ID: 994007532

View in Genome Browser
Species Human (GRCh38)
Location 5:94856915-94856937
Sequence CCTTAAAAGCAGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994007528_994007532 1 Left 994007528 5:94856891-94856913 CCTTTCAAGAAAATATAACTAGT 0: 1
1: 0
2: 1
3: 24
4: 290
Right 994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 475
994007525_994007532 28 Left 994007525 5:94856864-94856886 CCTGCTGCAACCAGTTAACATTT 0: 1
1: 1
2: 11
3: 57
4: 201
Right 994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 475
994007527_994007532 18 Left 994007527 5:94856874-94856896 CCAGTTAACATTTCTGGCCTTTC 0: 1
1: 0
2: 2
3: 17
4: 213
Right 994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994007532 Original CRISPR CCTTAAAAGCAGAGAGAGGA AGG Intronic
900820607 1:4884415-4884437 TCCTAAAAGCTGAGAGAGAAAGG + Intergenic
901267420 1:7922364-7922386 TCAGAAAGGCAGAGAGAGGAAGG + Intronic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
903226652 1:21897515-21897537 CCTGAGAAACAAAGAGAGGAAGG - Intronic
903538602 1:24083685-24083707 GCTTAAACCCAGAGAGAGGTGGG - Intronic
904197060 1:28793840-28793862 CCTTAAAGGAAGAGATAGTATGG + Intergenic
904744238 1:32701645-32701667 TCTTTTAAACAGAGAGAGGAGGG + Intronic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
906338811 1:44959640-44959662 ACTTAAAAGCACAGGGAGGCTGG - Intronic
906903393 1:49862631-49862653 CCCTAAAAGCAGCAAGAGAAAGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907663292 1:56413289-56413311 CCTCAAAATCCCAGAGAGGATGG + Intergenic
908889651 1:68830113-68830135 CCTTAAATCCCCAGAGAGGAAGG - Intergenic
909072131 1:71007511-71007533 CCCTGGAAGCAAAGAGAGGAAGG - Intronic
909229193 1:73063099-73063121 CCTTATTAGCAGAGTGAGAAAGG + Intergenic
909875441 1:80797066-80797088 CCCTAACAGAAGAGAGAAGAAGG - Intergenic
910627981 1:89328421-89328443 CATTAAAAGCAGAGTGTAGAGGG + Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912520169 1:110239807-110239829 TCTAAAAGGAAGAGAGAGGAAGG - Intronic
912738534 1:112172354-112172376 CCATCAAAGCATAGAGGGGAGGG - Intergenic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913697188 1:121338508-121338530 GCTTAAAAGCAAAGAAAGGTAGG - Intronic
914140370 1:144941543-144941565 GCTTAAAAGCAAAGAAAGGTAGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914985399 1:152451976-152451998 TCTTAAAAGCAGCCAGAGGGAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
915930944 1:160060707-160060729 CCTAAAAAGGGAAGAGAGGAAGG - Intronic
916424659 1:164669108-164669130 CCCTAAAATCACAAAGAGGAGGG - Intronic
916567357 1:165992747-165992769 CCTTAAAATCAGTGAGAGTGAGG - Intergenic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
918404692 1:184200206-184200228 CCTAAAAAGAAGAGGGAGTAGGG - Intergenic
918686916 1:187428577-187428599 CCTTAATAGCAGTGTGAGAATGG + Intergenic
919246721 1:194996910-194996932 CCCTGAAAACAGAGAGAGAATGG + Intergenic
919246801 1:194998219-194998241 CCCTGAAAACAGAGAGAGAATGG + Intergenic
920097700 1:203497237-203497259 CCTTACTAGCAGGGAGAGAAGGG + Intronic
920229709 1:204462124-204462146 ACTTGAATGCACAGAGAGGAAGG - Intronic
920484522 1:206356839-206356861 GCTTAAAAGCAAAGAAAGGTAGG - Intronic
920677161 1:208046190-208046212 GCACAAAAGCAGAGAGAGGGTGG - Intronic
920934621 1:210419453-210419475 CCTCAAAAGGAGAGAGAACAAGG - Intronic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921725214 1:218515773-218515795 ACTTAAAAGCAGATATAGGGAGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923212616 1:231818374-231818396 CATTAACATCAGAGAGAGAAGGG + Exonic
923473589 1:234313254-234313276 GCTTTAAAGAGGAGAGAGGAGGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063220855 10:3966395-3966417 CCTTCCAAACAGGGAGAGGAAGG - Intergenic
1063922654 10:10947705-10947727 CCTTGAAAGCAGAAAGTTGAAGG - Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1065150047 10:22813296-22813318 CATTCAAAGGAGAGAGAGGTGGG + Intergenic
