ID: 994003620

View in Genome Browser
Species Human (GRCh38)
Location 5:94811421-94811443
Sequence CTGTTTGAACAGTTGGAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994003620_994003622 -2 Left 994003620 5:94811421-94811443 CCGAACTCCAACTGTTCAAACAG 0: 1
1: 0
2: 0
3: 11
4: 168
Right 994003622 5:94811442-94811464 AGCCTGACTTTTACAGTAAAAGG 0: 1
1: 1
2: 0
3: 15
4: 231
994003620_994003624 3 Left 994003620 5:94811421-94811443 CCGAACTCCAACTGTTCAAACAG 0: 1
1: 0
2: 0
3: 11
4: 168
Right 994003624 5:94811447-94811469 GACTTTTACAGTAAAAGGAAAGG 0: 1
1: 1
2: 2
3: 28
4: 385
994003620_994003625 9 Left 994003620 5:94811421-94811443 CCGAACTCCAACTGTTCAAACAG 0: 1
1: 0
2: 0
3: 11
4: 168
Right 994003625 5:94811453-94811475 TACAGTAAAAGGAAAGGCCCTGG 0: 1
1: 0
2: 2
3: 30
4: 268
994003620_994003626 10 Left 994003620 5:94811421-94811443 CCGAACTCCAACTGTTCAAACAG 0: 1
1: 0
2: 0
3: 11
4: 168
Right 994003626 5:94811454-94811476 ACAGTAAAAGGAAAGGCCCTGGG 0: 1
1: 0
2: 4
3: 52
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994003620 Original CRISPR CTGTTTGAACAGTTGGAGTT CGG (reversed) Intronic
901092530 1:6651592-6651614 CTTTTCAAACAGTTGGAATTTGG - Exonic
902072807 1:13755096-13755118 GTTTTTCAACAGTAGGAGTTCGG + Intronic
902394297 1:16124237-16124259 CTGTTTAAACACTAGGGGTTTGG + Intergenic
902831598 1:19017109-19017131 CTGTTTGAAATGTTGTAGGTAGG - Intergenic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
907615599 1:55921848-55921870 CTCTTTTAAAAGTTGCAGTTGGG + Intergenic
909514909 1:76496448-76496470 CTGTTAGAACTGTTATAGTTTGG + Intronic
910030366 1:82713933-82713955 CTCTTTAAACAGTTCTAGTTAGG + Intergenic
910187046 1:84555309-84555331 CTTTTTGAATAATTGGATTTAGG - Intronic
910377175 1:86585364-86585386 AAGATTGAACAGTAGGAGTTTGG + Intergenic
910395815 1:86792857-86792879 CTGTTTGAACAGTTGCCATGGGG - Intergenic
910624099 1:89288089-89288111 ATGTTTGAGCATTTTGAGTTGGG - Intergenic
910838272 1:91537154-91537176 CTGTTTTCACTGTTGAAGTTGGG - Intergenic
910877718 1:91892929-91892951 ATGTTTGATCAGTTGGCTTTAGG - Intronic
911346094 1:96698461-96698483 CTTTTTGAAGAGGTGGGGTTTGG + Intergenic
913126670 1:115797099-115797121 TTGTTTGAACAGATGGGATTGGG - Intergenic
913601881 1:120429102-120429124 CTGTGTGCACACTTGTAGTTAGG + Intergenic
914085162 1:144447501-144447523 CTGTGTGCACACTTGTAGTTAGG - Intronic
914588980 1:149089479-149089501 CTGTGTGCACACTTGTAGTTAGG - Intronic
917048778 1:170893974-170893996 CTGTTTGAATAGTTCCAATTTGG + Intergenic
917145477 1:171885844-171885866 CTGTTTGCACAGTGAGGGTTAGG + Intronic
917618496 1:176770422-176770444 CGGTTTGAACAGAGGCAGTTTGG - Intronic
918083336 1:181224110-181224132 CTCTTTGACCAGATGGTGTTGGG + Intergenic
922083164 1:222317994-222318016 GTGTTTGACAAGTTGGAATTTGG - Intergenic
922994113 1:229942544-229942566 ATGTTTGCACAGCTGCAGTTTGG + Intergenic
1063752487 10:8966411-8966433 CTGTGAGAACAGTTGGACATGGG - Intergenic
1065719349 10:28611165-28611187 GTATTTGAAGAGTTGAAGTTTGG + Intronic
1066492892 10:35911529-35911551 CTGCTTGAACAGTGAGACTTTGG + Intergenic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1069067222 10:63955119-63955141 TTGTTTGAAACTTTGGAGTTAGG + Intergenic
