ID: 993992442

View in Genome Browser
Species Human (GRCh38)
Location 5:94676333-94676355
Sequence TAGTCTCCAGAAAACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993992442_993992445 10 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG 0: 1
1: 0
2: 0
3: 2
4: 67
993992442_993992451 21 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992451 5:94676377-94676399 GATCACACCAGGGGAGGTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 156
993992442_993992446 11 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992446 5:94676367-94676389 TAGTCCTGCCGATCACACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 47
993992442_993992449 15 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992449 5:94676371-94676393 CCTGCCGATCACACCAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 99
993992442_993992447 12 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992447 5:94676368-94676390 AGTCCTGCCGATCACACCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993992442 Original CRISPR TAGTCTCCAGAAAACACTGC AGG (reversed) Intronic
902737234 1:18409179-18409201 AAGTCTCCAGAGAACACTCAGGG + Intergenic
902890087 1:19436878-19436900 CAACCTCCAGAAAACAGTGCTGG + Intronic
908046076 1:60170189-60170211 CAGTCTTCATAAAACACTGTGGG - Intergenic
908531111 1:65035118-65035140 TTGTTTCCAGAAAATACTTCAGG + Intergenic
909803797 1:79849050-79849072 TAGTTACCAGAAAAAAATGCTGG - Intergenic
910792320 1:91064284-91064306 TTGTCTCAAGAAAACACTAGAGG + Intergenic
912549814 1:110477969-110477991 CAGTGCCCTGAAAACACTGCAGG + Intergenic
913419217 1:118646118-118646140 GAGTCTTCAGAAGACACTGAAGG - Intergenic
915591002 1:156870223-156870245 TAGTTTCTAGAAAACACAGATGG - Intronic
917687047 1:177427292-177427314 TAGTGTCCAGAAAACAGAGCAGG + Intergenic
917696624 1:177532382-177532404 AAGTGTCCAGAAAACAAAGCTGG + Intergenic
917787262 1:178472043-178472065 TAGTTTTCAGAAAACAACGCAGG - Intronic
921869151 1:220119497-220119519 TATTCTTCAGAAAAAAATGCAGG - Intronic
923537506 1:234864355-234864377 TGAGCTCCAGAAAACAGTGCAGG + Intergenic
1065180862 10:23123551-23123573 AAGTCTTCAGTAAACAGTGCTGG - Intergenic
1066701271 10:38131424-38131446 TAGTCTTCAAAAAACAGTGCCGG - Intergenic
1068953487 10:62801758-62801780 CAGCCTCCAGAATACACTACAGG + Intergenic
1070115687 10:73526586-73526608 TGGTCCCCAGACAAAACTGCCGG + Intronic
1071232619 10:83606374-83606396 CAGGCTCCATAAGACACTGCTGG - Intergenic
1071728466 10:88223213-88223235 TAGTGTTTAGAAAAAACTGCCGG - Intergenic
1071966751 10:90859001-90859023 TAAACTACAGAAATCACTGCTGG - Intergenic
1072566041 10:96617575-96617597 TAGTCTCCAGGAAGGTCTGCTGG - Intronic
1073620545 10:105043007-105043029 AAGTCTCAAGGAACCACTGCTGG - Intronic
1075576296 10:123580180-123580202 TAGAATCCAGAAAACCCTGGAGG - Intergenic
1076756838 10:132577030-132577052 TGGGCTCCAGAAAACTCTGAGGG + Intronic
1078559601 11:12359195-12359217 TAGTGTTCACCAAACACTGCTGG + Intergenic
