGGAAGG - Intronic
1039615444 8:38951587-38951609 GAGCCTAGGAAGGCTGAGGCAGG - Intronic
1042307048 8:67343405-67343427 GAGGCGTGGAGGGCAGCGGCAGG + Exonic
1044562795 8:93629729-93629751 GACCCTAGGAAGGGAGCTGCAGG - Intergenic
1046695325 8:117333325-117333347 GCCACTAGGAAGGAAGAGGCTGG + Intergenic
1046752713 8:117942062-117942084 GAGGCTAAGACGGTAGCAGCAGG - Intronic
1046882848 8:119329363-119329385 GAGGCTGGGAAGGGTGGGGCAGG + Intergenic
1049685436 8:143937460-143937482 GAGGGAAGGAAGGAAGGGGTGGG + Intronic
1049848396 8:144816763-144816785 GAGGCTAGGAAGGATGGGGTGGG + Intergenic
1050789412 9:9447513-9447535 GAGGGTAGGAAGTAAGAGGGAGG + Intronic
1052832767 9:33229398-33229420 GAGGCTGGGAAGAAAGAGGTGGG + Intronic
1053311404 9:37023143-37023165 GAGCCTGGAAAGGAAGCAGCAGG + Intronic
1054909254 9:70438842-70438864 GAGGCTGGGAAGGAAGGTTCTGG + Intergenic
1055749216 9:79486367-79486389 GAGGGAAGGAAGGAAGAGGGAGG - Intergenic
1056790845 9:89624408-89624430 TATGCCAGGGAGGAAGCGGCTGG + Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057548916 9:96037987-96038009 GAAGCCAGGAAGGTAGAGGCTGG + Intergenic
1057784362 9:98075373-98075395 GAGGAAAGGAAGGAAACGGTGGG + Intronic
1060028082 9:120190070-120190092 GAGGCTGGGAGAGCAGCGGCTGG + Intergenic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1060468683 9:123929997-123930019 GAGGGAAGGGAGGAAGGGGCGGG - Exonic
1061901764 9:133676524-133676546 GAGGCTAGGAACTAAGTGACCGG + Intronic
1062169085 9:135124544-135124566 GAAGGAAGGAAGGAAGGGGCAGG + Intergenic
1062573028 9:137194254-137194276 GAGGCCAGGCAGGGAGAGGCTGG + Intronic
1062631507 9:137465113-137465135 GAGGCTGGGAGGGAAGCGCTTGG + Intronic
1062669230 9:137696868-137696890 GAGGAAAGGAAGGAAGACGCAGG - Intronic
1185953719 X:4465299-4465321 GAGGCAAGGAAGGAAGGGAGGGG + Intergenic
1187192241 X:17046095-17046117 GAGGCTAGGAAAGAAGAGGAGGG - Intronic
1189257956 X:39654751-39654773 GAGGCTGGGAAGGGAGAGGGGGG + Intergenic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1195959549 X:110371534-110371556 GAGGCTGGGAAGGTAGTGGGGGG - Intronic
1196965170 X:121047600-121047622 GCGACTAGGAAGGAAGGGTCCGG - Exonic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1199672056 X:150155641-150155663 GAGGGCAGGCAGGAAGAGGCAGG + Intergenic
1200037734 X:153344320-153344342 GAGGGTAGGAAGGCAGCAGCTGG - Intronic
1200171933 X:154083322-154083344 GAAGCCAGGAAGGAAGAGGGCGG + Intronic
1200204774 X:154307972-154307994 GAGGGTAGGAAGCAAGAAGCAGG + Intronic
1200258881 X:154601082-154601104 GAGGCCAGGAAGGCACCGGCCGG - Intergenic