ID: 993996628

View in Genome Browser
Species Human (GRCh38)
Location 5:94730769-94730791
Sequence CTGGGAATAGGGTGTTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993996628_993996634 21 Left 993996628 5:94730769-94730791 CCTTGGTAACACCCTATTCCCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 993996634 5:94730813-94730835 AGTAGATACTTGTCACCATTTGG 0: 1
1: 0
2: 0
3: 9
4: 90
993996628_993996635 22 Left 993996628 5:94730769-94730791 CCTTGGTAACACCCTATTCCCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 993996635 5:94730814-94730836 GTAGATACTTGTCACCATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 152
993996628_993996631 -10 Left 993996628 5:94730769-94730791 CCTTGGTAACACCCTATTCCCAG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 993996631 5:94730782-94730804 CTATTCCCAGATGTTTCAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993996628 Original CRISPR CTGGGAATAGGGTGTTACCA AGG (reversed) Intronic
900460826 1:2801448-2801470 CAGGGAATAGGGGAGTACCAGGG - Intronic
902231090 1:15028123-15028145 CTGAGACCAGGGTGTAACCAGGG - Intronic
904251021 1:29224350-29224372 CTGGGCACAAGATGTTACCAAGG - Intronic
905117957 1:35659001-35659023 CTGGTAAAAGGGTGTTTCTAGGG - Intergenic
906193244 1:43912663-43912685 CTGGGAATAGAGATTAACCATGG - Intronic
906523155 1:46479039-46479061 TAGGGAAGAGGGTGTTAACAGGG - Intergenic
909010294 1:70327075-70327097 CTGGGAATAGGATATTCACATGG + Intronic
909397535 1:75187335-75187357 TTGGTTATAGGGTGTTAACATGG + Intergenic
916547654 1:165821604-165821626 CTGGGATTAGGGTGAGACAAGGG - Intronic
920415285 1:205795326-205795348 CTGGGAATCTGCCGTTACCAGGG + Exonic
921009159 1:211123881-211123903 CCGGAAATATGGTGTTACTAGGG + Intronic
921445938 1:215247785-215247807 CTGAGATTAAGGTGTTAGCAGGG + Intergenic
1062952611 10:1516089-1516111 CTGGGAAGAGGGTGTGGTCAGGG - Intronic
1065223698 10:23521620-23521642 CAGGAACTAGGGTGTGACCATGG + Intergenic
1067699961 10:48563927-48563949 ATGGGTAAAGGGTGTTAACAAGG + Intronic
1067740224 10:48889935-48889957 CTGGGAAGAGGATGTGACCTTGG + Intronic
1068688976 10:59896648-59896670 CTAGGAATAGAGGTTTACCAGGG + Intronic
1068748936 10:60568966-60568988 CTGAGATTAGGGTGTCAGCATGG - Intronic
1072722896 10:97791840-97791862 CTGGGAGTAGTGTGTTCTCATGG + Intergenic
1073066531 10:100763057-100763079 CTGGGAATGGGTTGCTACCTTGG - Intronic
1074976177 10:118583687-118583709 CTGGGCATAGGCTTTTGCCAGGG - Intergenic
1075286730 10:121193559-121193581 CTGGGAACAGGGTGGGTCCAAGG + Intergenic
1076947471 10:133660995-133661017 AAGGGAAAAGGGTGTTACCCGGG + Intergenic
1078455156 11:11469256-11469278 CTGGGAACAGTCTGGTACCATGG - Intronic
1081733815 11:45390031-45390053 CTGGGCATAGGGGCTTGCCAGGG - Intergenic
1085289476 11:75387477-75387499 CTGGGAATTGGAAGTCACCATGG + Intergenic
1089511016 11:118997300-118997322 CAAGGAATTGGGTGTTACAAGGG + Intergenic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1092291724 12:7163325-7163347 GGGGGAAGAGGGTGTTACCAGGG + Intergenic
1095746010 12:45659742-45659764 TTGGGAATAGGGCATTACAATGG - Intergenic