1066227162 10:33394451-33394473 CCTTTAAAGGACAGAGAGAAAGG + Intergenic
1067614313 10:47748560-47748582 CATTAAAAGCAGCTAGAGGCAGG + Intergenic
1068698031 10:59989932-59989954 TCTTACCAGCAGAGAGGGGAAGG + Intergenic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1069140827 10:64823007-64823029 TCTTGAAAGCAAAGAGAAGATGG + Intergenic
1070037194 10:72737918-72737940 ACTTAAAAGCAGAAAGAATACGG - Intronic
1071328444 10:84539091-84539113 GCTGGAAAGCAGAGAGATGAGGG + Intergenic
1071591765 10:86881489-86881511 CCTTAAAAACAGAGATAAGCAGG + Intronic
1071629723 10:87208538-87208560 CATTAAAAGCAGCTAGAGGCAGG + Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1072524580 10:96260001-96260023 CCCTAAAGTCAGAGAGGGGAAGG - Intronic
1072566977 10:96624910-96624932 CCTAAATAGCAGAGGGAGTAGGG - Intronic
1073112792 10:101072487-101072509 CCTTTAAGGCAGAGAGAGATGGG + Intergenic
1073617805 10:105015611-105015633 TTTTAAAAGCAAAGAGACGATGG + Intronic
1075023237 10:118966465-118966487 CCTTAGAATTAGAGAAAGGAAGG + Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1075935470 10:126337365-126337387 ACTTCAAAGCAGGAAGAGGAAGG - Intronic
1076191786 10:128488308-128488330 CCTTAAAAGAAGAGACACCAGGG - Intergenic
1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG + Intergenic
1077816021 11:5686046-5686068 CCAGAAGAGAAGAGAGAGGAAGG - Intronic
1079050623 11:17154827-17154849 CCCAAATAGCAGATAGAGGAAGG - Intronic
1079162884 11:18011339-18011361 CCTTAAAAGAAGAGACACCACGG + Intronic
1080810827 11:35702423-35702445 CCTTAATCGCAGAAACAGGAGGG - Intronic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1081090559 11:38860668-38860690 TCCTAAAAGCAGTGAGAGAAAGG - Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1084702584 11:70796944-70796966 CCGTAAAAGGACAGAAAGGAAGG + Intronic
1085178033 11:74507692-74507714 ACTTAAAGGCTGAGACAGGAAGG - Intronic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089771459 11:120806211-120806233 CCTTGAAACAAGAGAGAGGGGGG - Intronic
1090201352 11:124859940-124859962 CTTTAAAAGAATAGAGAGGATGG + Intergenic
1091288904 11:134425913-134425935 CCTTCACAGCACATAGAGGAGGG - Intergenic
1091859262 12:3764830-3764852 GGATAAAAGCAGGGAGAGGAAGG - Intergenic
1092051505 12:5474035-5474057 CCTTCAGAGAAGAGAGAGCATGG + Intronic
1092776344 12:11947957-11947979 CCTTTAAAGCAGTGCGAGAATGG - Intergenic
1093216060 12:16362294-16362316 GAATAAAAGCAAAGAGAGGATGG - Intronic
1094277901 12:28699612-28699634 CCTTAAAAGAAGAGAGAACTTGG + Intergenic
1094700100 12:32861773-32861795 TCTTAAAAGCAGCCAGAGGTGGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095845132 12:46736376-46736398 CCTTATAAGCTGAGAGAGATTGG + Intergenic
1096091610 12:48905670-48905692 CCTTAGAAGAAAAGATAGGATGG - Intronic
1096157986 12:49352035-49352057 TCTTAAAACCAGAGAGTGAAAGG + Exonic
1096185792 12:49579700-49579722 CATTTAAAGCAGAGAGGGCATGG - Intronic
1097098110 12:56566094-56566116 CATTAAAAGGAGGGTGAGGATGG - Intronic
1097285995 12:57877922-57877944 CATGAAAGGCAGAGAGAGAAGGG + Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098516326 12:71380469-71380491 CATAAAAAGAAGAGAGAGGTTGG - Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099749562 12:86755650-86755672 CCTGAAAAGAAAAGAAAGGAAGG - Intronic
1099839055 12:87943160-87943182 GCCAAAAAGCAGAGAGAGCATGG + Intergenic
1100434062 12:94555484-94555506 CCTTATAAGAAGAGAGGGCATGG - Intergenic
1100790483 12:98124857-98124879 CCTCAAAAGCAGAGGCAGGTAGG + Intergenic
1102778902 12:115546556-115546578 ACTTAAAAGCAGAAAGATGTAGG + Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103404479 12:120665719-120665741 CCTTAAAAAAAGAGAGAGAGAGG + Intronic
1103654684 12:122460945-122460967 CCTTGAAAGCTGAGAGAATATGG - Intergenic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1104705292 12:130940830-130940852 CCTTACAAGAAGAGACATGAGGG - Intergenic
