ID: 994003031

View in Genome Browser
Species Human (GRCh38)
Location 5:94803974-94803996
Sequence CTGGCTTTCAACTGGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994003031 Original CRISPR CTGGCTTTCAACTGGGGTGA TGG (reversed) Intronic
901198021 1:7451173-7451195 ATGGCTGTCAACTGGAGTCAGGG - Intronic
902215301 1:14930915-14930937 CTGGCTTCGGGCTGGGGTGAAGG - Intronic
902921441 1:19668056-19668078 CTGCCTATCACCTGGGGTGGGGG + Intronic
903496964 1:23775504-23775526 CTGGCTGTTAGCTGGGATGATGG - Intergenic
904283528 1:29438166-29438188 TTGGCTTTCATCTGGGGCAATGG - Intergenic
904709145 1:32415278-32415300 CTGGCTCTCAGCTGTGGTTAGGG - Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905807723 1:40888901-40888923 CTGACATTCTAGTGGGGTGAGGG - Intergenic
906514975 1:46433574-46433596 CTCCCTTCCAGCTGGGGTGAGGG - Intergenic
907029603 1:51157826-51157848 CTGTTTGGCAACTGGGGTGAAGG + Intergenic
907351842 1:53838310-53838332 CTGCCTTTGAACTGCGGTGGCGG - Exonic
907663446 1:56414455-56414477 TTAGGTTTCAACTGGGATGATGG - Intergenic
907819951 1:57957408-57957430 CTGTATTTTATCTGGGGTGAAGG + Intronic
908112301 1:60909419-60909441 CAGGCATGCAACTGGGGTGACGG - Intronic
909022641 1:70449283-70449305 CTGGCTTTAAACATGGGGGAAGG - Intergenic
909738515 1:78998111-78998133 CTGGCTTTCCCCTGTGGTGGTGG - Intronic
911177008 1:94827012-94827034 CTGGCTCTCAACCTGGGAGAAGG + Intronic
911924879 1:103817364-103817386 CTGCCTTGCCACTGGGGTGAGGG - Intergenic
912472686 1:109916396-109916418 TTGGCTTTCTTCTGGAGTGATGG - Intronic
912710911 1:111949080-111949102 GGGGCTTGCAACTGGGCTGAAGG + Intronic
914258185 1:145977398-145977420 CTGGTTTTAAAGGGGGGTGAGGG - Intronic
914408528 1:147402242-147402264 ATGTCTTTCAACTGGGTGGAGGG + Intergenic
915091351 1:153428572-153428594 CTGGATTTCACCTGGACTGAAGG - Intergenic
915093762 1:153444716-153444738 CTGGATTTCATCTGGACTGAAGG + Intergenic
917747864 1:178028042-178028064 ATGGCTTTCTCCTAGGGTGATGG - Intergenic
922092024 1:222404975-222404997 CGGGTTTTCAGCTGGGGCGAGGG + Intergenic
922863478 1:228839067-228839089 CTGACTTTCTTCTGGGGTGTGGG + Intergenic
922912098 1:229226520-229226542 CTGTCTTCCAACTGGGGGGCTGG - Intergenic
923064137 1:230502763-230502785 TTTGCTTACTACTGGGGTGATGG - Intergenic
923569834 1:235103568-235103590 CTGGGTTTCACCTGGGGTGGGGG - Intergenic
1064549140 10:16480941-16480963 CTGGCTTTCAGCTGTGCTGGAGG + Intronic
1067878656 10:50025297-50025319 CTGGCTGTCTCCTGGGGAGATGG - Intergenic
1067893070 10:50152639-50152661 CTGGCTGTCTCCTGGGGAGATGG + Intergenic
1069041379 10:63699164-63699186 GAGGTTTGCAACTGGGGTGAGGG - Intergenic
1069553836 10:69383707-69383729 TTGGCTGTCAGCTGGGGTGCAGG + Intronic
1069751169 10:70745868-70745890 CTGGCTGTCAGCTGGGGTCATGG + Intronic
1069899063 10:71696588-71696610 CTGGCTGTCAGCTGGTGTGTGGG - Intronic
1069927156 10:71858693-71858715 ACGGCTGTCAACTGGGGTAAGGG + Intergenic
1070310772 10:75272137-75272159 CTGGCTTTCCTCTATGGTGAGGG + Intergenic
