ID: 994004874

View in Genome Browser
Species Human (GRCh38)
Location 5:94826244-94826266
Sequence TCATTTACTAACTTTAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 29, 3: 52, 4: 409}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994004872_994004874 29 Left 994004872 5:94826192-94826214 CCAAGCAATTTGCTTCTTATTGA 0: 1
1: 0
2: 0
3: 24
4: 254
Right 994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG 0: 1
1: 1
2: 29
3: 52
4: 409
994004873_994004874 -5 Left 994004873 5:94826226-94826248 CCATGCTTGTAGATTAGTTCATT 0: 3
1: 12
2: 16
3: 22
4: 216
Right 994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG 0: 1
1: 1
2: 29
3: 52
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994004874 Original CRISPR TCATTTACTAACTTTAGATT TGG Intronic
900796951 1:4713742-4713764 ACATTTGCTAACTTTAAAATCGG + Intronic
901366194 1:8750860-8750882 TCATTTACTGACTTCAGATTTGG - Intronic
901369699 1:8786484-8786506 TCATTTACTGACTTCAGATTTGG + Intronic
904388431 1:30162709-30162731 GCATTTACTAACTGTTTATTTGG + Intergenic
904864456 1:33567328-33567350 TCATTTTCTAGCTTTTGAGTAGG - Intronic
906969039 1:50490991-50491013 TGATTAAATAGCTTTAGATTTGG - Intronic
907696016 1:56730140-56730162 TCTTCTACTAACTTTGGATTTGG - Intronic
909898033 1:81098553-81098575 TCATTTACTGACTTCAGATTTGG + Intergenic
910378979 1:86605360-86605382 TATTCTACTAATTTTAGATTTGG + Intergenic
911083163 1:93953341-93953363 TCTTTTACTAATTTTGGGTTTGG + Intergenic
911344418 1:96679166-96679188 TCATTTACTGACTTCAGATTGGG + Intergenic
911436657 1:97868682-97868704 ACATTTACTAACTTGATCTTGGG - Intronic
912434555 1:109651786-109651808 TCATTTACTGACTTCAGATTTGG - Intergenic
913036648 1:114972438-114972460 TCTTCTACTAACTTTGGGTTTGG + Intronic
916010733 1:160703259-160703281 TCACTTACTTCCCTTAGATTGGG - Intronic
916341544 1:163741898-163741920 TCTTTTACTAATTTTGGATTTGG + Intergenic
916360826 1:163966190-163966212 TCTTCTACTAATTTTGGATTTGG - Intergenic
916616066 1:166441563-166441585 TCTTCTACTAACTTTGGGTTTGG + Intergenic
916974962 1:170066380-170066402 TCTATTACTAACATTAGACTTGG + Intronic
917061418 1:171045324-171045346 TCTTTTACTAATTTTGGGTTTGG + Intronic
917226099 1:172784863-172784885 TCTTCTACTAATTTTGGATTTGG + Intergenic
917905157 1:179581111-179581133 TCATTTAAAAAATTTTGATTAGG - Intergenic
918568886 1:185963423-185963445 CCATTTACTAACTCTGGCTTTGG + Intronic
918747005 1:188215563-188215585 CCTTTTACTAACTTTAGGTTTGG + Intergenic
919737816 1:200964426-200964448 TATTTTAAGAACTTTAGATTCGG + Intergenic
919949773 1:202352065-202352087 TCAGTGACTAAATTAAGATTTGG + Intronic
921043056 1:211452736-211452758 TCTTCTACTAATTTTAGGTTTGG - Intergenic
921295818 1:213701945-213701967 TCTTCTACTAATTTTGGATTTGG + Intergenic
922044641 1:221932532-221932554 TCATCTATTAATTTTGGATTTGG - Intergenic
922381661 1:225035422-225035444 TCTTCTACTAACTTTGGATTTGG + Intronic
922639533 1:227214252-227214274 TTATTTAATAAATTTATATTTGG + Intronic
922654248 1:227367006-227367028 ATATTTAGAAACTTTAGATTGGG + Intergenic
1064906697 10:20354842-20354864 TCATATTCTAACTTTAGAGATGG - Intergenic
1065549191 10:26853472-26853494 GCATTTACAAAGTTTTGATTGGG - Intronic
1066470957 10:35697726-35697748 TCATTTACTGACTTCAGATTTGG - Intergenic
1067351317 10:45478501-45478523 TCTTTTACTAATTTTGGATTTGG - Intronic
1068648354 10:59493996-59494018 TCATCTACTAATTTGGGATTTGG + Intergenic
1068785052 10:60962924-60962946 TGATATTCTAACTCTAGATTAGG - Intronic
1068840530 10:61608845-61608867 TCATTTTCAGACTTTACATTTGG + Intergenic
1071418769 10:85467402-85467424 TCTTTTACTAATTTTGGGTTTGG - Intergenic
1071617861 10:87093452-87093474 TCATTTAATGTCTGTAGATTTGG - Intronic
1071879595 10:89881675-89881697 TCATCCACTAACTTTGCATTTGG + Intergenic
1072344120 10:94486330-94486352 TCTTTCACTAATTTTGGATTTGG + Intronic
1072777846 10:98218560-98218582 TCTTTTACTAATTTTGGGTTTGG + Intronic
1072864873 10:99048071-99048093 TCATTTACTGACTTCATATTTGG - Intronic
1074128373 10:110550404-110550426 TCATTTACTGAATTCAGGTTCGG + Intergenic
1074233193 10:111558107-111558129 TCATTCATTATCTTTAGAGTTGG - Intergenic
1075281589 10:121143572-121143594 TCATTTTGGAGCTTTAGATTTGG - Intergenic
1075676363 10:124298490-124298512 TCATTTATTAGTTTTAGAATTGG - Intergenic
1075748707 10:124745769-124745791 TAATTTACTAACGTTTTATTAGG + Intronic
1076913897 10:133409071-133409093 TCTTCTACTAATTTTGGATTTGG + Intronic
1077030675 11:464760-464782 TAATTTACTAAGTTTAAAATGGG - Intronic
