ID: 993992445

View in Genome Browser
Species Human (GRCh38)
Location 5:94676366-94676388
Sequence CTAGTCCTGCCGATCACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993992442_993992445 10 Left 993992442 5:94676333-94676355 CCTGCAGTGTTTTCTGGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993992445 Original CRISPR CTAGTCCTGCCGATCACACC AGG Intronic
900165486 1:1242801-1242823 CGAGCCCTCCCGCTCACACCCGG + Intronic
901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG + Exonic
901902134 1:12374063-12374085 CACGTTCTGCTGATCACACCTGG - Intronic
904670493 1:32161261-32161283 CTAGTCCTGCCTCTCTCCCCTGG - Intronic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
1072237287 10:93464406-93464428 CTAGTCCAACCAATAACACCAGG + Intronic
1085639159 11:78180826-78180848 CTAGTCCTGCCCTTGACACATGG - Intronic
1086265939 11:84998235-84998257 CTGGTCCTGCCCTTGACACCTGG - Intronic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG + Intergenic
1103411101 12:120711618-120711640 CTTGGCCTGCCCATCACTCCTGG + Intronic
1105471676 13:20700939-20700961 CTATTCCTGCTGATCATTCCTGG - Intergenic
1109755157 13:66748877-66748899 CTAGTCCTGCCCTTGACACAAGG - Intronic
1120708509 14:87769545-87769567 TTAGTCCTGCCCTTCACACGTGG + Intergenic
1121695353 14:95908024-95908046 CCAGTCCTGCAGATCAAACTGGG - Intergenic
1125936766 15:43643567-43643589 CTAGTCCTGCGGATCACTTGAGG - Intronic
1125949479 15:43739703-43739725 CTAGTCCTGCGGATCACTTGAGG - Intergenic
1128376648 15:67081281-67081303 CTAGTCATCCCCATGACACCAGG - Intronic
1128482367 15:68050355-68050377 CTAGTCCTGCCCTTGACACTTGG + Intergenic
1131266792 15:90920238-90920260 CTGATCCTGCTCATCACACCAGG - Exonic
1141764071 16:86047121-86047143 CTCATCCTGCCGGTCACCCCAGG - Intergenic
1142619799 17:1157739-1157761 ATGGTCCTGCTGATCCCACCAGG - Intronic
1143110853 17:4552042-4552064 CTAGTCCTGAGGTTCCCACCAGG - Intronic
1148436823 17:47692127-47692149 CTAGTTCTGCTGCTCATACCAGG - Intergenic
1156216433 18:35003104-35003126 CTACTCCTGCCAAACACAGCAGG + Intronic
1158276368 18:55772576-55772598 CTAGTCCTGCCCTTGACACATGG - Intergenic
1159261198 18:66015627-66015649 CTAGTCCTGCCCTTGACACATGG + Intergenic
1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG + Intronic
1165032471 19:33008057-33008079 CTGCGTCTGCCGATCACACCGGG + Exonic
925282369 2:2693573-2693595 ATTGTCCTGCCTAGCACACCAGG + Intergenic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
928432898 2:31234894-31234916 CTAGTCCCTCCGGTCACTCCTGG + Intronic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
933724557 2:85419095-85419117 CGAGTCCTGCCGGCCACACAGGG - Intronic
935656776 2:105430011-105430033 CTAGTTCTGCTGTTCACACTGGG - Intronic
937176061 2:119936399-119936421 CTGGTCCTGCCCTTGACACCTGG - Intronic
939666962 2:144964401-144964423 CTAGTCCTGCCCTTGACACATGG - Intergenic
1170561244 20:17560405-17560427 CTGGTGCAGCAGATCACACCAGG - Intronic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
964965980 3:162494590-162494612 CTAGTCCTGCCCTTGACACGTGG - Intergenic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
972158826 4:36198370-36198392 CTAGTCCTGCAGACCACAGTAGG - Intronic
980425927 4:132628070-132628092 CTAGTCCTGCCTTTGACACATGG - Intergenic
985531515 5:436421-436443 CCAGTCCTGCCAACCAAACCTGG - Exonic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
999121458 5:149212707-149212729 CCAGTTCTGCCAATGACACCAGG - Intronic
1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG + Intronic
1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG + Intergenic
1009242311 6:61197686-61197708 CTAGTCCTTCCCACCACACATGG - Intergenic
1009550931 6:65090171-65090193 CTGGTCCTGCCCTTGACACCTGG - Intronic
1015749939 6:136549924-136549946 CTCGTCCTGCCAGTCGCACCTGG + Intronic
1021224681 7:18013464-18013486 TTAGTCCTGCCGTTCACAGGAGG - Intergenic
1021404288 7:20246326-20246348 CTAGTTCGACCGATCACATCTGG - Intergenic
1027055268 7:75045454-75045476 CCAGGCCTGGGGATCACACCTGG - Intronic
1027785427 7:82574003-82574025 CTAGTCCTGCCCTTGACACATGG + Intergenic
1029136187 7:98373846-98373868 CTCGTCCTGATGATGACACCAGG - Intronic
1035116888 7:156532379-156532401 CTAGTCCTGTCTGTCAGACCAGG + Intergenic
1035447070 7:158950372-158950394 CTGGTCCTGGTGCTCACACCTGG - Intronic
1040696324 8:50003994-50004016 CAAGTCCTGACGATCAAAACAGG - Intronic
1041331428 8:56729612-56729634 CTAGTCCTGACTATGAAACCCGG - Intergenic
1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG + Intronic
1042690215 8:71489998-71490020 CCAGTCCTGGAGATCACACTTGG - Intronic
1046497825 8:115037041-115037063 CTAGTCCCATCGATCACCCCAGG + Intergenic
1047183304 8:122609771-122609793 CTGGTCCTGCCTATGACACTTGG - Intergenic
1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG + Intergenic
1191602954 X:63030599-63030621 CTAGTCCTGCCCTTGACACATGG + Intergenic
1195608217 X:106834382-106834404 CTAGTCCTGCCCTTGACACGTGG + Intronic
1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG + Intergenic
1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG + Intergenic
1200151222 X:153952387-153952409 CTCGTCCTCCCCATCACATCTGG + Intronic