1105026747 12:132853931-132853953 CGTTAAAAGCAGAGCGCGGTGGG + Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107193018 13:37612741-37612763 ACTACAAAGCGGAGAGAGGAAGG + Intergenic
1108480890 13:50870287-50870309 TCTTAAAAGCAGAGACCGAAGGG + Intergenic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1109866788 13:68274797-68274819 CCTTTATAGCAGAGTGAGAATGG - Intergenic
1110176703 13:72565335-72565357 CTTTAACACCAGACAGAGGAAGG + Intergenic
1110439396 13:75510338-75510360 CCTTAAAAGCTGACAGAGTGGGG - Intergenic
1111996120 13:95167778-95167800 CCCTAACAGCAGACAGAGCACGG - Intronic
1112385881 13:98939295-98939317 ACCTAAAATCAGAGAGAAGAAGG + Intronic
1112562923 13:100529724-100529746 CCTCAAAACCACAGAGAGGGAGG + Intronic
1112893922 13:104274164-104274186 CCATAAAAGGATTGAGAGGATGG + Intergenic
1112985632 13:105446013-105446035 CCTTGAAAGCTGGGAGAGAAAGG - Intergenic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113283187 13:108813052-108813074 CCATAAAAGGAGACTGAGGAGGG + Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1114174581 14:20309209-20309231 ACTTAAAAGCACAGAGAAGCTGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1115068341 14:29293160-29293182 CCTTTATAGCAGTGTGAGGATGG + Intergenic
1115177663 14:30582806-30582828 CCTTTAAACCAGAGTGAGGGAGG + Intronic
1116289265 14:43011305-43011327 CCTTACAAGAAGAGACAGCAGGG - Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1117227207 14:53674374-53674396 CCTTACAAGAAGAGAGACCATGG + Intergenic
1118687144 14:68302429-68302451 TCTTAATAGGAGAGAGAGAAGGG + Intronic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1120525164 14:85568936-85568958 CCTTAAGAGAAGGGAGACGAGGG - Intronic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1122569030 14:102681750-102681772 ACTTAACATCAGAGTGAGGATGG - Intronic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1124716232 15:32065015-32065037 CCATAAAATCAGAAAGAAGAAGG + Intronic
1124911133 15:33921916-33921938 CCTTAAGAGCAGGGAGCGGAGGG + Intronic
1124972535 15:34502938-34502960 CCTAAAAAGGTGATAGAGGAAGG - Intergenic
1125933061 15:43613644-43613666 TATTAAAACCAGGGAGAGGATGG - Intronic
1125946159 15:43713106-43713128 TATTAAAACCAGGGAGAGGATGG - Intergenic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1127385330 15:58462207-58462229 CTTTGAAGGCAGAGAGAGGCTGG + Intronic
1127532653 15:59859930-59859952 CCTGTACAGCAGAGAGAAGAGGG - Intergenic
1127759613 15:62125675-62125697 CCTTAAAAGAAGTGACTGGAAGG - Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130546186 15:84858693-84858715 CCTTAAAGGCTGTGAGAGAAGGG - Intronic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131304507 15:91229926-91229948 TTTTTAAAACAGAGAGAGGATGG - Intronic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132825316 16:1902124-1902146 CATGACAAGCTGAGAGAGGAAGG + Intergenic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1133426366 16:5693775-5693797 ACTTATAAGAAGGGAGAGGAAGG - Intergenic
1133567970 16:7013028-7013050 CCTTAAAAGGAGAGAAAGAGAGG - Intronic
1134025994 16:10954374-10954396 CCTTATAGGCAGAGAGGGCAGGG - Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1137658854 16:50185729-50185751 CCTTAAGAAAAGAGAGAGGGAGG - Intronic
1137672415 16:50286757-50286779 ACTGAAATTCAGAGAGAGGATGG + Intronic
1138078244 16:54063921-54063943 CCTTAAAAGCAGTCAGAAGAAGG - Intronic
1138272103 16:55702702-55702724 CCACCAAATCAGAGAGAGGATGG + Intronic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1140415402 16:74770669-74770691 CTTTAAATTGAGAGAGAGGAAGG - Intronic
1140641481 16:76978292-76978314 CCTTCAAAGTTGAAAGAGGAGGG - Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141789259 16:86222933-86222955 TTTTAAAAGCAGAGATAGGGAGG - Intergenic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1143439141 17:6954684-6954706 TCTTAAAAGCTTAGAGAGCAAGG - Intronic
1143714615 17:8758035-8758057 GCTCAAAAGATGAGAGAGGAAGG - Intronic
1144735763 17:17554479-17554501 GCTTAAAAGCAGCCAGAGCAGGG - Intronic