1077202215 11:1315733-1315755 TCCTCTACTAATTTTGGATTTGG + Intergenic
1079003147 11:16774269-16774291 TGATTTAATATCTTTGGATTTGG - Intergenic
1079252414 11:18796355-18796377 TTATTTACGAGCTATAGATTAGG + Intergenic
1079539397 11:21553660-21553682 ACATTTGTTAAGTTTAGATTTGG - Intronic
1080097055 11:28420829-28420851 TCTTCTACTAACTTTGGATTTGG - Intergenic
1080953016 11:37058150-37058172 TCATTTACCCACTTTATAATGGG - Intergenic
1081148167 11:39590682-39590704 TCATTTAATTACTTTAGTATAGG + Intergenic
1081244633 11:40749584-40749606 TCATTTGCTAATTTTGGCTTTGG - Intronic
1081431112 11:42977625-42977647 TCATTCACCAACTCTAGGTTGGG - Intergenic
1082202722 11:49392288-49392310 TCAGTGACTAACTTTAGTTTGGG - Intergenic
1082745519 11:56956938-56956960 TCATTTTTTAACTTTTTATTAGG + Intergenic
1082896205 11:58192781-58192803 TCATTTAAAAACTGCAGATTGGG + Intergenic
1085922259 11:80971389-80971411 TCATTTAATTACTTTTGATGTGG + Intergenic
1085980792 11:81721898-81721920 TTTTTTACTAACTTTGGGTTTGG - Intergenic
1086114505 11:83233611-83233633 TCTTTTACTAATTTTGTATTTGG + Intronic
1086249084 11:84792945-84792967 TCTTTTACTAATTTTGGGTTTGG + Intronic
1086277864 11:85152606-85152628 TCAGTCTCTCACTTTAGATTAGG + Intronic
1086652313 11:89307788-89307810 TCAGTGACTAACTTTAGTTTGGG + Intergenic
1087367897 11:97244889-97244911 TCTTCTGCTAACTTTAGGTTTGG + Intergenic
1087675986 11:101162384-101162406 TCCTTTACTCATTTTGGATTTGG + Intergenic
1087896656 11:103593971-103593993 TCATAAACTAGCTTTAGCTTGGG - Intergenic
1087896780 11:103594893-103594915 TCATAAACTAGCTTTAGCTTGGG - Intergenic
1090157124 11:124451059-124451081 TCTTCTACTAATTTTAGATTTGG - Intergenic
1090787205 11:130060292-130060314 GCCTTTACTAAATTGAGATTAGG + Intergenic
1091598120 12:1893866-1893888 CCATTCACTAATTTTAGGTTTGG - Intronic
1091598632 12:1901307-1901329 TCTTCTACTAACTTTTGGTTTGG - Intronic
1091603898 12:1934623-1934645 TCATTTGCTCACGTTAGAGTGGG + Intergenic
1091609580 12:1994262-1994284 TCATTTATTTACTTTAAATGAGG + Intronic
1092442063 12:8513310-8513332 ACATTTACTAAATTTTTATTGGG + Intronic
1093323922 12:17749281-17749303 TCATTTAGAAAGTTTAGTTTTGG + Intergenic
1093431416 12:19089577-19089599 TCATTTACTGACTTCAGATTGGG - Intergenic
1093538483 12:20251477-20251499 TCTTTTACCAATTTTAGGTTTGG - Intergenic
1093759795 12:22896080-22896102 TAATTTTCTAATTTTAGTTTTGG - Intergenic
1094036628 12:26078930-26078952 TCAATTACTAGCTTTAGTTTGGG - Intronic
1094165809 12:27442169-27442191 CCTTTTACTAATTTTGGATTTGG - Intergenic
1094456643 12:30642424-30642446 TCTTTTTTTAATTTTAGATTTGG - Intronic
1094699463 12:32854793-32854815 TCATTTACTTATTTTATAATTGG - Intronic
1095665691 12:44795010-44795032 ACATAAACTAACTTAAGATTAGG + Intronic
1095860519 12:46911936-46911958 TCCTCTACTAACTTTGGGTTTGG - Intergenic
1096624539 12:52886076-52886098 TCATTTACTGACTTCATATTTGG - Intergenic
1097714407 12:62951161-62951183 TCCTCTACTAACTTTGGGTTTGG + Intergenic
1097742729 12:63263216-63263238 TCTTTTACTTACTTTAAATCTGG - Intergenic
1097900486 12:64868245-64868267 TCATTTACTTACTTTAGGTTTGG + Intronic
1098333402 12:69377201-69377223 TCCTCTACTAACTTTGGGTTTGG + Intronic
1098959293 12:76721954-76721976 TCACTTACTGACTTCAGGTTTGG - Intergenic
1099024803 12:77451841-77451863 TCTTCTACTAATTTTACATTTGG - Intergenic
1099231363 12:80029323-80029345 TCATTTACTGACTTCGGATTTGG - Intergenic
1099399890 12:82190820-82190842 TCTTTTACTAATTTCGGATTTGG - Intergenic
1099564396 12:84223090-84223112 TCCCTTTTTAACTTTAGATTTGG + Intergenic
1099582930 12:84475918-84475940 TCTTTTACTAATTTTGCATTTGG - Intergenic
1100182486 12:92100442-92100464 CCATTTTCTACCTTTAGACTAGG - Intronic
1100328520 12:93564743-93564765 TCATTCAATAACTTTATATTGGG + Intergenic
1100886554 12:99077203-99077225 TCATGTATTTACTTTAGGTTAGG + Intronic
1101318916 12:103655654-103655676 TTATTTACTATCTCTAGTTTAGG - Intronic
1106712157 13:32349469-32349491 TCATTTCTTATCTTTAGAATTGG + Intronic
1106882855 13:34150648-34150670 TCCTATTCTAACTTTAAATTGGG + Intergenic
1106963785 13:35035050-35035072 TCTTCTACTAATTTTGGATTTGG + Intronic
1107305679 13:39015908-39015930 TTATTTACAAACATAAGATTAGG - Intronic
1107505051 13:41025595-41025617 TCAGTCACTAACTTGACATTGGG - Intronic
1108160898 13:47637948-47637970 TCTTCTACTAATTTTAGTTTTGG - Intergenic
1109825012 13:67707444-67707466 TCTTTTACTAAGTTTTGGTTGGG + Intergenic
1109940683 13:69360124-69360146 TCATTTACTTATTTTTGGTTTGG - Intergenic