1072230737 10:93412093-93412115 CTGTCTGTAAAATGGGGTGAAGG - Intronic
1072537385 10:96373844-96373866 CTGGCGTTCAGCTGGGGTGGGGG + Intronic
1075646545 10:124100582-124100604 CTGTCTTTCACCTGGGATGCCGG - Intergenic
1075867121 10:125733061-125733083 ATGGTTTTCAACTGGGAAGATGG - Intronic
1076129351 10:128002139-128002161 CTGGCTGTCAGCGGGGGCGACGG - Intronic
1079374259 11:19878147-19878169 CTGGCTATCAACTGTGGTCCTGG + Intronic
1081622469 11:44626800-44626822 TTGGCTGTCATCTGGGATGATGG - Intergenic
1082740813 11:56908986-56909008 CTGGGTCCCATCTGGGGTGATGG + Intergenic
1083104731 11:60346854-60346876 CTGCTTTTCAGCTGCGGTGAGGG + Intronic
1083319628 11:61837895-61837917 CTGGCTTGCAACCTGGGTGGGGG + Intronic
1083780559 11:64915283-64915305 CTGGGTGGCACCTGGGGTGACGG - Intronic
1083932805 11:65855191-65855213 CTGTTTGGCAACTGGGGTGAAGG + Exonic
1090067455 11:123515506-123515528 CTGCCTCTCAACTGCTGTGACGG - Intergenic
1090186857 11:124745019-124745041 CTGCATTTCTACTGGGGAGAGGG + Intronic
1090723722 11:129501973-129501995 CTGCCTTTTAATTGGGGTGGTGG - Intergenic
1091010971 11:132000123-132000145 CTGGCTTCCAGGTGGGCTGAGGG - Intronic
1091194397 11:133719051-133719073 CTGGTTTCCATCTGGGGTGATGG + Intergenic
1091746371 12:2995437-2995459 CAGCCTGTCATCTGGGGTGAGGG + Intronic
1092751370 12:11722675-11722697 CTGGCCTACAACTGGGGTTTGGG - Intronic
1097518372 12:60636483-60636505 CTAGCTTTCTACTGGGGAGGTGG - Intergenic
1098505688 12:71247864-71247886 CTAGCTTTCCCCTGGGGTTAAGG - Intronic
1100294320 12:93246622-93246644 CTGGCTTGCAAATGGGCTCAGGG + Intergenic
1101462666 12:104912703-104912725 CTGGCTTTAAGCTGGGGTTCCGG - Intronic
1102118197 12:110419607-110419629 GTGGTTCTCAACTGGGGTGGAGG + Intergenic
1102701269 12:114841644-114841666 GGAGCTTTCAACTGGGGTGGAGG + Intergenic
1102752346 12:115306432-115306454 CTGGCATTCCAGTGGGGTGGAGG + Intergenic
1103828862 12:123762743-123762765 CTGACTTTCAAGTGGGCTGTGGG - Intronic
1104397673 12:128448437-128448459 CTGGCTATCATCTGGGATGATGG + Intronic
1104459794 12:128945913-128945935 CTGCATTTTAAGTGGGGTGATGG + Intronic
1104641333 12:130469282-130469304 CATGCTTTCAAATGTGGTGACGG - Intronic
1105501443 13:20976228-20976250 CTGGCTACCAGCTGGGGTGATGG + Intronic
1106203406 13:27564922-27564944 TTGGCTTTTAACTGGTGTGTTGG - Intronic
1107132987 13:36916412-36916434 GAGGCTCTCAACTGGGCTGAGGG + Intronic
1108030667 13:46226018-46226040 CTGCACTTCAACTTGGGTGACGG - Intronic
1108140894 13:47419971-47419993 CTCTCTTTCAACTGTGGTGCAGG + Intergenic
1109971120 13:69770190-69770212 CTGGCTTTCACCTTGGGTGCTGG - Intronic
1110529812 13:76582867-76582889 CTGGCTTTGAAGTTGGGGGAAGG + Intergenic
1111864247 13:93748281-93748303 CTGACTTTTAAATGAGGTGAGGG + Intronic
1115215461 14:31009484-31009506 GTGGTTTTCAACTGGGGCGCGGG - Intronic
1115788738 14:36855848-36855870 GTGGTTCTCAACAGGGGTGAAGG + Intronic
1116387991 14:44356457-44356479 CTTGCTTTTATCTCGGGTGATGG - Intergenic
1116952073 14:50887943-50887965 ATTGCTTTCAACTGAGTTGAGGG + Intronic
1117254307 14:53962979-53963001 CTGGGATTCAGCTGTGGTGAGGG - Intergenic
1117729095 14:58703582-58703604 CTGGCTTCTAACTGGGTTGAGGG + Intergenic
1118572575 14:67208338-67208360 CTCACTTTCTACTGGGGTCAAGG - Exonic
1119493791 14:75061550-75061572 CTCTCTTTAAACTGGGGAGAGGG + Intronic
1119783884 14:77298108-77298130 GTGGCTTTCAACAGAGGAGAGGG - Intronic
1119897354 14:78231314-78231336 TTGGCTCTAAATTGGGGTGAGGG + Intergenic
1121980482 14:98450002-98450024 GAGGCTTTGAACTGGGGAGAAGG + Intergenic
1122129173 14:99595164-99595186 CTTGGGTTCAGCTGGGGTGATGG - Intronic
1122238871 14:100348675-100348697 CTGTCTGTCACCTGGGGAGATGG + Intronic
1123846763 15:24311160-24311182 GTGTCTTTCAAATTGGGTGATGG + Intergenic
1124319618 15:28703196-28703218 CTGGCTCTCAGAAGGGGTGAGGG + Intronic
1124551420 15:30684359-30684381 ATGGTTTACAACTGGGGAGAAGG - Intronic
1124679828 15:31721306-31721328 ATGGTTTACAACTGGGGAGAAGG + Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1127070395 15:55282964-55282986 CTGACTTAGAATTGGGGTGAGGG + Intronic
1128748111 15:70129254-70129276 TTGGCTTTCAACTGGGTTCAGGG - Intergenic
1129038622 15:72665788-72665810 CTGGCTTTCATATACGGTGAAGG - Exonic
1129052322 15:72792782-72792804 CTGGCTATCAGCTGGAGTGATGG - Intergenic
1129211268 15:74071442-74071464 CTGGCTTTCATATACGGTGAAGG + Exonic
1129399135 15:75269645-75269667 CTGGCTTTCATATACGGTGAAGG - Exonic
1129402742 15:75293921-75293943 CTGGCTTTCATATACGGTGAAGG - Exonic
1129728400 15:77915715-77915737 CTGGCTTTCATATACGGTGAAGG + Intergenic
1130011613 15:80156933-80156955 CTTGCCTTCAGCTGGGGTGTGGG + Intronic
1131873329 15:96781841-96781863 CTGGTTTTCATCTGCAGTGATGG + Intergenic
1132040342 15:98520255-98520277 CTGTCTTCCCACTGGGGAGAAGG - Intergenic
1132935251 16:2476748-2476770 GTGGCTTTCCACTGGGTTGAGGG + Intronic
1133255044 16:4511594-4511616 CAGCCTGTCAGCTGGGGTGAGGG + Exonic
1133285994 16:4691094-4691116 CTGGCTTCCCTCTGGGGTCAGGG + Intergenic
1133438177 16:5798109-5798131 CTGGCTTTCAAATGAGGAAATGG - Intergenic
1136545138 16:30950251-30950273 CTGGCTTGCAAGCGGGGTGGAGG - Intronic
1138130268 16:54473323-54473345 GGGGCTCTCCACTGGGGTGATGG + Intergenic
1140243379 16:73225551-73225573 CTGCCTTCCAGCTTGGGTGATGG + Intergenic
1143319142 17:6056698-6056720 CTGGCTGTCTTCTGGGGTGTGGG - Intronic
1143610765 17:8016275-8016297 CTGACCTGCAACCGGGGTGAGGG + Exonic
1144515647 17:15916072-15916094 CTGGCTGTCAGCTGGGGTGGGGG + Intergenic
1145010399 17:19364622-19364644 CTGGATGTCAGCTGGGCTGAGGG - Intronic
1145184251 17:20780550-20780572 CTGTTTGGCAACTGGGGTGAAGG + Intergenic
1146742592 17:35299487-35299509 CTGTTTTTCATCAGGGGTGAGGG - Intergenic
1150691975 17:67374953-67374975 CTGGCTTTAAAATGGTGTCATGG + Intergenic
1151191575 17:72402009-72402031 CTGACTTTTATCTGGGATGAGGG - Intergenic
1152626901 17:81391945-81391967 CTTGCCTTCCACTGGGGAGAGGG - Intergenic
1153172467 18:2331987-2332009 CTGGATTCAAACTGGGGTGGTGG - Intergenic
1154248962 18:12726794-12726816 CTGGCTTTTCCCTGGGTTGAAGG + Intergenic