1146231183 17:31111490-31111512 GCTTAAAAGCAGCCAGAAGAGGG + Intronic
1146816305 17:35944783-35944805 ACTTAAGATCTGAGAGAGGATGG + Intergenic
1146981339 17:37164549-37164571 CATTAAAGACAGAGAAAGGAAGG + Intronic
1147519985 17:41161437-41161459 CCCTCAGAGCAGAGAGCGGAGGG - Intergenic
1147613364 17:41813941-41813963 CCTAAAATGGAGAGAGATGAGGG - Intronic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148360606 17:47009506-47009528 GCTTAAAATCTGAGAGAAGATGG - Intronic
1149620469 17:58041073-58041095 GTTTAAAAGAAGAGAGAGGGGGG - Intergenic
1150785943 17:68162645-68162667 GCTTAAAATCTGAGAGAAGATGG + Intergenic
1151428694 17:74048283-74048305 CCACAAAACCACAGAGAGGATGG + Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1155420900 18:25654902-25654924 CCTTATTAGCAGAGTGAGAATGG - Intergenic
1155551741 18:26972495-26972517 CCCTAAAGGGAGAGAGAGCATGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155723030 18:29042975-29042997 TCTTAAAAGTAGCCAGAGGAAGG + Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1157749909 18:50168984-50169006 CCATAAAGTCAGAGAGAGAAGGG + Intronic
1157839206 18:50939703-50939725 AATTAAAGGCAGAGAGAGAATGG + Intronic
1158150800 18:54367544-54367566 CCTTAAAGGCCAGGAGAGGATGG - Intronic
1158748048 18:60225221-60225243 CCTAAAAAGCCGGGAGAGAATGG - Intergenic
1159276637 18:66230895-66230917 CCCTAAAAAAAGAAAGAGGAAGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160071413 18:75631771-75631793 CCTTAATAGCAGGTACAGGAAGG + Intergenic
1160388154 18:78510380-78510402 ACTTAAAGGCAAAGGGAGGAAGG + Intergenic
1161074793 19:2280368-2280390 CATTAAAAAGAGAGAGAGGCTGG - Intronic
1162081463 19:8220301-8220323 CCAGAAAAGAAGAGAGAGGGAGG - Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166786243 19:45369029-45369051 CCGTAAAGGCAGACAAAGGAAGG - Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1167685713 19:50954789-50954811 CCTAAAATGCAGGGAGAGGGAGG - Intergenic
1167798391 19:51725403-51725425 AGGTAAAAGCAGAGAGAGAATGG - Intergenic
1167992123 19:53369580-53369602 CCTTAAAAACAGTGAAAAGAAGG - Intronic
925321057 2:2968965-2968987 TCTTGAAAGCAGAGAGCAGATGG + Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925491577 2:4400944-4400966 CCTTATAAGGAGAGAGAGATTGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
926297974 2:11582183-11582205 CCTGAACAGCAGGGAGATGAGGG + Intronic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
931235975 2:60412973-60412995 TTTTAAAAGCAGACAGAGGTAGG + Intergenic
931378273 2:61727667-61727689 CCTTAGAAGCAGGGAGGGAATGG + Intergenic
931475547 2:62583976-62583998 CATTCAAAGCAGTGTGAGGAGGG - Intergenic
931574469 2:63705449-63705471 CATTCAAAGCAGTGTGAGGAGGG - Intronic
932207733 2:69898316-69898338 TCATAATAGCAGAGAGATGAGGG + Intronic
933119024 2:78512797-78512819 CCTAAAAATCAGTGAGAGAAAGG - Intergenic
935415619 2:102814550-102814572 TCTTCAAAGCATTGAGAGGAGGG - Intronic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
935868395 2:107417542-107417564 CCTTGAAGGAAGAGAGAGCATGG + Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936284722 2:111173254-111173276 CCCTAATGGCAGAGTGAGGATGG - Intergenic
936535305 2:113306491-113306513 CCATAAAAGCAGAGGTGGGATGG + Intergenic
937279991 2:120711208-120711230 CCTTAAAAGAAGACAGGGAAGGG + Intergenic
937819244 2:126289440-126289462 CCTTGAGAGAAGAGAGAGGGGGG + Intergenic
937925005 2:127161309-127161331 TCTGAAGAGCAGAGAGAGGCTGG + Intergenic
938760334 2:134419811-134419833 CCTTAAAAGGCAGGAGAGGAGGG + Intronic
939217641 2:139260187-139260209 CCCTAGAGGCAGAGAGAGCAGGG + Intergenic
939747601 2:145995166-145995188 TCTTAAAAGCAGAGAGACTAAGG + Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940405202 2:153293336-153293358 CCTTAAAAGATGAAAGAGGAAGG + Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
941116870 2:161481792-161481814 CCTTACAAGCCAAGAGAGAATGG + Intronic
941629264 2:167866032-167866054 GCATAAAATGAGAGAGAGGATGG - Intergenic