1110376316 13:74798073-74798095 ACATTTACAAAATTGAGATTAGG - Intergenic
1110568696 13:76981463-76981485 TTATTTACTGACTTCAGATTTGG + Intergenic
1110793103 13:79606878-79606900 TCATTTCAGAACTTTAGATTTGG - Intergenic
1111181614 13:84675155-84675177 TCTTTTATTAACTTTTCATTTGG + Intergenic
1111710576 13:91807461-91807483 TTATTAACTAACATTTGATTGGG - Intronic
1112371051 13:98793586-98793608 TAATTTAGTAATTTTATATTTGG - Exonic
1112791649 13:103009448-103009470 TCCTTTACCAATTTTGGATTGGG + Intergenic
1112937123 13:104814755-104814777 TCCTTTATTGACTTCAGATTTGG - Intergenic
1112944344 13:104908253-104908275 TCTTCTACTAATTTTTGATTTGG + Intergenic
1113128034 13:107001675-107001697 TCATTAACGATCTTTAGTTTAGG + Intergenic
1113212227 13:107996862-107996884 TCTTCTACTAACTTTAGATTTGG + Intergenic
1114292449 14:21299698-21299720 ACATTTACTAACTGTAGCTTTGG - Intronic
1114687762 14:24550241-24550263 TCTTTTACTAATTTTGGATTTGG + Intergenic
1115224584 14:31089445-31089467 ACAATTTCTAACTCTAGATTTGG - Intronic
1116298644 14:43146664-43146686 TTATTTACTAACTTCATCTTTGG + Intergenic
1117742976 14:58836858-58836880 TCATTTACAAAATTTTTATTGGG + Intergenic
1117923095 14:60746071-60746093 AGATTTTCTAACTTGAGATTTGG - Intronic
1118333998 14:64836254-64836276 TGATTTACTAACCTATGATTTGG + Intronic
1118866804 14:69710834-69710856 ACATTTACTTTCTTTAAATTAGG + Intronic
1120015575 14:79469668-79469690 TCATTTCCTAATCTAAGATTTGG - Intronic
1120133772 14:80839363-80839385 TCATTTAATAACTGTACATGTGG + Intronic
1120335714 14:83151673-83151695 TAATTTGCTATCTTTAGGTTTGG - Intergenic
1120439399 14:84517044-84517066 TTTTTTACTAATTTTGGATTTGG + Intergenic
1120697728 14:87663075-87663097 TCTTTTACTAATTTTGGGTTTGG - Intergenic
1121655557 14:95593076-95593098 TCATTCACAAACATTAGGTTAGG + Intergenic
1125090784 15:35789784-35789806 CCATGTACTAACTTCAGGTTTGG + Intergenic
1126042775 15:44608975-44608997 TCATAGAATAACTTTAGAGTTGG - Intronic
1127493505 15:59487378-59487400 TCTTCTACTAACTTTGGGTTTGG - Intronic
1127970525 15:63956321-63956343 TCTTCTACTAATTTTGGATTTGG + Intronic
1128411664 15:67405614-67405636 TCATTTATTAGCTATAAATTTGG - Intronic
1128772965 15:70296271-70296293 TCATTTATCAACTTTAGATCAGG + Intergenic
1130165888 15:81457742-81457764 TCTTTTGCTAACTTTGGGTTTGG + Intergenic
1134358822 16:13510856-13510878 TCATCTACGTACTTTAGCTTGGG + Intergenic
1134900411 16:17932965-17932987 TCATTTACTGACTTCAGATTGGG - Intergenic
1136663555 16:31787694-31787716 TCTTCTGCTAACTTTAGGTTTGG + Intronic
1138427301 16:56944306-56944328 AAATTTACTAAATTTAAATTTGG - Exonic
1138905657 16:61328271-61328293 TCATTTGCTCATTTTAAATTGGG + Intergenic
1141038263 16:80648121-80648143 TCATCTACTAATTTTGGGTTTGG - Intronic
1143580875 17:7825014-7825036 TCATTTCCTATCTTTAAAATGGG - Intronic
1143815581 17:9510728-9510750 TCCTTTACTAATTTTGGGTTTGG - Intronic
1144044696 17:11444624-11444646 TCCTTTAGTGATTTTAGATTTGG - Intronic
1144568229 17:16378170-16378192 TCATTTGGTAACCTAAGATTAGG - Intergenic
1146994564 17:37307492-37307514 TCATATACTTACTTGACATTTGG + Intronic
1147474399 17:40696489-40696511 TCCTTTTATAACTTTACATTTGG + Intergenic
1148973198 17:51502779-51502801 TCATTTACTGACTTCAGATTTGG + Intergenic
1150258228 17:63766729-63766751 TCATTTAATTTCTTTAGGTTGGG + Intronic
1151809620 17:76430674-76430696 TTATTTACTGATTTCAGATTTGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153898244 18:9589262-9589284 TTATTGACTAAGTTGAGATTAGG - Intronic
1155084802 18:22447433-22447455 TCATTTTCTCAGATTAGATTTGG + Intergenic
1155113992 18:22746535-22746557 TCCTTTACTAATTTTGGGTTTGG - Intergenic
1155853663 18:30804437-30804459 TCATTTTGACACTTTAGATTGGG - Intergenic
1156055915 18:33002645-33002667 TCTTCTACTAACTTTGGATTTGG - Intronic
1157064908 18:44337341-44337363 TTATTTACTAATTATTGATTTGG + Intergenic
1158360554 18:56667531-56667553 TAATTTATTAACTCTAGGTTTGG - Intronic
1158431617 18:57393110-57393132 TCATCTACTAATTTTTGGTTTGG - Intergenic
1158549223 18:58420687-58420709 TCATTGAGTAACTATTGATTGGG - Intergenic
1158656238 18:59337244-59337266 TCAGTTAATACCTTTTGATTTGG - Intronic
1158838045 18:61352621-61352643 TTATTTATTACATTTAGATTGGG - Intronic
1159765954 18:72488688-72488710 TCTCTTACTAATTCTAGATTTGG - Intergenic
1160242777 18:77134994-77135016 TCATTTACTTCCTTTAGCTTGGG - Intergenic
1164231572 19:23293468-23293490 TCTTCTAATAACTGTAGATTTGG - Intergenic
1164546666 19:29171067-29171089 TCATTTACCAAGTTAAAATTTGG - Intergenic