1085344393 11:75758582-75758604 AAGTCACCAGAAAACACTATTGG - Intergenic
1085756820 11:79208779-79208801 AAGTATGCAGAAAACACTCCAGG - Intronic
1087726286 11:101720706-101720728 TAGTCTTCTTAAAACACTGAAGG - Intronic
1088466559 11:110146356-110146378 TAGTCTCCACAAGACAGAGCAGG + Intronic
1089337353 11:117734364-117734386 CAGTCTCCGGAAAACCTTGCTGG + Intronic
1090606887 11:128430978-128431000 TAGTTTCCAGAAAACATTGAGGG - Intergenic
1092001308 12:5034572-5034594 TAGTCACCAGAAGCCACTGCTGG - Intergenic
1092531231 12:9347281-9347303 TAATCTACAGAAAACTTTGCTGG + Intergenic
1092977651 12:13760892-13760914 TAGTCACCAGAAAAAAATGATGG - Intronic
1093342536 12:17996623-17996645 CAGTCACTAGAAAACAATGCAGG - Intergenic
1093728999 12:22546338-22546360 CAGACTCCAGAAAAAGCTGCAGG - Intergenic
1096980132 12:55723964-55723986 GAGTCTGGAGAAAACCCTGCAGG + Exonic
1098890870 12:76009336-76009358 TAGTCTTCACCAGACACTGCAGG + Intergenic
1100857222 12:98768183-98768205 TAGACTCCAGAATACAGAGCAGG + Intronic
1104352092 12:128053667-128053689 CAGTCTCCTCAAAACACTGCAGG + Intergenic
1106692795 13:32136512-32136534 TAATCTCCAGAAAAAAAAGCAGG - Intronic
1106959409 13:34980380-34980402 TAGAAACCAGAAAACATTGCTGG - Intronic
1108744263 13:53374924-53374946 TAGTCTCCTGAAGAATCTGCAGG + Intergenic
1108757939 13:53526872-53526894 TACTCTACAGAGAACAATGCAGG + Intergenic
1109023755 13:57133689-57133711 TGGTCTCTAGGAAACACTACAGG + Intergenic
1109735330 13:66476763-66476785 TAGTCTCCTGATAACACTCCTGG - Intronic
1110179754 13:72602001-72602023 CAATCTGCAGGAAACACTGCTGG + Intergenic
1110234233 13:73199660-73199682 TAGTCTCTAGGACACACTGGAGG - Intergenic
1110756914 13:79185595-79185617 AAGTATTCAAAAAACACTGCTGG - Intergenic
1111935297 13:94551023-94551045 CATTCTCCTCAAAACACTGCAGG + Intergenic
1113104468 13:106758026-106758048 TTGTCTCCACCAAACACTTCGGG + Intergenic
1113382415 13:109816061-109816083 TAGTCTGTAGGAAACACTACAGG + Intergenic
1114234537 14:20812806-20812828 TGGTCTCCAGAACACACAGGGGG + Intergenic
1114549543 14:23525093-23525115 TAGTCTCAAAGAAAGACTGCAGG + Exonic
1114826606 14:26088363-26088385 TAGTCTCCAGGAAAACCTACTGG + Intergenic
1117463752 14:55972290-55972312 CAGTTGCCAGAAGACACTGCTGG + Intergenic
1119937109 14:78602158-78602180 AATTCTCCAGAAATCACTACTGG + Intronic
1126605204 15:50469402-50469424 TATTCTACAGAAAACACTTTGGG - Intronic
1127717532 15:61663907-61663929 AAGTCCCCAGAAAATTCTGCAGG + Intergenic
1131098019 15:89667912-89667934 AAGTTTCCAGAAAAGTCTGCTGG - Intronic
1131542366 15:93285302-93285324 TAGTCTCCCCCAAACAATGCAGG - Intergenic
1135433731 16:22410321-22410343 TAGTCTCCAACAAAGAGTGCAGG - Intronic
1136277922 16:29190425-29190447 TAGTCTTCAACAAACAGTGCCGG - Intergenic
1140192216 16:72827773-72827795 TAAACTCCAGAAAACAATGAGGG - Intronic
1142082294 16:88156465-88156487 TAGTCTTCAACAAACAGTGCCGG - Intergenic
1142220187 16:88850479-88850501 CACTCACCAGAAAATACTGCGGG + Intronic