941889276 2:170561210-170561232 CCTTAAAAGAAGAGTTAGAATGG + Intronic
942157103 2:173141450-173141472 GCTTAACAGCAGATTGAGGAAGG + Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
944627549 2:201587586-201587608 TCTTAAAGGCAGCCAGAGGAGGG - Intronic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945459369 2:210087317-210087339 TCTTAAAAGCAACAAGAGGATGG - Intronic
945757822 2:213871271-213871293 TCATAAAAGCAGAGAGAATATGG + Intronic
946610087 2:221448555-221448577 CTTTAAAAGAAGGGAAAGGACGG - Intronic
947483072 2:230521141-230521163 CATGACAAGCAGAGAAAGGATGG - Intronic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
948659098 2:239496039-239496061 GCTTAACAACAGAGAGAGGGAGG + Intergenic
948710640 2:239822894-239822916 CCTTAATAGCAGTGGGAGAATGG + Intergenic
948855061 2:240726312-240726334 CATTAAAAGCACATGGAGGATGG + Intronic
1169323704 20:4657377-4657399 CCTGAAAAGTAGAGAAAGGAGGG - Intergenic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1170235611 20:14101682-14101704 CCTTAAAAGCAGAGATACAGGGG - Intronic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173204016 20:40978257-40978279 CCCTAAAAGCAGCAAGAGAAAGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1173981945 20:47231227-47231249 CCATTACAGCAGAAAGAGGAGGG + Intronic
1174831136 20:53813288-53813310 CCTGACAAGCAGAGAGAAAATGG - Intergenic
1175086990 20:56468256-56468278 CCTTAATCGCAGAAACAGGAGGG + Intergenic
1177448735 21:21237051-21237073 TCTGAAAAGCAGAGAAAGCAGGG - Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1180078228 21:45473874-45473896 CCCTAAATGCAGACAGAGAAAGG - Exonic
1180262441 21:46681928-46681950 CCTCTAAATCAGAGAGATGAAGG + Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182707376 22:32294020-32294042 CCTTAAAAGCAGTCAGAAAAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184395717 22:44237428-44237450 CCTTAAAAGCAGTCAGAAAAGGG - Intergenic
1184641405 22:45873163-45873185 TCTTAAAAGCAGCCAGAGGGGGG + Intergenic
949273290 3:2246705-2246727 CATGAAAAGGAGAGAGGGGATGG + Intronic
950350594 3:12347376-12347398 CCATAAAAGCAGACAAAGGAAGG - Intronic
950458887 3:13109302-13109324 TCTTAAAAGAAGAGAGATGAAGG + Intergenic
951317086 3:21201388-21201410 CCTTACAAGCAGGAAGAGAATGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952801388 3:37295670-37295692 TATTTAAAACAGAGAGAGGACGG - Intronic
954521064 3:51227016-51227038 CCTCAAAAACAGAGAGAAGCAGG - Intronic
956274319 3:67481742-67481764 TCTTTAAAGCAGAGAAAGGTAGG - Intronic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
957161348 3:76613577-76613599 CCCTAAGTGCAGAGAGAAGACGG + Intronic
957790077 3:84929434-84929456 CCTGAAAAGCTGTGGGAGGATGG + Intergenic
958884722 3:99712960-99712982 ACTCAAAAGTAGAGAAAGGAAGG + Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
960208895 3:114935945-114935967 CCTCAAAATCAGAGAAAGGGGGG + Intronic
960432225 3:117583080-117583102 CATTAAAATCAGAGTGGGGAAGG - Intergenic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
962961030 3:140311057-140311079 CCACAACAGCAGAGAGAGAAAGG + Intronic
963094849 3:141525166-141525188 CCTTAAAATCAGACAAAGAAAGG - Intronic
963114829 3:141718548-141718570 TCTTAAAAGCAGCCAGAGGCTGG - Intergenic
964680151 3:159329350-159329372 GCTTAAAAGCAGAGAATTGATGG + Intronic
966105818 3:176332639-176332661 CCTCAAAGGTAGAGAGAAGAAGG + Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
968290781 3:197538054-197538076 CTTAAAAGGCAGAGAGAAGAAGG - Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
969685213 4:8668397-8668419 CCTCAAAAGAAGAGAATGGAGGG + Intergenic
969929812 4:10620048-10620070 CGTGAAGAGCAGAGAAAGGAAGG - Intronic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970457163 4:16236381-16236403 CCTTTAAGCCAGGGAGAGGATGG + Intergenic
970771417 4:19616868-19616890 CCTTAAAAGCCAAGAGAACATGG + Intergenic
971029511 4:22621335-22621357 CCCTAAAGGGAGAGAGAGCAAGG + Intergenic