1165612172 19:37164971-37164993 TCATTTTTTAACTTTACTTTTGG - Intronic
1166622949 19:44320079-44320101 TCTTCTACTAATTTTGGATTTGG + Intergenic
1167787716 19:51649298-51649320 TCATTTACTGACTTCAGGTTTGG - Intergenic
1167901782 19:52627768-52627790 TCATTTTTTTACTTTAGGTTTGG - Intronic
925445262 2:3921891-3921913 CCAGTTACTATCTTTACATTTGG - Intergenic
925620996 2:5792773-5792795 TCATTTAAAAACATAAGATTTGG + Intergenic
927080816 2:19628854-19628876 TCTTTTACTAATTTTGGGTTTGG - Intergenic
927353640 2:22148535-22148557 TCTTTTGCTAACTCTAGATTTGG + Intergenic
928771781 2:34710714-34710736 TCATGTACTGACTTTCCATTGGG - Intergenic
928806543 2:35163483-35163505 CCATTTACTACCTCCAGATTTGG + Intergenic
929092377 2:38232000-38232022 TCATTTACTGACTTCAGATTTGG - Intergenic
929204047 2:39269838-39269860 CCCTTGACTAACTTTACATTAGG + Intronic
930259599 2:49129648-49129670 TCAGTTAGTATCTTGAGATTTGG - Intronic
930606456 2:53498207-53498229 TCAGTTTCTAACTGTAGATGAGG - Intergenic
931927877 2:67094937-67094959 TCATTTAAAAATTTTACATTTGG + Intergenic
932010232 2:67970038-67970060 TCATGTATTAAATTTATATTTGG - Intergenic
932833168 2:75010177-75010199 ACATATAATAACTTTACATTGGG - Intergenic
933298663 2:80518855-80518877 TCAGATACTAGGTTTAGATTTGG - Intronic
933450933 2:82450490-82450512 TCTTTTACTAATTTTGGGTTTGG - Intergenic
933617860 2:84502054-84502076 TCTTCTACTAATTTTGGATTTGG + Intergenic
934877448 2:97937919-97937941 TCACTTACGAAGTTTAGTTTGGG - Intronic
935439364 2:103074290-103074312 TCTTCTACTAATTTTGGATTTGG - Intergenic
935835487 2:107047869-107047891 TCTTCTACTAATTTTGGATTTGG + Intergenic
936766586 2:115856904-115856926 TCTTCTACTAATTTTAGGTTTGG + Intergenic
937753523 2:125506916-125506938 TCATCTACTAATTTTCGCTTTGG + Intergenic
939376325 2:141372894-141372916 TCCTTAGCTAACTTTGGATTTGG + Intronic
939434274 2:142153661-142153683 TCATATAGTAACTCTATATTTGG + Intergenic
939990243 2:148871604-148871626 AGATTTCCTAACTTTTGATTTGG - Intergenic
940697457 2:156997444-156997466 TCATTTACTTACTTTATTTTTGG - Intergenic
940826694 2:158420479-158420501 TCATTTATGAAGTTTAGTTTGGG - Intronic
941236189 2:162977296-162977318 TCATTTAGTAATTGTATATTTGG + Intergenic
941250230 2:163152537-163152559 TCATTTACTGACTTCAGATTTGG + Intergenic
941734020 2:168952739-168952761 TCTTTTGCTAACTTTGGGTTTGG + Intronic
944051981 2:195479937-195479959 TCATTTAGTAACTTTAAAAAGGG + Intergenic
944306994 2:198189766-198189788 TCATTTACTAACTGTGACTTTGG + Intronic
944828533 2:203509434-203509456 TTAAATACTAACTTTGGATTTGG - Intronic
945061644 2:205914338-205914360 TCATTTATTACCTTTATCTTGGG + Intergenic
945575949 2:211528966-211528988 TCATCTACTAATTTTGGGTTTGG - Intronic
945888098 2:215398575-215398597 CCATTTACAAACTTTATCTTTGG + Intronic
946697718 2:222377186-222377208 TCTTTTACTAATTTTGGGTTTGG - Intergenic
948774970 2:240281291-240281313 TTTTCTACTAATTTTAGATTTGG - Intergenic
1168916903 20:1496588-1496610 TCTTCTACTAATTTTGGATTTGG + Intergenic
1170435342 20:16321361-16321383 TCTTTTAATAACCTAAGATTTGG + Intronic
1170442606 20:16394488-16394510 CCATTTACTAACTTTACAGTTGG - Intronic
1171455084 20:25265547-25265569 TCATTTACTCATTTTAAATCAGG + Intronic
1173053321 20:39586593-39586615 TCATTTACCTAGTTTAAATTAGG + Intergenic
1174760046 20:53198301-53198323 TCATTTTCTAAGGTTAGAGTGGG + Intronic
1177221629 21:18201361-18201383 TCATTTACTTGCTTCAGAATAGG + Intronic
1177232344 21:18338616-18338638 TCATTTCCAAACTTTAGTTTTGG + Intronic
1177341342 21:19805075-19805097 TCTTTTAGAAATTTTAGATTTGG - Intergenic
1179911713 21:44454079-44454101 TCTTTTACTCACTTTTAATTGGG - Intergenic
1183613839 22:38929556-38929578 TAATTTATAAATTTTAGATTTGG + Intergenic
1183794700 22:40106610-40106632 TCATTTAGTGACTTTAGATTTGG + Intronic
949118352 3:356106-356128 TTATTAACTATCTTCAGATTTGG + Intronic
949202700 3:1398508-1398530 TCATTTGCAAACTTCAGAGTTGG + Intronic
950760562 3:15220663-15220685 TTATATACTAATTTTACATTAGG + Intronic
952098734 3:29986079-29986101 AGAATTACTAACTTTAGAATAGG + Intronic
952633739 3:35502062-35502084 TGATTTAGTAACTTTAAAATTGG + Intergenic
952913967 3:38217144-38217166 TCTTTTACTACATTTATATTTGG - Intronic
954448211 3:50557824-50557846 TCATTTCCCAACTGTGGATTGGG - Intergenic
955240154 3:57170644-57170666 TCATTTGCTTACTTCAGGTTCGG - Intergenic
956410635 3:68974714-68974736 TCATTTAGTAAATATTGATTGGG - Intergenic
956457805 3:69441073-69441095 TGATTTGCTATCTTCAGATTTGG - Intronic