1145055367 17:19700131-19700153 CAGTCTCCAGGAAATTCTGCGGG + Intronic
1148553754 17:48565609-48565631 GTGTCTCCAGAAATCACTTCTGG + Intronic
1149903179 17:60500841-60500863 TAATGTCCAGAAAACAGAGCTGG + Intronic
1152509333 17:80774759-80774781 GAGTCCTCAGGAAACACTGCGGG - Intronic
1152789212 17:82269696-82269718 TAACCTCCAGAACACACTACAGG + Intronic
1153612048 18:6895986-6896008 AAGTGTGCTGAAAACACTGCAGG - Intronic
1155810809 18:30232099-30232121 AAGTCGCTTGAAAACACTGCTGG - Intergenic
1161405509 19:4089258-4089280 TAGTCTCCAGGAAGTACTGAAGG + Intergenic
1168471499 19:56643869-56643891 TGGGCTCCGGGAAACACTGCCGG + Intronic
925995061 2:9285485-9285507 GACTCTCCAGAAAATACAGCTGG - Intronic
926959088 2:18333886-18333908 TAGTTTCCAGGCCACACTGCAGG - Intronic
930152236 2:48070467-48070489 GAGTCTCCAGAAAAGAATGAAGG + Intergenic
933920179 2:87038057-87038079 CAGTCTTCAAAAAACAGTGCTGG + Intergenic
933931445 2:87155729-87155751 CAGTCTTCAAAAAACAGTGCTGG - Intergenic
934002819 2:87731836-87731858 CAGTCTTCAAAAAACAGTGCTGG - Intergenic
934638279 2:96010422-96010444 CCGTCTCCAGAAAACGCGGCCGG + Intergenic
936291751 2:111230555-111230577 TTATCTACAGAAAACATTGCTGG - Intergenic
936361675 2:111809710-111809732 CAGTCTTCAAAAAACAGTGCTGG + Intronic
940406300 2:153306177-153306199 CACTCCCCAGCAAACACTGCTGG + Intergenic
944279273 2:197876257-197876279 TATTTTCCACAAAACACTGTGGG - Intronic
945679755 2:212899543-212899565 TAGTCTCCTGAAAACTCAACAGG - Intergenic
1169726829 20:8743570-8743592 TGGTCTCAGGAAAAAACTGCAGG - Intronic
1169751027 20:8994672-8994694 TAGTCTCCAGAAAAGACAGGTGG + Intergenic
1176703337 21:10086140-10086162 TAGTAACCAGAGAACACAGCAGG + Intergenic
1177670353 21:24217079-24217101 TATTATTCAGAAAACACTTCAGG + Intergenic
1177930422 21:27275736-27275758 TAGGCTCCAGAACCCACTGAAGG + Intergenic
1178692993 21:34765219-34765241 TCTTCTCCACAAAGCACTGCTGG - Intergenic
1179999198 21:44987463-44987485 GAGTCTGCAGGCAACACTGCTGG - Intergenic
1181694551 22:24586380-24586402 CAGCCTCCAGAAGACTCTGCTGG - Exonic
1182319187 22:29467332-29467354 TAGTCCCCGGCACACACTGCAGG + Intergenic
1182344805 22:29654847-29654869 TAATCTCCAGTAAACAGTGTGGG + Intronic
951466157 3:23002616-23002638 TAGTTTCCAGCAGACACTACAGG + Intergenic
951763719 3:26173325-26173347 CATTCTCCAGAAAGCAGTGCAGG + Intergenic
954174991 3:48837475-48837497 TAGAATCCTCAAAACACTGCTGG + Intronic
955725399 3:61927221-61927243 TATTCTCCACAAAACACTGAGGG + Intronic
957928047 3:86840359-86840381 CAAGCTCCAGAAAACCCTGCGGG + Intergenic
958073382 3:88643278-88643300 TAGTCTCCCTTAAACTCTGCTGG - Intergenic
959761653 3:109973166-109973188 TAGTATCCAGAAAACTTCGCTGG - Intergenic
961477564 3:127158224-127158246 GAGTCTCCAGAAAGTACCGCTGG + Intergenic
962491751 3:135900919-135900941 TAGAAGCCAGAAAACAATGCGGG - Intergenic
963269359 3:143270425-143270447 TGCTCTCCAGAAAACCCAGCTGG - Intronic
963566233 3:146934568-146934590 AAGTCTCCATAAAGTACTGCAGG + Intergenic