971033368 4:22666045-22666067 CCTTAAGACCAGAAAAAGGAGGG - Intergenic
972156050 4:36163301-36163323 TCTTGGAAGCTGAGAGAGGATGG + Intronic
972321156 4:37974853-37974875 CCGTAAAGGCATAGAGAGGCTGG - Intronic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
972388010 4:38586521-38586543 CCTTAAAAGAAGGAAGAGGGAGG - Intergenic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
974138161 4:57847083-57847105 TCTTAAAAGCAGCTACAGGAGGG - Intergenic
975654512 4:76628334-76628356 CCTTAAATTCAAAGAGAGCAAGG + Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976880449 4:89916722-89916744 CTTTAAAATCAGTGAGAAGAAGG - Intronic
977233612 4:94480722-94480744 TCCACAAAGCAGAGAGAGGAAGG + Intronic
978611605 4:110546756-110546778 CCTTAAAGGAAGTGAGAAGATGG + Intronic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981439194 4:144763254-144763276 ACTTAAGAGTAGAGAGAGGGAGG + Intergenic
982056646 4:151556684-151556706 CCTTAAAACCAGAGATTGAAAGG + Intronic
982286339 4:153739747-153739769 CCTTAAAAGCAGCCAGAGAGGGG - Intronic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982634435 4:157875107-157875129 CCTTAAGAACAGAGGAAGGATGG - Intergenic
982712966 4:158776729-158776751 CATTAAAAGCAGAGACACAATGG - Intronic
982809981 4:159812977-159812999 CCTTAAAAGTCAATAGAGGAAGG - Intergenic
983403862 4:167300173-167300195 TCTTGAAAGCAGCCAGAGGAGGG + Intergenic
983420893 4:167515628-167515650 CCTCAAAAAAAGAGAGAGGCAGG - Intergenic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
984668486 4:182454428-182454450 CCTTAAAAGCAAATACAGAATGG - Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985186487 4:187322263-187322285 ATTTAATAGCAGACAGAGGAAGG + Intergenic
985282878 4:188304444-188304466 CCAAAAGAGGAGAGAGAGGAAGG - Intergenic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
985838437 5:2288096-2288118 CCTGAAAAGCAAGGAGAGCAGGG - Intergenic
987080614 5:14422057-14422079 GCTCAAAAGGAGAGAGTGGACGG - Intronic
988326824 5:29779361-29779383 CCATAAAGGCAGAGAGAAGATGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988785018 5:34558480-34558502 TCCTAAAAGCCAAGAGAGGAAGG + Intergenic
989447362 5:41546005-41546027 GCATAAAATCAGAGAGATGAAGG + Intergenic
990044365 5:51410989-51411011 TCTGAACAGCAGAGAGACGAGGG + Intergenic
990716157 5:58639534-58639556 CCTTAAAAGAAGAGAGATCAGGG - Intronic
991258841 5:64645272-64645294 ACTTAGAAGCAGGGAGAGAAGGG - Intergenic
991604207 5:68383976-68383998 CCTGAAAAGCAGTGAGGGAATGG - Intergenic
992002849 5:72452245-72452267 CCTCAAAGGGAGAGAGAGGGAGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992242158 5:74783341-74783363 CCTTAAGAGCAGTGGGAGTACGG - Intronic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
992483510 5:77174268-77174290 CCATAAAAACAGAGACAGGGTGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994266307 5:97720941-97720963 CATTAAAAGCAGTGTGAAGAGGG - Intergenic
994395510 5:99223216-99223238 CCTAATAAGCAGGGAGGGGAAGG - Intergenic
994598718 5:101873700-101873722 CATAAAAAGGTGAGAGAGGATGG + Intergenic
995379243 5:111513196-111513218 CCTTAGAAGCAGAGAAAAGGAGG + Intergenic
996179048 5:120396309-120396331 TATTAAAAGCTGAGAGAGGTAGG + Intergenic
996324979 5:122262614-122262636 ACTAAAAAGAAGTGAGAGGAAGG - Intergenic
996339275 5:122418109-122418131 GCTTAAATGCAGGGAGAGTATGG + Intronic
996429502 5:123356585-123356607 GATTAAAAGGAGAGAGAAGAAGG - Intronic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
999243416 5:150140406-150140428 CCTCTAGAGCAGAGAGAGGGAGG + Intronic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
1000412760 5:160950702-160950724 CCGCAAAAGCAGAGGGAGGTGGG - Intergenic
1000971440 5:167719113-167719135 CCATAAAAGCAAAGACAGGTTGG + Intronic
1001132561 5:169076603-169076625 CTTTAAGAGGAGAGAGAGGGTGG + Intronic
1001138808 5:169125715-169125737 CCCCCAAAGCAGAGAGAGGGAGG + Intronic
1001216879 5:169864459-169864481 ACTGAAAAACACAGAGAGGAAGG + Exonic