957068981 3:75550662-75550684 TCTTTTCCTGACTTTAGATGTGG - Intergenic
958427291 3:93993631-93993653 TCATTTACTATATTTTGTTTTGG + Intronic
958616708 3:96502754-96502776 TCATTTAATAAAATTACATTTGG - Intergenic
958663605 3:97105161-97105183 TCTTTTGCTCTCTTTAGATTTGG + Intronic
958837759 3:99166283-99166305 TCCTTTACTAACTTTGGGTTTGG - Intergenic
958840243 3:99194913-99194935 TCATCTACTAATTTTGGGTTTGG - Intergenic
959227700 3:103606607-103606629 TTCTTTACTAATTTTAGGTTTGG - Intergenic
959285565 3:104404634-104404656 TCTTTTACTAAATTGGGATTCGG - Intergenic
959413736 3:106058881-106058903 TGGTTTATTAACTTTAGATCAGG + Intergenic
960471441 3:118071194-118071216 TCATCTACTAATTTTGGCTTTGG + Intergenic
960581771 3:119286094-119286116 CCTTCTACTAACTTTGGATTCGG + Intergenic
960807480 3:121598045-121598067 TCATTGATTTACTTTATATTGGG + Intronic
960831563 3:121854947-121854969 TCTTTTTCTAAGTTTAAATTTGG + Intronic
961095484 3:124152239-124152261 TCATTTACTGACTTCAGATTTGG + Intronic
961610875 3:128137173-128137195 TCTTTTACTAATTTTAGATTTGG - Intronic
962090966 3:132243814-132243836 TTATTTACTGACTTCAGATTTGG + Intronic
962296117 3:134189138-134189160 TCATATACTTAGTTTAGATATGG - Intronic
962570385 3:136707491-136707513 TACTTTACAAACTTTAGAATAGG + Intronic
963343373 3:144064882-144064904 ATATATACTAACTTTAGATTGGG + Intergenic
963365389 3:144327381-144327403 TCTTCTACTAATTTTAGGTTTGG - Intergenic
963479218 3:145848786-145848808 TAACTTACAAACTTTAGATCAGG + Intergenic
963491458 3:146006885-146006907 TCATTTACTCATTTTAAAATTGG - Intergenic
963674676 3:148295073-148295095 CCATTTAGTAACATTATATTTGG - Intergenic
963738920 3:149055064-149055086 TCAATTGCTAACATAAGATTTGG - Intronic
963996370 3:151714515-151714537 TCTTGTACTAGCTTTACATTTGG - Intergenic
964075594 3:152688231-152688253 TCATTTAATAACCTTATAATGGG + Intergenic
964182141 3:153902026-153902048 TCCTTCCCTGACTTTAGATTAGG + Intergenic
964866068 3:161262945-161262967 TCTTCTACTAATTTTTGATTTGG + Intergenic
965380775 3:167985004-167985026 TCTTCTACTAATTTTGGATTTGG - Intergenic
966348857 3:179008377-179008399 TCTTCTACTAATTTTGGATTTGG - Intergenic
967236831 3:187393138-187393160 GGATTTACTGACTCTAGATTTGG + Intergenic
967263825 3:187672448-187672470 TCATTTTCTGACTTTGGTTTGGG + Intergenic
967529595 3:190533416-190533438 TCACTTAGAAACTTTATATTGGG + Intronic
967767842 3:193301499-193301521 TCATTTACTCACTTTTATTTAGG + Intronic
968254044 3:197249052-197249074 TCTTCTACCAATTTTAGATTTGG - Intronic
969852639 4:9972907-9972929 TCTTTTGCTAACTTTGGAGTTGG - Intronic
970915274 4:21325625-21325647 TCTTCTACTAACTTTGGGTTTGG + Intronic
971560442 4:28073376-28073398 TTATTTATTCAGTTTAGATTAGG - Intergenic
971714901 4:30163421-30163443 TCAATAACTAACATTAAATTAGG - Intergenic
972272042 4:37521090-37521112 TCTTCTACTAATTTTGGATTTGG + Intronic
973042902 4:45495425-45495447 TCATTGGCTAGCTTTTGATTTGG - Intergenic
973262920 4:48182819-48182841 TCACTTAATTTCTTTAGATTAGG - Intronic
974120588 4:57633156-57633178 TCATTTAATAGCTTTATAATTGG + Intergenic
974290946 4:59929621-59929643 TCTTCTACTAATTTTAGGTTTGG - Intergenic
974333499 4:60509756-60509778 TCATCTACTAATTTTGGGTTTGG - Intergenic
974384499 4:61187375-61187397 TCATTTACCTACTTTAGATATGG - Intergenic
974569367 4:63625146-63625168 TCTTCTACTAACTTTGGGTTTGG - Intergenic
974890887 4:67880988-67881010 CCAATTAATGACTTTAGATTTGG + Intronic
975179828 4:71332197-71332219 TCCTTTACTAATTTTGGGTTTGG + Intronic
975200972 4:71589189-71589211 CCATTTTCTCTCTTTAGATTTGG + Intergenic
975234403 4:71975085-71975107 TCATTTAATATTTTTAGACTAGG + Intergenic
976253915 4:83081302-83081324 TCTTCTACTAATTTTGGATTTGG + Intergenic
976354996 4:84106689-84106711 AAATTTACTAACTGTAAATTAGG + Intergenic
976483085 4:85567500-85567522 TCATTTACTAAGATCAGGTTTGG + Intronic
976580959 4:86736581-86736603 TAATTTAATATCTTTAAATTTGG - Intronic
977044743 4:92054925-92054947 TCTTCTACTAATTTTGGATTTGG - Intergenic
977458252 4:97291214-97291236 TCATATACAAACTTTTGTTTGGG + Intronic
977522020 4:98096581-98096603 TCTTTTACTAATTTTGGGTTTGG - Intronic
977787434 4:101054021-101054043 TGACTTACTAACTTTAGGTTAGG + Intronic
977873307 4:102119793-102119815 TATTTTACTAATTTTAGATGTGG + Intergenic
978082652 4:104613193-104613215 TCTTCTACTAATTTTGGATTTGG + Intergenic
979218793 4:118196867-118196889 TCTTCTACTAATTTTGGATTTGG + Intronic
979589905 4:122466135-122466157 TCATCGCCTAACTTTAGATATGG - Intergenic
979850843 4:125569610-125569632 TCTTCTACTAAATTTTGATTTGG + Intergenic