1070112328 10:73497697-73497719 CCTTTTGAACAGATGGAGTCAGG - Exonic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1071105673 10:82091612-82091634 CTGTTTGTACAGCTGGTCTTGGG - Intronic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1084484881 11:69442472-69442494 CTGTTTGCACAGTTCTAATTTGG + Intergenic
1086285377 11:85243126-85243148 CTGTTTCAACTGTTGGTGGTAGG - Intronic
1088474208 11:110218545-110218567 CTTTTTGGACAATTTGAGTTTGG - Intronic
1090144658 11:124308574-124308596 TTGTTAGAACAGTAGGATTTTGG + Intergenic
1090508122 11:127341532-127341554 TTGTGAGAAAAGTTGGAGTTAGG + Intergenic
1091480970 12:830266-830288 CTGAGTGAACTGTTGGGGTTGGG + Intronic
1091556133 12:1574717-1574739 CTGCTTGAACAGCTGGATGTGGG + Intronic
1092718296 12:11414851-11414873 ATGTTTGATCAGATGCAGTTTGG + Intronic
1093046359 12:14450059-14450081 ATGTTTGAACAGTTGTCTTTAGG + Intronic
1095905167 12:47369819-47369841 CTGTCTGACCAGTTCAAGTTGGG - Intergenic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1097965020 12:65569990-65570012 CCTTCTGAAGAGTTGGAGTTGGG - Intergenic
1098722614 12:73921805-73921827 CTACTTGATCAGTTGCAGTTTGG + Intergenic
1098869870 12:75804743-75804765 CTGTTTGATCAGATGAAGTATGG + Intergenic
1100704470 12:97185335-97185357 CTGTTTGAATAGTTCCAGGTGGG - Intergenic
1101045163 12:100797911-100797933 TGGTTTCAACATTTGGAGTTTGG - Intronic
1101629885 12:106482998-106483020 CTGTGTGATCAGTTAGGGTTGGG - Intronic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1105468064 13:20665877-20665899 ATGATTGGACACTTGGAGTTTGG + Intronic
1106213496 13:27673226-27673248 CTGGTTGAACAGGTGGTGTTTGG - Intergenic
1107967856 13:45613705-45613727 CTGGTTCCACATTTGGAGTTTGG + Intronic
1108497229 13:51036923-51036945 CTTTTTGAACAGTTCTGGTTTGG + Intergenic
1108781391 13:53840369-53840391 TTGTTTATACAGTTGAAGTTTGG - Intergenic
1113831618 13:113299862-113299884 CTTTTTTAAAAGTTGGATTTTGG - Intronic
1114145520 14:19972325-19972347 CTATTTGAACTGGTAGAGTTTGG + Intergenic
1118705808 14:68479288-68479310 CTATTTGAGAAGTTGGAGGTAGG + Intronic
1118892583 14:69922394-69922416 CTGCTTGAAGTGTTGGAGTGTGG + Intronic
1202828285 14_GL000009v2_random:389-411 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1127034228 15:54896982-54897004 TTGACTGAACAGTTGGAGTTGGG - Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1130423053 15:83767469-83767491 ATGTTTGAACAGGGGGAATTGGG + Intronic
1131801079 15:96069980-96070002 CTTTTTGAAATGTGGGAGTTAGG - Intergenic
1138637922 16:58357755-58357777 TTGGTGGAACAGGTGGAGTTTGG + Intronic
1139522305 16:67491018-67491040 CAGTTTGAAGAGTGTGAGTTTGG + Intergenic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1149852387 17:60046100-60046122 CTGTTAGAACAGTAGAAATTAGG + Exonic
1150494339 17:65595771-65595793 ATGCTTGAGCAGTTGTAGTTTGG - Intronic
1151012614 17:70517937-70517959 TTGTTTAAACAATTGCAGTTAGG - Intergenic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1158253334 18:55515602-55515624 CTCTTTGAAGCGTTGGACTTTGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160688254 19:447434-447456 CAGTTTAAACAGTTGGGATTAGG + Intronic
1164572370 19:29383694-29383716 CTGTCTGAGCAGTTTGAGTTGGG - Intergenic
1166015104 19:39973863-39973885 CTCTTTGACCTGTGGGAGTTGGG + Intronic
1202644414 1_KI270706v1_random:127431-127453 CTTTTTGAACAGTTGTTGTATGG - Intergenic
930056487 2:47256449-47256471 TTGTTTGGAGAGTAGGAGTTAGG - Intergenic