1155865162 18:30956045-30956067 CTGGCCTTCAACTGGTGAGCAGG + Intergenic
1156512787 18:37655259-37655281 CTGGGTTTCAACTTTAGTGATGG - Intergenic
1157494874 18:48149546-48149568 CTGGCCTTGCAGTGGGGTGAAGG - Intronic
1158106387 18:53889299-53889321 GTGGCTTCCAGCTGGGATGAAGG - Intergenic
1158664129 18:59417058-59417080 CTGGTTTTCAGCTGGGTTCATGG - Intergenic
1159189362 18:65021626-65021648 CTAGCTCACTACTGGGGTGAGGG + Intergenic
1160688678 19:450072-450094 ATGGCTTTCCACAGGGGCGAGGG + Intronic
1161874061 19:6893954-6893976 CTGGCTTTGAAGTTGGGGGAAGG - Intronic
1162272768 19:9629846-9629868 GTTGCTTCCAACTGGAGTGAGGG - Intronic
1166662478 19:44656343-44656365 AAGGTTTTCAACTGGTGTGATGG + Intronic
1167095115 19:47371193-47371215 CTGGCTTTGATCGGAGGTGATGG + Intronic
1167106550 19:47433184-47433206 CTGGCTTTCAGCAGCTGTGAAGG - Intronic
1167142597 19:47662265-47662287 CTGGCTGTTAGCTGGGGTGATGG + Intronic
925429237 2:3776627-3776649 CTGGCTTTCAGCAAGGATGAGGG + Intronic
925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG + Intergenic
926236767 2:11051593-11051615 CTGGCTCTGTTCTGGGGTGAGGG + Intergenic
929563693 2:42971348-42971370 CTGAGTGTCCACTGGGGTGAGGG - Intergenic
931668201 2:64625072-64625094 CTGCCTTTCAGCTGGGCAGAGGG + Intergenic
931901181 2:66789948-66789970 CTGACTGTCACCTGTGGTGATGG + Intergenic
936690601 2:114883790-114883812 CTGGCATTCAGGTGGAGTGATGG + Intronic
940604887 2:155909228-155909250 CTCACTCTCACCTGGGGTGAAGG - Intergenic
943365960 2:186967747-186967769 CAGGCTATCAGCTGGGGTGGAGG + Intergenic
943784271 2:191859899-191859921 CTGGCTGTAAACCAGGGTGAGGG + Intergenic
944369556 2:198966024-198966046 CTGGCTTTTAGCTGGGGTGATGG + Intergenic
945106048 2:206315889-206315911 CTGGCTTGGAACTGGGGGGTGGG - Intergenic
948926301 2:241100829-241100851 CTGATTTTCAACTGGTGTGGGGG + Intronic
1169974623 20:11310841-11310863 GTGGCTTTCATCTGGTGGGAGGG - Intergenic
1170794989 20:19539352-19539374 CTGGATTTCAGCTGGGGGCAGGG + Intronic
1170892848 20:20390869-20390891 CTGGCTGTCATCGGGGGTCATGG + Intronic
1174779649 20:53377273-53377295 ATAGCTTTGAACTGAGGTGACGG - Intronic
1175226330 20:57446135-57446157 CTGACTATCATCTAGGGTGATGG + Intergenic
1176725650 21:10430306-10430328 ATGGCTCTTAACTGGGGAGAGGG - Intergenic
1178870486 21:36370287-36370309 CTGGTTCTCAACTGAGGAGAGGG + Intronic
1184978537 22:48080317-48080339 CTGGGGTCCAACTGGGATGAGGG - Intergenic
949761759 3:7478726-7478748 CTAGCTATCAACTAGTGTGAAGG + Intronic
950138677 3:10600714-10600736 CAGGCTCTCAACTGGGCAGAGGG - Intronic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
952952801 3:38538439-38538461 GTGGGTTTCAGCTGGGGTGTGGG + Intronic
953941986 3:47107860-47107882 CAGGCTTTCAACTGGTGTAGTGG - Intronic
956213128 3:66822357-66822379 CTGGCTTCCAGCTTGGGTAATGG + Intergenic
957510355 3:81180047-81180069 CTGGGTACCAAGTGGGGTGATGG - Intergenic
960025698 3:113006768-113006790 GTGGCTTTTAAGTGGGGAGAAGG + Intronic
962375459 3:134855329-134855351 GAGGCTTTGGACTGGGGTGATGG + Intronic