980417492 4:132511138-132511160 TCATTTCATAAGGTTAGATTTGG - Intergenic
980669745 4:135988648-135988670 TTATTTTTTAACTTTAGCTTGGG - Intergenic
980892061 4:138826207-138826229 TCTTTTACTTACTTTCAATTAGG + Intergenic
981117445 4:141008258-141008280 TCATTTGTTAATTTTATATTGGG + Intronic
981558311 4:146019621-146019643 TCTTCTACTCACTTTAGGTTTGG + Intergenic
983238135 4:165203436-165203458 TGCTTTACTAATTTTAAATTAGG - Intronic
984161890 4:176262922-176262944 GCACTTAATAACTTTAGATTTGG - Intronic
985379271 4:189374999-189375021 TAATTTTTTAACTTTAGGTTCGG + Intergenic
986213070 5:5692169-5692191 TCATTCACTAACTCTACATCTGG + Intergenic
987059022 5:14224621-14224643 TTATTTACTAACATTTGTTTTGG - Intronic
987523099 5:19012841-19012863 TGATTCAATAACTTTTGATTTGG + Intergenic
987803776 5:22734422-22734444 TCATTTTCTTTCTCTAGATTAGG - Intronic
989318112 5:40105266-40105288 CACTTTACTTACTTTAGATTGGG + Intergenic
989985205 5:50689280-50689302 ACATTTACTAACTGTAGCCTAGG + Intronic
991681442 5:69144029-69144051 TCTTCTACTAACTTTGGGTTTGG + Intergenic
992326112 5:75661845-75661867 TCATTTATTAACTATGTATTGGG - Intronic
992520048 5:77541273-77541295 TCCTTTGCTCACTTTATATTGGG - Intronic
992523558 5:77582808-77582830 TCATTTACTGACTTCAGATTGGG - Intronic
992821413 5:80500761-80500783 TCATTTACTGACTTCAGATTTGG - Intronic
992945594 5:81806084-81806106 TCTTCTACTAATTTTAGGTTTGG - Intergenic
993196990 5:84761756-84761778 TCTTCTACTAATTTTGGATTTGG + Intergenic
993268952 5:85768118-85768140 TATTCTACTAACTTTGGATTTGG + Intergenic
993431176 5:87833431-87833453 TCATTTGCAAAGTTGAGATTTGG - Intergenic
993683293 5:90906757-90906779 TCTTCTACTAATTTTGGATTTGG + Intronic
993708881 5:91202953-91202975 TCATTTGCTCACTTGAAATTGGG - Intergenic
994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG + Intronic
994021625 5:95032696-95032718 TCTTCTGCTAACTTTAGGTTTGG - Intronic
994531251 5:100974815-100974837 TCTTCTACTAACTTTGGGTTTGG - Intergenic
994628066 5:102246141-102246163 TCTTCTACTAATTTTAGGTTTGG - Intronic
994633607 5:102317007-102317029 TCTTCTACTAAATTTGGATTTGG + Intergenic
995044418 5:107629198-107629220 TAAATAACTAACTTTAAATTGGG - Intronic
995180876 5:109229136-109229158 TCTTTTACTGCCTTTAGACTTGG - Intergenic
995372042 5:111429102-111429124 TCTTCTACTAAGTTTAGGTTTGG - Intronic
995485024 5:112631467-112631489 TCACTTACTAGGTCTAGATTGGG - Intergenic
995733449 5:115271612-115271634 TCATTTAGTCAATTCAGATTTGG - Exonic
995818282 5:116196911-116196933 TGATTTACTAAATTAAGCTTAGG + Intronic
995919529 5:117295030-117295052 TCACTTACTAACCTTAGACATGG - Intergenic
995927458 5:117392196-117392218 TCCATTACTAACTTAAGAATAGG + Intergenic
996380248 5:122855968-122855990 TTATTTACTTATTTTAGGTTCGG + Intronic
996421620 5:123269001-123269023 TCATTTTGTAACTTTTCATTTGG - Intergenic
996969531 5:129347000-129347022 TCCTTTGCTCACTTTTGATTGGG + Intergenic
997671358 5:135676493-135676515 TCTTCTACTAATTTTAGGTTTGG + Intergenic
997784879 5:136701068-136701090 TCAATGTCTAACTTTAGCTTGGG + Intergenic
997982045 5:138474047-138474069 TCATTTACTGACTTCAGATTTGG - Intergenic
998695577 5:144634865-144634887 TCTTCTACTAATTTTAGATTTGG - Intergenic
999027197 5:148247388-148247410 TCTTCTACTAATTTTGGATTTGG + Intergenic
999235984 5:150094734-150094756 TCATTTACTGACTTCAGATTGGG - Intronic
999455836 5:151715092-151715114 TCTTCTACTAATTTTGGATTTGG + Intergenic
999846867 5:155491868-155491890 TTCTTTCTTAACTTTAGATTTGG - Intergenic
1000657088 5:163892722-163892744 TAATAGATTAACTTTAGATTAGG + Intergenic
1000732153 5:164848298-164848320 TCATTTTTTAAATTTAGTTTGGG + Intergenic
1000824534 5:166028860-166028882 TCATTTACTGAATTCAGATTTGG + Intergenic
1002855536 6:1034686-1034708 TTATTTACTAACTTTGAAATAGG - Intergenic
1003139863 6:3462068-3462090 CCGTTTAATAACTTTAGATTTGG - Intergenic
1003845966 6:10173549-10173571 TCATTCACTTTCTTTAGATCTGG - Intronic
1004642719 6:17531186-17531208 TCATTTACTGACTTCAGAATTGG + Intronic
1005414166 6:25583595-25583617 TCATTTCCTCACTTTAGATCAGG + Intronic
1005961525 6:30697099-30697121 TCATTTACTGACTTCAGCTTTGG + Intergenic
1006527217 6:34616946-34616968 TCATTTACTGACTTCAGATTTGG - Intronic
1007001263 6:38315310-38315332 TCTTCTACGAACTTTAGATTTGG + Intronic
1007158849 6:39772476-39772498 TCATTTCCTCACTTCTGATTTGG + Intergenic
1008419256 6:51277881-51277903 TTATTTACTAACTCAAGTTTTGG - Intergenic
1009335707 6:62488318-62488340 TCATTTACTAACTTTATCATTGG + Intergenic