931712072 2:64996861-64996883 CTGTGTGAACATGAGGAGTTGGG + Intronic
932284165 2:70518621-70518643 CTGATTGAGGAGTTGGAGTGGGG - Intronic
932813276 2:74841966-74841988 CTGTTTGATGAGCTGGAGTCAGG + Intronic
934506793 2:94901023-94901045 CTTTTTGAACAGTTGTTGTGTGG - Intergenic
935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG + Intronic
937506871 2:122547454-122547476 CATTTAAAACAGTTGGAGTTAGG - Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
938528265 2:132157610-132157632 CTGTTTGAACAGAAAGAGCTTGG + Intronic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
945420473 2:209630006-209630028 CTGTTTGACCAAATGGAGATAGG + Intronic
946721744 2:222616275-222616297 TTTTTTTAACAGTTTGAGTTCGG - Intronic
1168968803 20:1916751-1916773 CTGTTTTAATAGTTCAAGTTTGG - Intronic
1173088584 20:39948825-39948847 CTGTTTAAACAGTGAGTGTTAGG - Intergenic
1174209989 20:48870341-48870363 GGCTTTGAAGAGTTGGAGTTGGG - Intergenic
1176607467 21:8845223-8845245 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1180357550 22:11855010-11855032 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1180380714 22:12137323-12137345 CTTTTTGAACAGTTGTTGTATGG - Intergenic
1182514714 22:30848818-30848840 ATGTTTGAATAGTTTCAGTTTGG + Intronic
952010228 3:28892284-28892306 CAGTTTCAAAAGCTGGAGTTTGG - Intergenic
952361871 3:32638336-32638358 GTGTTTGATCATTTGGAGCTGGG + Intergenic
955068221 3:55550693-55550715 CTGTTTGAAAATTTGGAAATCGG - Intronic
955246773 3:57231926-57231948 TTGTTTGATCAGCTGGATTTTGG - Intronic
956490354 3:69764911-69764933 TTGTTTTAACAGTGGGAGTCTGG + Intronic
958745285 3:98126919-98126941 TTGTTTGCACTGTTGGATTTTGG - Intergenic
959483115 3:106897440-106897462 CTTTTTGAACAGTTGATGTATGG + Intergenic
960089609 3:113626044-113626066 CTCTTTGAACAGTTGAACTGTGG + Intronic
966466448 3:180235312-180235334 TTGCATGAACATTTGGAGTTTGG - Intergenic
966877999 3:184334635-184334657 TTGTTTGAACAGTGGAACTTGGG + Intronic
968854960 4:3113114-3113136 GTGTTTGAACAGTTGTAGCGTGG + Intronic
970069888 4:12145770-12145792 CTGTTTTAAGAGTTGGACATTGG + Intergenic
970146740 4:13043929-13043951 CTGATTGAATTGTTTGAGTTGGG - Intergenic
970701034 4:18738846-18738868 TTGTTTGTTCTGTTGGAGTTTGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973718925 4:53704090-53704112 CTGTATCAACAGTTGTACTTCGG + Intronic
974602001 4:64095364-64095386 CAGTGTGAACAGTTTGAGATTGG - Intergenic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
976708294 4:88041828-88041850 CTGTTTGCAAGGTTGGACTTTGG - Intronic
981967786 4:150626756-150626778 CTGTTTAAACACTTGGAAATGGG + Intronic
988078394 5:26382674-26382696 CTGTTTGCCCTGTTGGATTTTGG + Intergenic
988966214 5:36420763-36420785 CTGTTGGACCACTTGGAGTATGG + Intergenic
989231563 5:39093059-39093081 CTGCTTGAAAAGTTGGCTTTGGG - Intergenic
989899833 5:47154543-47154565 CTGTTTGAACAGTCTGAATGTGG + Intergenic
990439349 5:55829253-55829275 CAGGTTTAACAGTTGGATTTGGG - Intergenic
992019675 5:72609994-72610016 CTCTTTAAACAGTAGGACTTGGG - Intergenic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
995581364 5:113606404-113606426 CTGATTGAGCAGTTGGAGGCGGG - Intergenic
1006073687 6:31515808-31515830 CTGTTAGAAGTGCTGGAGTTGGG + Intergenic
1008045202 6:46844728-46844750 CCATTTGACCAGTTGGAGTTTGG - Intergenic
1008165950 6:48138582-48138604 CTGTTTTAACGGTTGGTATTTGG + Intergenic