963922636 3:150920653-150920675 GAGTCTCCAGAAAATAATGAGGG + Intronic
965969379 3:174534846-174534868 TTTTCTCCAAAAAACACTGTCGG - Intronic
967374731 3:188788173-188788195 AAGTCACTAGAAAACACTGAAGG - Intronic
969675004 4:8609817-8609839 TGGTTTCCAGAGATCACTGCCGG - Intronic
970196883 4:13559919-13559941 TATTTTCCAGTAAACACTGATGG - Intergenic
971993561 4:33933469-33933491 TAGTCTCCCAACAACACAGCAGG + Intergenic
983450109 4:167898597-167898619 TAGTCTATAGAAAACAAAGCAGG + Intergenic
985519517 5:366864-366886 TAATCTCCAAAAAACCCAGCAGG + Intronic
985887266 5:2689184-2689206 TAAGCTGCAGATAACACTGCCGG + Intergenic
985908246 5:2858776-2858798 AAGTCTTCAGAAAACAGTGTGGG - Intergenic
985968741 5:3358126-3358148 TAGTCTCAAGAAACCATTTCTGG - Intergenic
986401753 5:7388855-7388877 TAGGCTCCAGAAATAATTGCAGG - Intergenic
989217738 5:38922623-38922645 TTGTCTCCAGCAAAGCCTGCAGG - Intronic
991228700 5:64304182-64304204 TAGTCACCAGAGAGCTCTGCTGG + Intronic
992024542 5:72657539-72657561 AAGTCTCCAGAAATCCCTGGTGG - Intergenic
992191867 5:74300429-74300451 TAGTCTTCAGCAAATAGTGCTGG + Intergenic
992739020 5:79754487-79754509 TATTTTCAAGAAAACACAGCCGG + Intronic
993666344 5:90702030-90702052 GAGTCACCAGACAACACTGTAGG + Intronic
993992442 5:94676333-94676355 TAGTCTCCAGAAAACACTGCAGG - Intronic
995934286 5:117489280-117489302 CACTCTCCAGAAAACAAGGCAGG + Intergenic
996135330 5:119834651-119834673 TAGACTGCAGAAAACTCTGCAGG - Intergenic
996310183 5:122095675-122095697 TGGTCTCCAGAAATAATTGCAGG - Intergenic
996938798 5:128978917-128978939 TACTGTACTGAAAACACTGCAGG - Intronic
998267902 5:140679871-140679893 TTTTCTCCAGGAAACACTGATGG - Exonic
998870015 5:146542718-146542740 GAGTTTCCAGAAGACACTGTTGG + Intergenic
999128973 5:149267995-149268017 AAGTCTCCTGAGATCACTGCAGG + Intergenic
1002445052 5:179285518-179285540 TAGCCTCCAGGAAACAGAGCTGG + Intronic
1004008212 6:11656344-11656366 TGGTCTCCAGAAGAAAGTGCTGG + Intergenic
1004944671 6:20597758-20597780 TTCTCTCCTGAAAACCCTGCCGG + Intronic
1005373109 6:25155279-25155301 GAGTGTCCAGAAAAGACAGCAGG - Intergenic
1006503619 6:34474127-34474149 CAGTCTGCAGGAAACACAGCAGG - Intronic
1007910029 6:45504278-45504300 CAGTCTCCAGAAAGGACTGAGGG + Intronic
1008937529 6:57007850-57007872 GGGCCTCCAGAAAACACAGCTGG - Intronic
1009426216 6:63516373-63516395 TAGTCTAAAGAAAACATTTCTGG - Intergenic
1010714711 6:79215003-79215025 TAGTCTCCAGAGAATACAGAGGG - Exonic
1011343261 6:86340672-86340694 TAGGCTCCAGAAAACATTTCTGG + Intergenic
1011520294 6:88197090-88197112 TAGTCCTCAGAAAACACTGCTGG - Intergenic
1012927665 6:105283915-105283937 TATTCTCCAGAAAACCCCTCTGG - Intronic
1016157587 6:140831426-140831448 AAGTTTCCACAAAACACTGTTGG + Intergenic
1016885498 6:148956028-148956050 ATGTCTACAGAAAACAGTGCTGG + Intronic
1017272583 6:152525936-152525958 TAGTATACTGGAAACACTGCTGG - Intronic
1017595969 6:156028859-156028881 ATGTTTCCACAAAACACTGCAGG + Intergenic