1009580046 6:65521453-65521475 AAATTTACTAACTTTCTATTTGG - Intronic
1009702889 6:67205792-67205814 TCTTCTGCTAACTTTATATTTGG - Intergenic
1009847067 6:69147173-69147195 TCTTCTACTAATTTTGGATTTGG + Intronic
1010337683 6:74705827-74705849 TGAGTGACTAACTTAAGATTTGG - Intergenic
1010633520 6:78229598-78229620 TCATTTATGAAGCTTAGATTCGG + Intergenic
1010662971 6:78592719-78592741 TCTTTTACTGCCCTTAGATTGGG - Intergenic
1011270115 6:85569823-85569845 TGATTTACTTACTGTATATTAGG - Intronic
1011320478 6:86086705-86086727 TCATTTACTGACTTCAGATTTGG + Intergenic
1011401819 6:86970886-86970908 TCATTTACTGACTTCAGGTTTGG - Intronic
1011561020 6:88615826-88615848 TCATTGCCTAATTTTATATTTGG - Intronic
1011854584 6:91673526-91673548 ACATTTACTAATGTTACATTTGG - Intergenic
1012512438 6:100018828-100018850 TCTTCTACTAATTTTAGGTTTGG - Intergenic
1013154722 6:107482219-107482241 TCATTTATTCAAATTAGATTTGG - Intergenic
1013370542 6:109467129-109467151 TCATTTATTAAATTTTGATTGGG - Intronic
1013687624 6:112602971-112602993 TCTTCTACTAACTTTGGGTTTGG - Intergenic
1013923361 6:115437861-115437883 TCCTTTGCTCACTTTTGATTTGG - Intergenic
1014030969 6:116703875-116703897 TCATTTATTAAATTTCAATTAGG - Intronic
1014859437 6:126446638-126446660 TCATTTACTTATTTTATTTTTGG - Intergenic
1015578445 6:134698000-134698022 TCTTCTACTAATTTTGGATTTGG + Intergenic
1016127612 6:140424963-140424985 TCTTTTACTAATTTTGGGTTTGG + Intergenic
1016230078 6:141792628-141792650 TCTTTGACTAACTTTGGGTTTGG - Intergenic
1017573097 6:155769291-155769313 TCTTCTACTAACTTGGGATTTGG + Intergenic
1018045659 6:159963978-159964000 TCATCTAATAAGCTTAGATTTGG - Intergenic
1018322656 6:162628479-162628501 TCATTTCCTGACTATGGATTAGG - Intronic
1020981631 7:15076663-15076685 TCCTTTAATAACTTTACAGTAGG - Intergenic
1022194869 7:28055104-28055126 TCATTTAGTAAGTCTATATTGGG - Intronic
1022892033 7:34711182-34711204 TCATTTAATGACTTCAGGTTTGG - Intronic
1023087065 7:36581360-36581382 TCATTTACTGTCGTTAGAGTAGG + Intronic
1023740155 7:43273424-43273446 TTATTTACGAAATTTATATTAGG - Intronic
1023788079 7:43728478-43728500 TAATTTAATAACTTTAGATATGG - Intronic
1024886162 7:54145082-54145104 TGATTTAAAAATTTTAGATTAGG - Intergenic
1024892095 7:54215360-54215382 TCTTCTACTAATTTTGGATTTGG - Intergenic
1027566844 7:79805679-79805701 TGGTTTACAACCTTTAGATTAGG - Intergenic
1027597628 7:80194747-80194769 TCATGTAATAAGTTCAGATTTGG + Intronic
1027626896 7:80556538-80556560 TCTTCTGCTAGCTTTAGATTTGG + Intronic
1027930532 7:84528402-84528424 TCATTTACTGACTTCAGGTTCGG + Intergenic
1028141169 7:87275950-87275972 CCTTTTACTAACTTTAGGTTTGG + Intergenic
1028206866 7:88027721-88027743 TCTTGTACTAACTTTGGATGTGG + Intronic
1028284388 7:88977760-88977782 CCTTCTACTAACTTTGGATTTGG + Intronic
1028293769 7:89101710-89101732 TCATTTATTTGTTTTAGATTCGG + Intronic
1028747285 7:94341858-94341880 TCATTTAGTAACTGTAGCATTGG - Intergenic
1028835377 7:95369001-95369023 TCTTTTACTAAAATGAGATTAGG - Intronic
1029333979 7:99884700-99884722 TCTCTTACTGACTTTGGATTTGG - Intronic
1029369553 7:100139916-100139938 TCAATTACTGACTTCAGATTTGG + Intergenic
1030244561 7:107368168-107368190 TCATTCACTACTTTTAAATTTGG + Intronic
1030353024 7:108510662-108510684 TCATTTACTGACTTCAGATTGGG - Intronic
1031167260 7:118244191-118244213 TGGTTTACTAAGTTTTGATTGGG - Intergenic
1031338877 7:120573935-120573957 TCATTAAATAACTTAAAATTAGG + Intronic
1031553226 7:123140940-123140962 TCTTCTACTAACTTTGGGTTTGG + Intronic
1032612879 7:133434615-133434637 ACATTTATTAACTTTTAATTTGG + Intronic
1032972066 7:137175659-137175681 TCTTCTACTAATTTTGGATTTGG - Intergenic
1033813071 7:145040286-145040308 TCATTTACTGCCTTTAGATTTGG + Intergenic
1033813089 7:145040487-145040509 TCATTTACTGACTTTAGATTTGG + Intergenic
1035347268 7:158210435-158210457 TCTTTTACTAATTTTGGGTTTGG - Intronic
1039539691 8:38354199-38354221 TTATTTCCTCACTTTAGATTCGG - Intronic
1039929605 8:41972987-41973009 TCATTTACTAACTTCTCCTTTGG - Intronic
1040620456 8:49086148-49086170 TCATTTACAAATTTTACATAAGG + Intergenic
1040643160 8:49364790-49364812 TCTTTTACTAATTTTGCATTTGG + Intergenic
1041416347 8:57613344-57613366 TCTTTTACTAATTTTGGGTTTGG - Intergenic
1042858510 8:73291635-73291657 TCATTTACTGACTTCAGATTGGG + Exonic
1043479238 8:80636516-80636538 TTATTTACTGACTTCAGGTTTGG + Exonic
1043548496 8:81341710-81341732 TCATTTCCTAACTGGAAATTAGG + Intergenic
1043567634 8:81565786-81565808 TCTTCTCCTAATTTTAGATTTGG - Intergenic
1043676962 8:82968825-82968847 TTATTTACTAACTATAGGTCAGG + Intergenic
1043762927 8:84092442-84092464 TCTTCTACTAAATTTTGATTTGG + Intergenic
1044824465 8:96183194-96183216 TTAATTAATAACTTTATATTTGG + Intergenic
1045777173 8:105818822-105818844 TCTTCTACTAATTTTGGATTTGG + Intergenic
1046328632 8:112682768-112682790 TTATTTATTTACTTTAAATTTGG + Intronic
1046591621 8:116214122-116214144 TCATTTATTAAGTGTAGATCAGG - Intergenic
1047973111 8:130103425-130103447 CCTTTTACTAATTTTGGATTTGG + Intronic
1048006503 8:130423824-130423846 GCATTTACTATGTTTACATTTGG + Intronic
1048674098 8:136757543-136757565 TAATTTATTAAGCTTAGATTTGG + Intergenic
1050219009 9:3364678-3364700 TCATTTGCTGACTTCAGGTTTGG + Intronic
1050643913 9:7698573-7698595 TCCTCTACTAATTTTGGATTTGG + Intergenic
1051271725 9:15361825-15361847 TCATTTACTGACTTCAGATTTGG - Intergenic
1051291636 9:15551763-15551785 TCATTTCTAAACTTTAGAGTGGG + Intergenic
1051330162 9:16016402-16016424 TCATTCACTAAATATATATTGGG - Intronic
1052420615 9:28238755-28238777 TCTTCTACTAATTTTGGATTTGG - Intronic
1052427306 9:28322284-28322306 TCATTGATTAATTTTAGCTTGGG - Intronic
1055176913 9:73330646-73330668 TCTTCTACTAACTTTAGGCTTGG + Intergenic
1055285887 9:74727467-74727489 TCTTTTACTGACTTCAAATTCGG + Intronic
1055651143 9:78408329-78408351 TCATTCACTCACTTTACATAGGG - Intergenic
1055682228 9:78727647-78727669 CCATCTACTAACTTTGAATTTGG - Intergenic
1056087914 9:83171940-83171962 TCTTCTACTAATTTTGGATTTGG + Intergenic
1058292868 9:103264512-103264534 TCTTTTACTCACTTTTTATTGGG + Intergenic
1059494193 9:114696209-114696231 TCATTTACTGACTTCAGATTTGG + Intergenic
1186691926 X:11986536-11986558 TCTTCTACTAATTTTAGGTTTGG - Intergenic
1187795127 X:22995138-22995160 ACATTGAATAAATTTAGATTTGG + Intergenic
1188151976 X:26687641-26687663 TCATTTACTGACTTCAGATTTGG - Intergenic
1188420947 X:29990381-29990403 TCTTCTACTAATTTTGGATTTGG + Intergenic
1188971943 X:36628539-36628561 TCTATTACTAATTTTGGATTTGG + Intergenic
1191069544 X:56385379-56385401 TCTTTTACTAATTTTAAGTTTGG + Intergenic
1191146786 X:57174608-57174630 TCTTTTACTAGCTTTGAATTTGG + Intergenic
1192058427 X:67797736-67797758 ACATGTTATAACTTTAGATTGGG + Intergenic
1192088364 X:68125301-68125323 TCTTCTACTAATTTTGGATTTGG - Intronic
1192706909 X:73535929-73535951 TTATTTACTGACTTCAGGTTTGG - Intergenic
1192812882 X:74562927-74562949 TCTTTTACTAATTTTGGCTTTGG - Intergenic
1193163105 X:78251131-78251153 TCTTCTGCTAACTTTAGGTTAGG + Intergenic
1193207247 X:78763586-78763608 TCATTTACTGACTTCAGATTTGG - Intergenic
1193607936 X:83591398-83591420 TCACTTGCTAACTTGAGCTTAGG - Intergenic
1193633662 X:83921970-83921992 TCTTTTACTAGCTTTGGGTTTGG + Intergenic
1193747074 X:85295248-85295270 TCATCTGCTATCTTTGGATTTGG + Intronic
1193989560 X:88289345-88289367 TCTTCTACTAATTTTAGGTTTGG - Intergenic
1194055974 X:89132026-89132048 TCTTTTATTAATTTTGGATTTGG + Intergenic
1194096207 X:89642085-89642107 TCTTCTACTAACTTTGGTTTTGG - Intergenic
1194098427 X:89673389-89673411 TCTTTTACTTACCTTAGATGTGG - Intergenic
1194352418 X:92836958-92836980 TCTTTTACTAATTTTAGGTTTGG - Intergenic
1194437824 X:93890967-93890989 TCTTCTACTAATTTTGGATTTGG + Intergenic
1194890674 X:99374251-99374273 TTATTTTCAAACTTTATATTTGG - Intergenic
1194959688 X:100221005-100221027 TCATTTATTCACTATACATTTGG - Intergenic
1195110575 X:101644799-101644821 TCTATTTCTAACTTTTGATTTGG + Intergenic
1195289855 X:103421578-103421600 TTTTCTACTAATTTTAGATTTGG + Intergenic
1195584006 X:106542562-106542584 TTATTTACTAACATTAAATATGG - Intergenic
1195786657 X:108531565-108531587 TCTTCTGCTAACTTTCGATTTGG - Intronic
1196215338 X:113044432-113044454 TCTTATACTAATTTTAGATTTGG + Intergenic
1196385344 X:115142786-115142808 TCTTATACTAACTTTGGATTTGG - Intronic
1196775007 X:119330326-119330348 TCATATTTTAACTTTTGATTTGG + Intergenic
1197360829 X:125501354-125501376 TCTTCTACTAACTTTGGGTTTGG + Intergenic
1198453436 X:136791466-136791488 TCATTTACTGACTTCAGCTTTGG - Intergenic
1199143635 X:144339208-144339230 TGATTTAATAACTTTAATTTCGG - Intergenic
1199919137 X:152378553-152378575 TCATTTATTTATTTTATATTTGG - Intronic
1200449213 Y:3303466-3303488 TCTTCTACTAACTTTGGGTTTGG - Intergenic
1200451449 Y:3334764-3334786 TCTTTTACTTACCTTAGATGTGG - Intergenic
1200660728 Y:5953696-5953718 TCTTTTACTAATTTTAGGTTTGG - Intergenic
1201977052 Y:19862440-19862462 TCATTAACTAAATTTACATAAGG - Intergenic