1011272276 6:85592152-85592174 ATGTTTGAACTGTAGGAGTGTGG - Intronic
1013837338 6:114348249-114348271 CTATTTGAACATCTGGATTTTGG - Intergenic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1017264298 6:152424254-152424276 CTGATTTAACAGTTGAACTTTGG - Intronic
1017858506 6:158373443-158373465 CTGAGTGAACAGTTAGAGTGTGG + Intronic
1018140578 6:160829928-160829950 CTGTGTGAAGAGTTAGAGGTAGG + Intergenic
1018542428 6:164896909-164896931 ATATTTGAAGTGTTGGAGTTTGG - Intergenic
1023521167 7:41051404-41051426 GTGTGTGATGAGTTGGAGTTTGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1028411668 7:90536955-90536977 AGGTTTGAACAGTGGAAGTTAGG - Intronic
1030340010 7:108367029-108367051 CTATTTTAACATTTGGTGTTAGG - Intronic
1030395784 7:108984729-108984751 CTGTTTGTAGAGTTGGTGATTGG + Intergenic
1031360451 7:120843504-120843526 CAGTTTGAACAATTGGCCTTGGG - Intronic
1032836675 7:135681545-135681567 CAGTTTGTACACTTGGCGTTAGG + Exonic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1035103905 7:156425853-156425875 CTGTTGGAACAGAGGAAGTTTGG - Intergenic
1035781550 8:2232116-2232138 CTGTTTGAATTGTTGGAATTAGG + Intergenic
1036293477 8:7516380-7516402 CAGTGTGAACAGTTGGGATTTGG + Intergenic
1036329082 8:7804615-7804637 CAGTGTGAACAGTTGGGATTTGG - Intergenic
1036397446 8:8381352-8381374 CTGTTTGAACACTTGGTGACTGG - Intronic
1038244414 8:25841439-25841461 CTGTTTGCTCTGTTGGATTTTGG - Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1042407351 8:68421482-68421504 CTGGATGTACAGTAGGAGTTGGG - Intronic
1045695142 8:104800951-104800973 CTCTTTGAGGAGTTGAAGTTTGG + Intronic
1047492327 8:125385280-125385302 GAGTTTGAATATTTGGAGTTTGG - Intergenic
1049960962 9:737660-737682 GTGGTTGAACAGTTGTATTTGGG + Intronic
1051311661 9:15780655-15780677 CTTTATGCACAGTTGTAGTTTGG + Intronic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1053652363 9:40182011-40182033 CCATTTGACCAGTTGGAGTTTGG + Intergenic
1053661825 9:40289574-40289596 CTGTTTAAACAGCTGGCATTTGG - Intronic
1053902759 9:42811323-42811345 CCATTTGACCAGTTGGAGTTTGG + Intergenic
1054354272 9:64046410-64046432 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1054373951 9:64435810-64435832 CTGTTTAAACAGCTGGCATTTGG - Intergenic
1054522784 9:66086710-66086732 CTGTTTAAACAGCTGGCATTTGG + Intergenic
1054532219 9:66194204-66194226 CCATTTGACCAGTTGGAGTTTGG - Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1203702801 Un_KI270742v1:10111-10133 CTTTTTGAACAGTTGTTGTATGG + Intergenic
1203567494 Un_KI270744v1:103896-103918 CTTTTTGAACAGTTGTTGTATGG - Intergenic
1186316937 X:8381213-8381235 CTGATTGAACAGCTGCGGTTGGG + Intergenic
1186872742 X:13788592-13788614 CTTTTTCATCATTTGGAGTTAGG + Intronic
1191271174 X:58472486-58472508 TTGATTGAGCAGTTTGAGTTTGG + Intergenic
1193526204 X:82592540-82592562 CAGGTGGAAGAGTTGGAGTTAGG - Intergenic
1194868784 X:99101638-99101660 CTGTTTAAACTGATGGACTTTGG - Intergenic
1195144267 X:101997761-101997783 ATGTTTGAATAGTGGGAGTGGGG - Intergenic
1196273724 X:113741807-113741829 TTGTTTAAGCAGTTGGAGGTTGG - Intergenic
1196971224 X:121110393-121110415 TTGTGTGAACAGGTGGTGTTTGG - Intergenic
1197484143 X:127026070-127026092 GAGTTTGAACATGTGGAGTTTGG + Intergenic
1198816545 X:140597845-140597867 CTGTTTGAAGATTTGGTGGTGGG - Intergenic