1002070762 5:176677782-176677804 CCTTACAAGCAGAGACCAGATGG + Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1004153926 6:13150002-13150024 CCTCAAAAGCAGAGAGAGGCAGG - Intronic
1004989818 6:21124793-21124815 CCATCAAAGCAGTGAGAGAATGG - Intronic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1007026010 6:38574948-38574970 GCCTAAACTCAGAGAGAGGACGG + Intronic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1007234853 6:40383350-40383372 TCTTAAAAGCAGGGAGACCAAGG + Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007936915 6:45740756-45740778 CCCTTAAAGCAGAGAGGGTAAGG - Intergenic
1008365289 6:50671997-50672019 CCTTTAAAGCAGGCAGAAGAGGG + Intergenic
1008496394 6:52138346-52138368 TCCTAAAAGCAAAGAGATGAGGG - Intergenic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1008702979 6:54124075-54124097 CTTTAAAAGCCAAGGGAGGAAGG - Intronic
1008817373 6:55584539-55584561 TCTCAAAAACAGAGTGAGGAGGG + Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1010497179 6:76549109-76549131 CCTTCAAAGATGATAGAGGATGG + Intergenic
1011045628 6:83078940-83078962 CCTTAAAACATGAGAGGGGATGG + Intronic
1011368599 6:86608014-86608036 CAATAAAAGCAGGGAAAGGATGG - Intergenic
1011962631 6:93110057-93110079 ACTTCAAAGCAGAGAGTGGCTGG + Intergenic
1013890074 6:115016200-115016222 CCTTCAAAGCAGAGCAAGGCAGG - Intergenic
1014503538 6:122224610-122224632 CTTTAAAAGAAGAGAAAGAAAGG - Intergenic
1014599780 6:123396531-123396553 CTTTTAAATCAGAGACAGGATGG + Intronic
1014693292 6:124588290-124588312 TCTTGAGAGCAGAGAGATGATGG - Intronic
1014812976 6:125906180-125906202 CCTTAAAAGTACAGAGAGGAGGG + Intronic
1015868231 6:137749672-137749694 ACTTAAACGCAGAGAAAGGGAGG - Intergenic
1016120911 6:140340198-140340220 ACTTAAAAGCAGAGAAGGAAAGG + Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017815376 6:158012374-158012396 CCTTAAAAGCTGGAAGAGGGAGG + Intronic
1019275058 7:171784-171806 CCTGGAAAGCAGTGAGAGAAGGG - Intergenic
1019697500 7:2454134-2454156 CTTGAAAAGCTGAGACAGGAGGG + Intergenic
1020832284 7:13107904-13107926 CTTTAACAGAAGAGAGAGAAAGG + Intergenic
1021341373 7:19466610-19466632 CCTGAAAAGCAGAGAGATACAGG - Intergenic
1021627820 7:22611928-22611950 CCTTTCAGGCAGAGAGAGCAGGG - Intronic
1023792369 7:43763171-43763193 CCTTCAAACCAGAGAGGGGATGG - Intronic
1023817591 7:43962282-43962304 CCTTGAGTGCAGAGACAGGAAGG - Intergenic
1024269831 7:47633971-47633993 GTTTAAAGTCAGAGAGAGGAGGG + Intergenic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1025242840 7:57292196-57292218 CCATAACAGCAGAGAGAAGCTGG - Intergenic
1025843688 7:65176254-65176276 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1025894083 7:65682876-65682898 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1026170739 7:67951786-67951808 CCTTAAAATGATAAAGAGGAGGG + Intergenic
1026344472 7:69462311-69462333 TCATAAAAGCAGAGAGATGTTGG - Intergenic
1027156490 7:75772003-75772025 CCTAAAAATCAGGGAGAGGAAGG + Exonic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1029742215 7:102497156-102497178 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029760205 7:102596321-102596343 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029923172 7:104287619-104287641 CCTTAAAAGAAAAGAGAAGAAGG - Intergenic
1030060315 7:105616240-105616262 CCTCCAAAGAAGAGAAAGGACGG - Intronic
1031267314 7:119597656-119597678 TCTTAAAAGCAGCTAGAGAAAGG - Intergenic
1031448260 7:121881631-121881653 CCTTAAGAAGAGAGAGAGAAGGG - Intronic
1031978749 7:128110606-128110628 CCTGAAAAGCTGAGAAAAGAAGG + Intergenic
1032057206 7:128693364-128693386 CCTTGAACGGAGTGAGAGGAGGG - Intergenic
1032219773 7:129985472-129985494 TTTTAAAAACAGAGACAGGAAGG - Intergenic
1032301904 7:130695411-130695433 CGTTGAAAGCACAGAGCGGAGGG - Intergenic
1032889589 7:136180334-136180356 CCATGATAGAAGAGAGAGGAGGG - Intergenic
1033102649 7:138488499-138488521 CATTTAAAGCAGTGTGAGGAGGG - Intronic