1018344333 6:162885145-162885167 AAGTTTGCACAAAACACTGCAGG + Intronic
1018938739 6:168293710-168293732 AAGTGTCCAGAAAGGACTGCTGG - Intronic
1019802806 7:3100805-3100827 CTGACTCCAGCAAACACTGCAGG + Intergenic
1021122488 7:16813191-16813213 TTGTCACCTGAAAACACCGCAGG + Intronic
1021241630 7:18209099-18209121 TAATCTCCATAAACCACTGTAGG + Intronic
1022086612 7:27074655-27074677 TAGTCTCCAGGAAACATAGTGGG - Intergenic
1022392223 7:29953130-29953152 TGGCCTTCAGCAAACACTGCGGG - Intronic
1022828520 7:34041258-34041280 AAGTCTCCAGAAGACCCTGTGGG - Intronic
1030514620 7:110524255-110524277 TACCCTCCAGAGAACACTCCTGG + Intergenic
1033017457 7:137686375-137686397 TACTCTCCACACACCACTGCAGG + Intronic
1033266298 7:139890047-139890069 TGGTCTCAAGGACACACTGCGGG - Intronic
1036908238 8:12726497-12726519 TAGTCTAAAGAATACACTGAGGG - Intronic
1037511411 8:19586944-19586966 TAATCTCCAGGAAACACTCTGGG + Intronic
1037940195 8:22945471-22945493 GAGCCTCCAGAGAAAACTGCAGG + Intronic
1038001266 8:23393457-23393479 TTGTCTTCAAAAAACAGTGCTGG + Intronic
1039104683 8:33977512-33977534 TTTTCTCCAGAAAACACAGGGGG - Intergenic
1041146478 8:54881389-54881411 TGGCGTGCAGAAAACACTGCAGG - Intergenic
1041299381 8:56394807-56394829 GAGTCTCCCGGAAACACAGCTGG + Intergenic
1046033875 8:108817484-108817506 TTTTCTCCAGGAACCACTGCAGG - Intergenic
1046568570 8:115933113-115933135 TGATTTCCATAAAACACTGCAGG - Intergenic
1047184717 8:122622361-122622383 TAGTCTTGAGAAATCAATGCTGG - Intergenic
1047258837 8:123237929-123237951 TAATTTCCAGAAAGCACTGCAGG - Exonic
1047364328 8:124198315-124198337 TTGACTCCAGAAAACCCTCCAGG + Intergenic
1050334972 9:4582066-4582088 TTGTCTCCAGAAAGCACTGTAGG + Intronic
1053640602 9:40073150-40073172 TAGTAACCAGAGAACACAGCAGG + Intergenic
1053765536 9:41392316-41392338 TAGTAACCAGAGAACACAGCAGG - Intergenic
1054321291 9:63669138-63669160 TAGTAACCAGAGAACACAGCAGG + Intergenic
1054544148 9:66303475-66303497 TAGTAACCAGAGAACACAGCAGG - Intergenic
1055085131 9:72306006-72306028 TAGGTTCCAGAAGACACTTCAGG - Intergenic
1055160469 9:73120371-73120393 AATTCTCCAGAATACACAGCAGG + Intergenic
1058080715 9:100698645-100698667 GAGTCTCCAGGAAAACCTGCAGG - Intergenic
1058650395 9:107170580-107170602 TCGGCTCCAGGAAACATTGCAGG - Intergenic
1059551539 9:115234034-115234056 GAGTTGCTAGAAAACACTGCTGG - Intronic
1060784845 9:126443020-126443042 TAGAGTCTAGAAAACACTGGTGG + Intronic
1202788369 9_KI270719v1_random:56245-56267 TAGTAACCAGAGAACACAGCAGG + Intergenic
1189698646 X:43693609-43693631 AAGTCTCCTGGAATCACTGCAGG + Intronic
1192937304 X:75873546-75873568 TAGTCTCCAGAACTCAATGCAGG + Intergenic
1196082954 X:111652455-111652477 TAGTATGCAGAAAGTACTGCTGG - Intergenic
1197312278 X:124919304-124919326 TAGTCTACAAAAAAGACTACAGG + Intronic
1197493997 X:127154407-127154429 CAGTCTCCAGCATACACTGAGGG - Intergenic
1198089795 X:133316797-133316819 AAGGCTCAAGAAAACACTGCTGG + Intronic