966000894 3:174947026-174947048 ATGGCTTTGAGCTGAGGTGAAGG - Intronic
967199629 3:187060513-187060535 CTGGCTTTCATCTGAGCAGAGGG + Intronic
968088887 3:195887233-195887255 CTGGCTCTCAAACTGGGTGAAGG + Intronic
969317881 4:6393133-6393155 CTGGCATTAGACTGTGGTGATGG - Intronic
970091650 4:12415180-12415202 CTGTCTCTCAACTGCTGTGAAGG - Intergenic
970961329 4:21874416-21874438 CTGGCTTTCAGCTGGTTTGGGGG + Intronic
973609877 4:52625646-52625668 CTGCCTCTAAACTGGGGTGATGG + Intronic
973913950 4:55613850-55613872 CTGGCTATCAGCAGGGGTGGTGG - Intronic
974021822 4:56698369-56698391 CAGGCTTTCAGCCTGGGTGATGG - Intergenic
974351340 4:60750799-60750821 CTGGCTGTCAGCTGAGGTGAAGG - Intergenic
974638234 4:64592914-64592936 GTGGCATCCAACTGGGATGAAGG - Intergenic
977572869 4:98647988-98648010 CTAACTTTCAAAGGGGGTGAAGG + Intronic
979695322 4:123606623-123606645 TGGGCTTACTACTGGGGTGATGG + Intergenic
983572335 4:169223667-169223689 CTTACTTTCTAATGGGGTGATGG + Intronic
984186165 4:176546229-176546251 CTGGCTTCCAAAAGAGGTGATGG + Intergenic
984331617 4:178327879-178327901 CTGGCTTGCAATTGAGTTGAAGG + Intergenic
985148136 4:186915987-186916009 CTGGCTTTCATTTGGTGTGACGG - Intergenic
985783923 5:1884338-1884360 CAGGCTTGCAGCTGGGGAGAGGG - Intronic
985797527 5:1974049-1974071 CTGGCTTTCAGCTGAGGGGAGGG + Intergenic
987645782 5:20671291-20671313 GTTGCTTTCCACTGGGGTCAGGG - Intergenic
988509018 5:31849805-31849827 CTGCCCTCCAACTTGGGTGATGG + Intronic
989241475 5:39207756-39207778 CTGGTTCTTAACTGGGGTGTGGG + Intronic
991207293 5:64064647-64064669 ATGGTTTTCAACTGGGGTTGAGG + Intergenic
991510680 5:67373554-67373576 CTGATTTTAAACTGGGGGGAGGG + Intergenic
991700617 5:69313226-69313248 CTGTTTGGCAACTGGGGTGAAGG + Intronic
992998750 5:82358397-82358419 CTGGATGTGACCTGGGGTGAAGG + Intronic
994003031 5:94803974-94803996 CTGGCTTTCAACTGGGGTGATGG - Intronic
996030589 5:118699976-118699998 CTGGCTTTTCACTGGGAAGATGG + Intergenic
996076605 5:119202319-119202341 CTGGATTTCACCTGTGGGGATGG - Intronic
997528222 5:134567015-134567037 CTGGCTTTCAGCATGGGTTACGG - Intronic
1000948569 5:167452179-167452201 CTGGCTTCTGAGTGGGGTGACGG + Intronic
1003636910 6:7840368-7840390 CTGGTTTTCAGGTTGGGTGATGG + Intronic
1006410540 6:33870969-33870991 CAGGCTTTCAAGTGAGGGGAGGG - Intergenic
1006415120 6:33899129-33899151 CCGGCTTTCAACAAGGGTGTAGG + Intergenic
1007826895 6:44607455-44607477 CTGCTTTTCAAGTGGGGTCAGGG + Intergenic
1008164073 6:48113932-48113954 CTGGGTTACACCTGGGTTGACGG + Intergenic
1008379400 6:50824656-50824678 ATGCCTCTCAACTGGGATGATGG - Intronic
1008476626 6:51941011-51941033 GAGGCTTTGAACTGGGGTAAAGG - Intronic
1009809161 6:68638759-68638781 CTGGTGTTCAACTTTGGTGAAGG + Exonic
1010666624 6:78638278-78638300 CTTACTTTCCACTGGAGTGAAGG - Intergenic
1016067904 6:139702864-139702886 TTGACTTTCAACTGGGGAGCAGG + Intergenic
1016096617 6:140045340-140045362 CATGCTTCCAACTAGGGTGAGGG + Intergenic
1016560233 6:145388455-145388477 CTGGGTTTTATCTGGGGTTAGGG - Intergenic
1018097317 6:160400376-160400398 CTAGCTTTCAACTTGGAAGAAGG + Intronic
1019129712 6:169864712-169864734 CTGGTTTGCCACTGTGGTGATGG + Intergenic
1019528359 7:1491350-1491372 CAGGCTTTCAACAGCGGTGCCGG + Intronic
1020666619 7:11052007-11052029 CTGTCTTTCAAGGTGGGTGATGG - Intronic
1022309634 7:29184641-29184663 CAGGCCTTCAACTGATGTGATGG + Intronic
1025955361 7:66178494-66178516 CTGGCTTCTAACTTGGGGGATGG + Intergenic
1026966179 7:74441594-74441616 CTGCATTTCAGCTGGGGTGACGG + Intergenic
1029756509 7:102577495-102577517 CTGGCATTCAACTGGGGCCTGGG - Intronic
1029774451 7:102676564-102676586 CTGGCATTCAACTGGGGCCTGGG - Intergenic
1029927535 7:104333366-104333388 CTCGCTTTCATCTGTGGAGATGG + Intronic
1035558971 8:590753-590775 AGGGCTTCCCACTGGGGTGATGG + Intergenic
1037256767 8:16964342-16964364 CTGGCTCTCAATTTGTGTGATGG - Intergenic
1038530653 8:28315957-28315979 CTGGATTTAGACTGAGGTGATGG - Intergenic
1038865351 8:31433704-31433726 CTGGCTTGGCTCTGGGGTGAAGG + Intergenic
1039216533 8:35278113-35278135 CTGGCTTTCACCAGGAATGAAGG - Intronic
1039903058 8:41766960-41766982 CAGGCTGTCCCCTGGGGTGAGGG + Intronic
1040277622 8:46022035-46022057 CTGGCTTGCACCCAGGGTGAGGG - Intergenic
1041416720 8:57618198-57618220 CTGACTCTCTACTGGGGAGAGGG + Intergenic
1044054214 8:87548315-87548337 CTGCACTTAAACTGGGGTGAAGG + Intronic
1046044527 8:108947955-108947977 CTTTCTTTCTACTGGGGGGAAGG + Intergenic
1047903218 8:129446027-129446049 AAGGCTTTCAACTGCGGCGACGG + Intergenic
1049588382 8:143442209-143442231 CTGGCTTCCACCTGGGGGTATGG - Intronic
1050319300 9:4434667-4434689 CTGGCTTACATCTGGATTGAGGG - Intergenic
1050405392 9:5303983-5304005 CTGGCTTTCCTGTGGGGTGCAGG + Intronic
1050408694 9:5339149-5339171 CTGGCTTTCCTGTGGGGTGCAGG + Intronic
1051666703 9:19472854-19472876 CTAACTTTCAGATGGGGTGATGG + Intergenic
1053307650 9:36995516-36995538 CTGGCTGTCAACAGTGGGGATGG + Intronic
1056137207 9:83642173-83642195 CAGGATTTCCACTGGGGTCATGG - Intronic
1056571614 9:87821422-87821444 GTGGCTTTCAACTGTGGTCTAGG - Intergenic
1058147684 9:101430045-101430067 CTTGCTTTCCACTGTGGTGAGGG - Intronic
1059629074 9:116100065-116100087 TTGGCTGTCAACTTGGGAGATGG + Intergenic
1060074710 9:120580761-120580783 ATGTCTTTCAACTGGAGTGGGGG + Intergenic
1060216527 9:121741771-121741793 CCTGCTTTCAGCTGGGGTGAAGG - Intronic
1060326947 9:122626063-122626085 CTGCATCTCAAGTGGGGTGAAGG + Intergenic
1060400434 9:123345778-123345800 CTGGCTTTCATCTGGGGCTGTGG - Intergenic
1060972153 9:127744534-127744556 CTGGCTGTGCACTGGGGTGGAGG - Intronic
1187216401 X:17281344-17281366 CTGGCTGTCACTTGGGGTGATGG + Intergenic
1188315855 X:28672682-28672704 ATTCCTTTCAAGTGGGGTGATGG - Intronic
1190286176 X:48962686-48962708 TTGGCTCTCATCTGGGGTGTTGG + Exonic
1191110863 X:56802432-56802454 CTGGCTTTCACATGGGGTGGGGG - Intergenic
1193825821 X:86225301-86225323 CTGGCTTCCAAATGTGGTAATGG - Intronic
1200226308 X:154419731-154419753 CTGCGTTTCAAGTGGGGTAAGGG + Exonic