1034382926 7:150714650-150714672 TCTTTAAAGCAGCGTGAGGACGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035956662 8:4088087-4088109 CCACAAAAGGAGAAAGAGGAAGG + Intronic
1037667084 8:20979054-20979076 CCTTAAAAGAAGGGAAGGGATGG + Intergenic
1038301924 8:26359236-26359258 ACTTAAAGGCAGAGAGACTAAGG + Intronic
1040962996 8:53054270-53054292 CCCAAAAGGCAGAGAGAAGAAGG - Intergenic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042401916 8:68359641-68359663 CCTTAAAAAGAGAGAGGGGTGGG - Intronic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1043165065 8:76893354-76893376 CCTCAATAGCTGAGAGATGATGG + Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044375086 8:91460741-91460763 GATTAAACCCAGAGAGAGGAAGG - Intergenic
1044595929 8:93958323-93958345 CCTTAAAACCACAGAGAAGGAGG - Intergenic
1045808804 8:106197529-106197551 CCATAATAGCAAAGTGAGGATGG - Intergenic
1046969472 8:120205355-120205377 GCTGAAAAGTAGAGAGAAGAAGG - Intronic
1047878395 8:129166303-129166325 CTTTAAAATCTGATAGAGGAGGG + Intergenic
1048416422 8:134232239-134232261 ACTAAAAAGTGGAGAGAGGAAGG + Intergenic
1049945038 9:586229-586251 ACTTCAAAGCACAGTGAGGATGG + Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050206258 9:3199508-3199530 CTTTAAGGGCAAAGAGAGGAGGG + Intergenic
1050238028 9:3603571-3603593 CCTTCAAAGCAGAGTAAGCAAGG + Intergenic
1051166170 9:14264468-14264490 TCTTAAATGCACAGAGAGTAGGG - Intronic
1052519839 9:29532292-29532314 ACATATAAGTAGAGAGAGGAAGG - Intergenic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1055827198 9:80340901-80340923 CCCTAAAAGCAGTAAGAGGCTGG + Intergenic
1056697933 9:88876038-88876060 CCTTAAAAGCAGACATGTGATGG - Intergenic
1056880154 9:90383832-90383854 ACTGAAAAGCACAGAGATGAAGG + Intergenic
1057512770 9:95694515-95694537 CCATAAAAGCTTAGAGAAGATGG - Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1058349926 9:104009471-104009493 TCTGAAAGGCACAGAGAGGAAGG - Intergenic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058779550 9:108319159-108319181 CCTTATTAGCAGTGTGAGGATGG + Intergenic
1059121653 9:111644802-111644824 CCCAAAAAGCAGAGGGAGAATGG + Intronic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1059700314 9:116769584-116769606 CCTTAAAAGATTGGAGAGGATGG + Intronic
1059843151 9:118241927-118241949 CCTTTAAAGCAGTGTGAGAATGG - Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1061308787 9:129748920-129748942 TCATAAAAGCAGAGACAGGGGGG - Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1061835364 9:133325244-133325266 ACAAGAAAGCAGAGAGAGGATGG + Intergenic
1062455239 9:136633694-136633716 CCTGAAAAGCAAATAGAGGCCGG + Intergenic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1186123484 X:6387472-6387494 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1187133923 X:16528754-16528776 ACTTAAAAGCACAGAGAAAAGGG + Intergenic
1187566094 X:20451126-20451148 AATGAAAAGCAGAGAGATGATGG - Intergenic
1188063193 X:25626066-25626088 GCTTGAAAGCAGAGAGAGACTGG + Intergenic
1190410388 X:50131333-50131355 CCAAAAAATCAGAGAGAGTATGG - Intergenic
1191087124 X:56580940-56580962 CCTTGAAAGCAGTTAGAGAAGGG - Intergenic
1195037790 X:100985962-100985984 CCTTAAAAGTATAGAAATGAAGG + Intronic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1196867064 X:120079703-120079725 CCTTGAAAGGAGAGAGATGATGG + Intergenic
1196876035 X:120156579-120156601 CCTTGAAAGGAGAGAGATGATGG - Intergenic
1198342960 X:135732647-135732669 CTTTAAAAGCAGACAGAGATGGG + Intergenic
1198345029 X:135750648-135750670 CTTTAAAAGCAGACAGAGATGGG - Intergenic
1198948103 X:142038180-142038202 CCTTACAAGAAGTGAGAGAAAGG - Intergenic
1199218436 X:145289027-145289049 CCTTAAAGGCCAAGAGAGAAAGG - Intergenic
1199437911 X:147834061-147834083 CCTTAAAAGATGAAAGAGAAAGG + Intergenic
1201223418 Y:11792680-11792702 CCTTATAAGGAGAGACAGCAAGG + Intergenic
1201605204 Y:15776497-15776519 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic