ID: 993988237

View in Genome Browser
Species Human (GRCh38)
Location 5:94622938-94622960
Sequence GTACAACCCTTGGGAAAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993988237 Original CRISPR GTACAACCCTTGGGAAAAAG CGG (reversed) Intronic
905326197 1:37153560-37153582 TTACAGTCATTGGGAAAAAGAGG + Intergenic
906871263 1:49484162-49484184 GTACAACCACTGAGAAAAAACGG + Intronic
907019813 1:51055844-51055866 GAACAACTCTTGGGTCAAAGAGG - Intergenic
910484626 1:87699779-87699801 GTAAAACTCTTGAGAACAAGGGG - Intergenic
911768216 1:101705104-101705126 ATACAACCCTTGTCAAAAGGAGG + Intergenic
911971164 1:104439703-104439725 GCACAAATCTTGGGAAAAATGGG - Intergenic
914426280 1:147580046-147580068 GTACATCGCTTAGGCAAAAGAGG - Intronic
914988207 1:152477606-152477628 GGACAACCCTCAGCAAAAAGAGG + Intergenic
918546587 1:185691392-185691414 GAACAAACCTTTGGAAAAATAGG - Intergenic
919071212 1:192757203-192757225 ACACAACCCTTGGGCAAAAAGGG - Intergenic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
920090472 1:203449498-203449520 ACACAACCCTGGGGAAAAGGAGG - Intergenic
920144762 1:203849999-203850021 GCACAGACCTTGGAAAAAAGGGG + Exonic
921820382 1:219610129-219610151 GCACAGACCTTGGAAAAAAGGGG - Intergenic
921900086 1:220440968-220440990 GGACAACCAGTGGGAGAAAGAGG + Intergenic
923112312 1:230902078-230902100 GTACAACACTTAGAAAAAATTGG + Intergenic
924352284 1:243127535-243127557 GTACACCCCATGAGTAAAAGTGG - Intronic
1064142729 10:12804155-12804177 GTACTACACTTGGGAAAATTTGG + Intronic
1066278738 10:33893768-33893790 CTTCAACCCTTGGGAAAAGAAGG + Intergenic
1067261718 10:44698783-44698805 GAACATCCCATGGGAAGAAGAGG + Intergenic
1070458247 10:76639604-76639626 GTACAACATGTGGGAAAGAGGGG + Intergenic
1071926613 10:90416403-90416425 GTATAACCATTGGGGAAAACTGG + Intergenic
1072122139 10:92413892-92413914 GGTCAGCCCTAGGGAAAAAGAGG + Intergenic
1074669853 10:115777776-115777798 ATGCAACCCTTGGGGAAAAAAGG + Intronic
1074847855 10:117414303-117414325 GTTCAGCCCTTGGGGACAAGTGG + Intergenic
1075586409 10:123661457-123661479 GCACAACCCTTGGGGAAATCTGG - Intergenic
1080149177 11:29027891-29027913 ATACAACCATTGAGAAAATGAGG - Intergenic
1080670788 11:34375033-34375055 GAACAACCGTTGGGTCAAAGAGG - Intergenic
1080884152 11:36350044-36350066 GTTTAACCCTGGAGAAAAAGAGG + Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083215709 11:61218123-61218145 CTACATCACTTGCGAAAAAGTGG + Intergenic
1083218593 11:61236952-61236974 CTACATCACTTGCGAAAAAGTGG + Intergenic
1084988828 11:72903604-72903626 TTACATACCTTGGGAAAGAGTGG + Intronic
1089001651 11:115056972-115056994 GGACAACCCTTGTCATAAAGTGG + Intergenic
1090084439 11:123638979-123639001 GTACAGCCCTGGGGACAATGCGG - Intronic
1098693064 12:73514520-73514542 ATACAACTCTGGGGAAAAAGAGG + Intergenic
1099741900 12:86648476-86648498 TTAATACCCTTGTGAAAAAGAGG + Intronic
1100613190 12:96209048-96209070 GTGCAACCCTGGGGAGGAAGGGG - Intronic
1103252580 12:119513085-119513107 CTACAAACATTAGGAAAAAGCGG + Intronic
1106314740 13:28583352-28583374 GCTCTACACTTGGGAAAAAGAGG - Intergenic
1111881589 13:93964295-93964317 GTACTAACCCTGGGAAAATGAGG + Intronic
1114988586 14:28261535-28261557 CTACAACCCTAAGGAAACAGGGG - Intergenic
1115316440 14:32029685-32029707 GGGCAACCCTTGGCCAAAAGAGG - Intergenic
1116551079 14:46238572-46238594 CTACAATCCTTGAGAAAAAGAGG + Intergenic
1116575896 14:46574944-46574966 TAACAACACTTTGGAAAAAGTGG - Intergenic
1118256008 14:64206301-64206323 GTCCAAACCTAGAGAAAAAGTGG - Intronic
1120281217 14:82440607-82440629 GTACAACCATTTTGAAAAACTGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122906650 14:104804816-104804838 GGACAAACCTGGGGAAAGAGGGG - Intergenic
1123025750 14:105422925-105422947 GGACAACCCTTGAGAAGCAGAGG - Intronic
1123098986 14:105783015-105783037 GTCCAACTCTGGGGAAGAAGGGG + Intergenic
1130086306 15:80780500-80780522 GTCCGACCCTTGGGGAACAGCGG - Intronic
1133442236 16:5830509-5830531 GTATGACCCTCGGGAGAAAGGGG + Intergenic
1137027523 16:35492609-35492631 GCACATCCCTGGGGAAAGAGAGG - Intergenic
1141992775 16:87620072-87620094 GTAAACCCCTTGGGAAACAGAGG + Intronic
1148875795 17:50686433-50686455 GTCCCACCCTTGGGATAATGAGG - Intronic
1153997721 18:10455725-10455747 CTAGAACCCCTGGGGAAAAGTGG - Intronic
1154107925 18:11540250-11540272 GTAAAACCCCTTGGAAAAACTGG + Intergenic
1156938224 18:42736620-42736642 GTAAAACCCTAGGGATAAAGTGG + Intergenic
1157214313 18:45770121-45770143 GGACAACCTTTTGGAAACAGTGG - Intergenic
1157309861 18:46544548-46544570 GTACAACATTTGGGACAAAGTGG - Intronic
1158929143 18:62304064-62304086 GTAGAACCACTGGCAAAAAGAGG + Intronic
1162293836 19:9799126-9799148 GTACAACTCTTGGGAATCAAAGG - Intergenic
1166523458 19:43496370-43496392 GTGAGACCCTTGGGAAAAAATGG - Intronic
1167268581 19:48495421-48495443 GTAGTTCACTTGGGAAAAAGCGG + Intronic
927037573 2:19195095-19195117 GTACAAGCCATGGGTACAAGGGG + Intergenic
928247276 2:29641460-29641482 GAACAGCCCCTGGGAAAAACAGG + Intronic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
933059539 2:77720220-77720242 TTTCAACTCTTGGGAAAAAAGGG - Intergenic
935880697 2:107562229-107562251 GTACAACAGTTTGGAAAAGGGGG - Intergenic
938019952 2:127898124-127898146 ATACAACCAATGGGAGAAAGTGG + Intergenic
939976738 2:148726370-148726392 GTACAGCCCTTATGAAAAACAGG - Intronic
942600480 2:177635756-177635778 GTACTACCATTTGTAAAAAGGGG - Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
948566491 2:238890424-238890446 GCACAAGCCTTGTAAAAAAGAGG + Intronic
1170221069 20:13942028-13942050 ATAAAGCTCTTGGGAAAAAGAGG + Intronic
1170721582 20:18885141-18885163 GAACAACCATTGGGTCAAAGAGG + Intergenic
1171137895 20:22713439-22713461 GTTCAACCATTGTGAAAAAACGG - Intergenic
1173598246 20:44274109-44274131 GTCCATCCCTTGGTAACAAGAGG - Intronic
1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG + Intergenic
1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG + Exonic
1178102867 21:29288973-29288995 TTACATCCCTTAGGAAAAACAGG - Intronic
951486105 3:23211909-23211931 GTACAAACTTTGGAAAAATGAGG + Intronic
954745488 3:52785322-52785344 GTACTACTCTGGGGAAAGAGAGG - Intronic
955058420 3:55475687-55475709 GCACAACCTATGGGGAAAAGAGG + Intronic
959850706 3:111083214-111083236 GGACAACTCTTGGGAAAGAAAGG + Intronic
963327831 3:143881552-143881574 GGGCAACCCTTAGGAGAAAGAGG + Intergenic
967260398 3:187635925-187635947 GTACAGCCTTTGGGACACAGAGG - Intergenic
970340119 4:15097414-15097436 GGACAACCATGGAGAAAAAGTGG + Intergenic
971148393 4:24004974-24004996 GGAAAGCCCTTGGGAAAAAAGGG - Intergenic
971465843 4:26959763-26959785 GTGAAAGCCTAGGGAAAAAGAGG - Intronic
973659837 4:53093091-53093113 GTTAAAACATTGGGAAAAAGAGG + Intronic
975599444 4:76084017-76084039 GAATAACCCTGGGGTAAAAGAGG - Intronic
979249661 4:118552990-118553012 GTATAACCCATGAGTAAAAGTGG + Intergenic
980401357 4:132290164-132290186 GTACAACCACTAGGAAAAAAAGG + Intergenic
980501656 4:133662990-133663012 GTGCAAACCTTGGGTCAAAGTGG + Intergenic
981600392 4:146481579-146481601 GCATAACTCTTGGGAAGAAGGGG - Intronic
982345287 4:154351157-154351179 GGACAACAGGTGGGAAAAAGGGG + Intronic
982624221 4:157745253-157745275 GTACAGCCATTAGGAAAAACAGG + Intergenic
988768914 5:34411382-34411404 TTACAAGGCTTGGGAAAAAGGGG - Intergenic
990284972 5:54292148-54292170 CTACAAGACTTAGGAAAAAGTGG - Intronic
992025790 5:72667421-72667443 GCAGAACCCTTGGCAAAAAATGG - Intergenic
992752776 5:79876115-79876137 TTACCACTCTTGGGAAAAAGTGG - Intergenic
993566369 5:89480943-89480965 GATCAAGCCTTTGGAAAAAGTGG - Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
996117680 5:119635463-119635485 ATATAGCCCTTGGGGAAAAGGGG + Intronic
997660004 5:135582238-135582260 GTACAACGCCTGGGACACAGTGG - Intergenic
998018501 5:138751778-138751800 GAACAACCTTTAAGAAAAAGAGG - Intronic
1000430261 5:161143307-161143329 GTACAAGCATTGGGAGAAATTGG - Intergenic
1001206252 5:169765945-169765967 GGACAACGGTTGGGGAAAAGAGG + Intronic
1001448182 5:171803302-171803324 GTACAACCTTAGGGAAAATATGG + Intergenic
1001799730 5:174532530-174532552 GAAAGACCCTTTGGAAAAAGAGG - Intergenic
1003209310 6:4046219-4046241 GTACAACCCTTATAAAAGAGTGG - Intronic
1007004120 6:38343992-38344014 GAACAAAACTTGGGAAAGAGAGG + Intronic
1007952607 6:45885700-45885722 GTAGAGACCTTGGGAGAAAGTGG + Intergenic
1009565256 6:65304433-65304455 GCACAGACCTTGGAAAAAAGGGG + Intronic
1013271463 6:108549481-108549503 GTACAACAATTGTGAAAAAGTGG + Intergenic
1024154322 7:46604801-46604823 ATAAAGCCCTTGGGAACAAGGGG + Intergenic
1028680098 7:93517972-93517994 GCAGAACCTTTGGGAAAAAATGG + Intronic
1028961666 7:96755826-96755848 GAACACCCCTCTGGAAAAAGAGG + Intergenic
1029696432 7:102216475-102216497 ATTGAACCCTTGAGAAAAAGAGG + Intronic
1031575051 7:123405473-123405495 GGACAACCTGTGGGAAAAAGTGG - Intergenic
1032660782 7:133981665-133981687 GTTCAACCATTGTGAAAAACAGG + Intronic
1038010595 8:23472722-23472744 GTCCAATCCTAGGGAAAATGTGG + Intergenic
1040106885 8:43546522-43546544 GTACCACCTGTGGGAAAAACAGG + Intergenic
1043555082 8:81421183-81421205 GTACATCCCCTGGGAATTAGTGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048209659 8:132444149-132444171 TCACACCCCTTGGGAAATAGGGG - Intronic
1049789024 8:144464630-144464652 GGAGAACACGTGGGAAAAAGAGG + Intronic
1051163517 9:14235841-14235863 GTTCAAGCCTTGGGGATAAGTGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1056592825 9:87977539-87977561 ATACAACCCCTTGGAAAAACTGG + Intergenic
1057539896 9:95957469-95957491 TAACCAACCTTGGGAAAAAGTGG + Intronic
1058519143 9:105802121-105802143 GTACATCCCCTGTGAAAATGGGG + Intergenic
1058922120 9:109627124-109627146 GTCTAACCATTGGGACAAAGGGG + Intergenic
1062631754 9:137466223-137466245 TTACAGCCCCTGGGAATAAGAGG - Intronic
1186203098 X:7173891-7173913 GTAGAATCTTTGGGAGAAAGTGG + Intergenic
1192463379 X:71337123-71337145 GAGCAACCTTTGGGAAACAGAGG - Intergenic
1193415384 X:81216186-81216208 CTATAACCCTTGGAAAAGAGAGG - Intronic
1196343336 X:114622743-114622765 CTATAACCCCTGGTAAAAAGTGG + Intronic