1099799665 12:87441692-87441714 CTTGGAAGAGGGTGTTGCAATGG - Intergenic
1106203521 13:27566290-27566312 GTGGGAATAAGGTGTTTGCAGGG + Intronic
1108104964 13:46998793-46998815 CTGAGACTAAGGTGTTAACAGGG - Intergenic
1108733250 13:53256777-53256799 CTGGGAATGGGGGATTAGCAGGG + Intergenic
1110369876 13:74727844-74727866 CTGGAAATAGGATGTCACTAAGG + Intergenic
1112018223 13:95349096-95349118 TTGGGAATAGAGAGTTCCCATGG + Intergenic
1112063229 13:95762993-95763015 TTGGGAATAGTGTGCCACCATGG + Intronic
1113102762 13:106737799-106737821 CAGTAAATAGGGTGTTATCATGG + Intergenic
1116460047 14:45161896-45161918 CTTGGACTAGGGTGGTAACAAGG + Intronic
1119639813 14:76306121-76306143 CTGGGATTAAGGTGTCAGCAGGG - Intergenic
1122284582 14:100643121-100643143 CTGAGATTGAGGTGTTACCAGGG - Intergenic
1123150881 14:106180705-106180727 CTGGGAAGAGGGTTCTACAATGG + Intergenic
1123399299 15:19968562-19968584 CTGGGAAGAGGGTTCTACAATGG + Intergenic
1124126415 15:26941672-26941694 CTGGGATCAGGGTGTTGGCAGGG + Intronic
1125010631 15:34869534-34869556 ATGGAAATAGGGTGGTTCCAAGG - Intronic
1126673231 15:51135616-51135638 GTGGGCAGAGGGTGTTCCCATGG - Intergenic
1127811419 15:62568624-62568646 CTGGGAATAGTGTGTTTCTTTGG + Intronic
1135662277 16:24307012-24307034 CTGGGAAGCGGGTGTGACCTTGG - Intronic
1138011136 16:53381343-53381365 CTGAGACCAGGGTGTTAGCAGGG + Intergenic
1143314376 17:6021021-6021043 CTGGGAATAGGGGGTCTCCTGGG - Intronic
1147537307 17:41328947-41328969 CTGGGAAGAGAGGGGTACCAGGG + Intergenic
1148856311 17:50580927-50580949 CTGGGAGTGGGGGGTTGCCAGGG + Intronic
1149943810 17:60899464-60899486 CTGGGACTAGGGTGTGATCTGGG - Intronic
1150432283 17:65127893-65127915 CTGGAAATAGGGTGATGACAGGG + Intergenic
1203171373 17_GL000205v2_random:149993-150015 AGGGGAAAACGGTGTTACCAGGG + Intergenic
1153415473 18:4841252-4841274 CTGAGAACAGGGTGTCAGCATGG + Intergenic
1159050425 18:63416524-63416546 CTTGAACTAGGGTGTTAGCAAGG - Intronic
1159292359 18:66439611-66439633 CTGGGAATGGGGAGAGACCAGGG - Intergenic
1161293216 19:3506668-3506690 CTGGGATTTGGGTGTTAACTCGG - Intronic
1167458324 19:49610525-49610547 ATAGGAACAGGGTTTTACCATGG - Intronic
1167771180 19:51519914-51519936 CTGAGAACAAGGTGTTATCAGGG - Exonic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930417133 2:51103267-51103289 CAGGGAAGAGGGTTTTGCCAGGG - Intergenic
931606364 2:64057026-64057048 CTTGGACTAGGGTGATAGCACGG - Intergenic
932074178 2:68647624-68647646 CTGAAAAAAGGGGGTTACCAAGG + Intronic
935926330 2:108073784-108073806 CTGGTATTAGGGTTTTTCCATGG - Intergenic
936490855 2:112970922-112970944 TTGGAAATAGGGTGTTTCAAGGG + Intergenic
937249577 2:120515073-120515095 CTGGGAAGAAGGTGGTGCCAGGG - Intergenic
942853462 2:180518687-180518709 CTGAGATCAGGGTGTTAGCAGGG - Intergenic
943532302 2:189098042-189098064 CTGGGAAATGGCTGTTGCCAGGG + Intronic
945133044 2:206595446-206595468 CTGAGAAAAGAGGGTTACCAAGG + Intronic
946147593 2:217742678-217742700 CTGGGAATGGGCTGTAACTAAGG + Intronic
946367839 2:219261142-219261164 CTGAGTATAGGGTCTTTCCAGGG + Intronic
948169151 2:235887353-235887375 CAGACAATAGGGTGTTACCAGGG - Intronic
1169087671 20:2837543-2837565 CAGGGACTAGGGTGTTGACATGG + Intronic
1172866356 20:38101958-38101980 CTGAGAACAGAGTGTTAGCATGG - Intronic
1176327357 21:5511821-5511843 AGGGGAAAACGGTGTTACCAGGG + Intergenic
1176400400 21:6309130-6309152 AGGGGAAAACGGTGTTACCAGGG - Intergenic
1176436757 21:6679974-6679996 AGGGGAAAACGGTGTTACCAGGG + Intergenic
1176461019 21:7007044-7007066 AGGGGAAAACGGTGTTACCAGGG + Intergenic
1176484580 21:7388822-7388844 AGGGGAAAACGGTGTTACCAGGG + Intergenic
1176958587 21:15134165-15134187 GTGGGCATAGGGTGTTACAATGG + Intergenic
1178539998 21:33441349-33441371 TTGGGAATAGGGTATTACAAGGG + Intronic
1179240660 21:39588275-39588297 CTGAGATCAGGGTGCTACCATGG + Intronic
1180253622 21:46606633-46606655 CTGGGAACAGGGTGGACCCACGG - Intergenic
1180745412 22:18085289-18085311 CTGGGAAGGGGTTGTTGCCAGGG + Intronic
1184453773 22:44597779-44597801 CTAGGACTGGGGTGTTGCCATGG + Intergenic
1184493409 22:44823606-44823628 CTGGGAGTGGGGTCTTGCCAGGG - Intronic
949288622 3:2436578-2436600 GTGGAAATAGGGTGTTAGAAAGG + Intronic
950583741 3:13879166-13879188 CTGGAAATTGGGTGGTGCCAAGG + Intronic
950663182 3:14479611-14479633 TTGGAAATGGGGTGTTTCCATGG + Intronic
952283320 3:31944687-31944709 CTGGGAAGAAGGTGTCTCCAAGG - Intronic
963054402 3:141173737-141173759 TTGGGAATAGGGTATTGCAATGG + Intergenic
963346201 3:144099024-144099046 CTGGGAACAGGGTGAAGCCAGGG - Intergenic
967591255 3:191276307-191276329 CGGAGAAAAGGGTGTTACTAGGG + Intronic
972420850 4:38884884-38884906 ATATGAATAGGGTGTTACAAAGG - Intronic
973163950 4:47053661-47053683 CTGGAAAGAAGGTGTGACCATGG + Intronic
980031048 4:127831154-127831176 CTCGGAATAAGATTTTACCATGG - Intronic
980169605 4:129273319-129273341 CTGGGAATAGAGAGTTACTCAGG + Intergenic
982205659 4:152995598-152995620 CAGTGAATAGGGTGTCACCGGGG + Intergenic
984316890 4:178140347-178140369 ATGGGAAATGGGTGTAACCAAGG + Intergenic
985450927 4:190061795-190061817 AAGGGAAAAGGGTGTTACCCGGG + Intergenic
987676872 5:21085977-21085999 CTGGGAATAGAGTGTTTTAAAGG + Intergenic
988389735 5:30612339-30612361 CTGGGAATTGGGGGTTGCAATGG - Intergenic
991173192 5:63653027-63653049 CTGAGATTGGGGTGCTACCATGG + Intergenic
991346614 5:65675111-65675133 GTGGGTTTAGGATGTTACCAGGG - Intronic
993012223 5:82496131-82496153 CTGAGAATAAACTGTTACCAAGG + Intergenic
993660556 5:90628612-90628634 CTGCGAATTGGGTGTTGACACGG + Exonic
993996628 5:94730769-94730791 CTGGGAATAGGGTGTTACCAAGG - Intronic
995167285 5:109059065-109059087 GTGGGAAGAGGTTGTTACCAAGG - Intronic
1002711492 5:181197838-181197860 CTGGGAATGGGGTGTATACAGGG - Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1005816342 6:29555852-29555874 CTGGGCATGGGGTGTTGGCAGGG - Exonic
1006416410 6:33906819-33906841 CTGGGAGAAGGGTGGGACCAGGG + Intergenic
1006856825 6:37139519-37139541 CTGGTAATAGGCTCCTACCAAGG + Intergenic
1007216534 6:40244300-40244322 GTGGGAGCAGGGTGTTCCCAGGG - Intergenic
1010556686 6:77289973-77289995 CATGGAATAAGGTGTTTCCAAGG - Intergenic
1011113567 6:83865397-83865419 CTGTGATTAGGGTGTCAGCAGGG + Intronic
1012759252 6:103277322-103277344 CTGGGGATAGGCTTTTTCCATGG - Intergenic
1012814943 6:104011522-104011544 CTAGAAATAGAGTGTTTCCATGG - Intergenic
1013563151 6:111327080-111327102 TTAGGAATAGGGTTTCACCAGGG - Intronic
1013840003 6:114380270-114380292 CTGAGATTAGGGTGTCAGCATGG + Intergenic
1014298664 6:119652569-119652591 CTGAGATTAGGGTGCTAGCACGG + Intergenic
1019516064 7:1440725-1440747 CTGGGAATGGGGTGTCTGCAAGG + Intronic
1021152754 7:17171772-17171794 CAGGGCAGAGGATGTTACCAGGG + Intergenic
1030142060 7:106314722-106314744 CTGGGAATAGGGTGGTATAGGGG + Intergenic
1031930880 7:127684662-127684684 CTCAGGATAGGGTGTTAGCATGG + Intronic
1033302896 7:140202029-140202051 CTGGGATGAGGGTGTTGCCCAGG - Intergenic
1034081052 7:148277959-148277981 CTGGGACCAGGGAGTTAGCATGG + Intronic
1037602007 8:20404876-20404898 CTGGGAAGAGTCTGTTACCATGG + Intergenic
1039503070 8:38031855-38031877 CTGGGAAAACGGTGTGACAATGG - Intronic
1039866485 8:41508791-41508813 TTGGGATTTGGGTGTTCCCAAGG + Intronic
1040909221 8:52501543-52501565 CTGGAAAGGGGGTGTTAACACGG + Intergenic
1043651356 8:82596685-82596707 GTGAGATTAGGGTGATACCATGG + Intergenic
1044028056 8:87198321-87198343 CTGTGAATGGGGTTTTTCCATGG - Intronic
1045827369 8:106414624-106414646 GTGGGAATGGGATGTTAACAAGG + Intronic
1048556909 8:135487511-135487533 AAGAGAATAAGGTGTTACCATGG + Intronic
1048612704 8:136041159-136041181 CAGGGAATAGAGTCTTTCCAAGG + Intergenic
1048615956 8:136075878-136075900 CTGGGACCAGGGTTTTACTAAGG + Intergenic
1049196580 8:141319049-141319071 CAGGGATTAGAGTGTGACCAGGG + Intergenic
1049781874 8:144432784-144432806 CTGGGAATTGGGTGTCATCCAGG - Intronic
1050914560 9:11115620-11115642 CTGGGAATAGGCCATTACAATGG - Intergenic
1055879267 9:80979134-80979156 CTGGGAATAGAGTGTTGCAATGG - Intergenic
1056295807 9:85192018-85192040 CTGGGAATACAGTGTGAACAAGG + Intergenic
1058832548 9:108832129-108832151 CTGGGATTAGGGTTTTATCCTGG + Intergenic
1060476998 9:123994399-123994421 CTGGAAAGAGGGTGTTGCTAAGG + Intergenic
1062086273 9:134650588-134650610 GTGGGAGTAGGGTGTGGCCAAGG + Intronic
1203434756 Un_GL000195v1:128685-128707 AGGGGAAAACGGTGTTACCAGGG - Intergenic
1185519520 X:728405-728427 CTGTGACTGGGGTGTTAGCAGGG - Intergenic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1186719264 X:12285274-12285296 CTGGGAACAGGATGGAACCATGG - Intronic
1187631701 X:21180320-21180342 CTGCTAATAGGGTGCTACCCAGG + Intergenic
1188906727 X:35799799-35799821 TCTGGAACAGGGTGTTACCATGG + Intronic
1189514105 X:41693788-41693810 CTGGAAACAGGCTCTTACCAGGG + Intronic
1190334466 X:49253917-49253939 CTGGGAATGTGCTGTTTCCATGG + Exonic
1195608711 X:106838799-106838821 CTGGGAATAGAGATTTTCCAGGG + Intronic
1196104030 X:111877093-111877115 ATGGGAGTAGGGTGATAGCATGG + Intronic
1196354287 X:114771865-114771887 CTGGGAATAATGTGTTTCAAAGG + Intronic
1199595520 X:149503628-149503650 CTGGGATTTGGGTGTCACCTAGG + Intronic
1199598356 X:149525583-149525605 CTGGGATTTGGGTGTCACCTAGG - Intronic
1199609200 X:149599087-149599109 AGGGGAATAGAGTGTTAGCAAGG + Intronic
1199629918 X:149770268-149770290 AGGGGAATAGAGTGTTAGCAAGG - Intergenic