ID: 994009152

View in Genome Browser
Species Human (GRCh38)
Location 5:94879463-94879485
Sequence ATGATTATCAATTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994009152_994009156 16 Left 994009152 5:94879463-94879485 CCCTCCTCCTAATTGATAATCAT 0: 1
1: 0
2: 0
3: 19
4: 173
Right 994009156 5:94879502-94879524 TTCTTAAACATTTTGATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994009152 Original CRISPR ATGATTATCAATTAGGAGGA GGG (reversed) Intronic
908228393 1:62079405-62079427 ATGAATATCAAAAAGGAGAAAGG - Intronic
912632646 1:111259663-111259685 ATGATTTCCAACTAGGATGAAGG - Intergenic
912962901 1:114211696-114211718 ATGATAATGCATTAGGTGGATGG - Intergenic
913510615 1:119558456-119558478 ATCAGTATTAAATAGGAGGATGG + Intergenic
913514823 1:119595870-119595892 ATCAGTATTAAATAGGAGGATGG + Intergenic
913530127 1:119727912-119727934 ATGATTATTCATAAGGAGGTGGG + Intronic
915251349 1:154591194-154591216 AAGATTATGAAGTATGAGGAAGG + Intronic
916899785 1:169208742-169208764 ATGTTAATTAATTAGTAGGAAGG + Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918100498 1:181369000-181369022 ATGATGTTCTATCAGGAGGATGG + Intergenic
918197944 1:182240193-182240215 ATGTTTATCAATGAGTAGAATGG - Intergenic
918424074 1:184390380-184390402 CTGATTATCAATCAGGAGTGAGG + Intronic
919211160 1:194488766-194488788 ATGATTAACCATTGTGAGGAAGG + Intergenic
919691399 1:200531454-200531476 TTGATTATCACTTAGGAAAAGGG + Intergenic
919721416 1:200840708-200840730 ATAATTAGCAAGTAGGAAGAAGG + Intronic
920377217 1:205515573-205515595 ATTATTCTCAATTAGCAGCAAGG + Intronic
1063174743 10:3541065-3541087 ATTATTTTCAATTATGTGGAAGG - Intergenic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064380072 10:14833788-14833810 ATGTTTAGCAATTGGGAAGATGG + Intronic
1065571751 10:27077916-27077938 ATAATAATCAATTAGGGGTAAGG - Intronic
1066692612 10:38045741-38045763 ATGATAACCAATTAAGAAGAGGG - Intronic
1066733865 10:38454524-38454546 ACGATCATCCATGAGGAGGAGGG - Intergenic
1067000162 10:42603360-42603382 ATGATAACCAATTAAGAAGAGGG + Intronic
1072553866 10:96499438-96499460 ATAATTATCAACTAGGAAAAGGG - Intronic
1080371525 11:31651301-31651323 ATGACCATTAATTAGGAGGAGGG - Intronic
1081249341 11:40810729-40810751 ATGTTAATTAATTAGGAGTAGGG - Intronic
1081470854 11:43369257-43369279 TTGCTTGTCAATTAGGAGAATGG + Intronic
1083402722 11:62435103-62435125 GTCATTCTCAATTAGGGGGAGGG - Intronic
1084141960 11:67238171-67238193 TTTATTCTCAATTAGCAGGAGGG + Intronic
1084767494 11:71322300-71322322 ATGAAAATCAATTAGAAGGCTGG - Intergenic
1085336392 11:75699976-75699998 ATGATGATCAATCAGGAGAGTGG + Intergenic
1086531150 11:87786714-87786736 ATGGTGATAAATTGGGAGGAAGG + Intergenic
1086931012 11:92693157-92693179 ATGATACTCAATAAGGAGGTGGG - Intronic
1087526970 11:99327552-99327574 ATGCTTTTCAATTAGTTGGAAGG - Intronic
1088224089 11:107600022-107600044 ATGATTCTCAATTATGTGGATGG + Intronic
1091602017 12:1923480-1923502 ATGATGAACTATTAAGAGGAAGG + Intergenic
1091934149 12:4422167-4422189 ATAAACAACAATTAGGAGGAAGG - Intergenic
1092045030 12:5425631-5425653 ATGGGTCTCAATTAGGAGTAAGG + Intergenic
1092200790 12:6581403-6581425 AAGACAATCAATTAGGAAGAAGG + Intronic
1092467636 12:8747632-8747654 ATGAATATCAATTATTAGTAAGG + Intronic
1094045477 12:26161523-26161545 ATGATAAGCAATGAGGAAGAAGG - Intronic
1096420867 12:51456255-51456277 ATGATTATAATATAGGGGGAAGG + Intronic
1096913316 12:55005882-55005904 ATGATTATCACTTAGGCAGTAGG - Intergenic
1097745830 12:63302292-63302314 TTAATTATCAGTGAGGAGGAAGG + Intergenic
1098491325 12:71083359-71083381 ATGATTATTCATAAGGAGGTGGG + Intronic
1098510253 12:71304032-71304054 ATGTTTATCAATTTAGAGAATGG - Intronic
1103140654 12:118545248-118545270 GTGATTCTCAATTAGGGCGAGGG - Intergenic
1108421073 13:50250170-50250192 AGGATAATCAATAATGAGGAAGG - Intronic
1110663483 13:78086889-78086911 ATGATTATAATTTTGGGGGAGGG + Intergenic
1111251741 13:85609934-85609956 ATTATTATCAAATAGGAAAAGGG + Intergenic
1111732913 13:92099602-92099624 ATGATTATCTATTTGTAGGTTGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113130950 13:107036369-107036391 ATAATTATCAATTACGAAGGGGG - Intergenic
1114261551 14:21040399-21040421 ATGATTCTAAGTCAGGAGGATGG - Intronic
1117728810 14:58700617-58700639 ATGATTTTCAGTTACGTGGAGGG + Intergenic
1120261868 14:82195936-82195958 ATGCTTATCAAATAGGAGACTGG - Intergenic
1120735002 14:88042729-88042751 ATGCTTTTCATTTAGAAGGATGG - Intergenic
1124226575 15:27900344-27900366 ATGATTATTTATAAGGAGGTGGG - Intronic
1125381892 15:39094890-39094912 ATGATTATCAGTCAGGACTAAGG + Intergenic
1125978448 15:43977380-43977402 ATTATTATCATTTAGGAATAGGG + Intronic
1127341559 15:58050097-58050119 ATGATTTTGAATTAGAAGGTTGG + Intronic
1127553102 15:60060550-60060572 AGGATTAGCAGTGAGGAGGAAGG + Intronic
1129906265 15:79189751-79189773 ATGATCATCATTTGGGATGAGGG + Intergenic
1130542315 15:84829547-84829569 ATGATTATTCATGAGGAGGTAGG + Intronic
1130757842 15:86785008-86785030 ATCAGTATAAATTAAGAGGAAGG + Intronic
1130835723 15:87647774-87647796 ATGATTGTCATTTAGCTGGATGG - Intergenic
1133723143 16:8513644-8513666 AACATTATCAATTAACAGGACGG + Intergenic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140090932 16:71838283-71838305 ATCATCATCTATTAGTAGGAAGG - Intergenic
1141393290 16:83682288-83682310 ATGATTATTCATAAGGAGGTGGG + Intronic
1143924351 17:10356674-10356696 ATGGTTATCAATGAGGAAGTAGG - Intronic
1203164607 17_GL000205v2_random:82269-82291 ATTATTATTAATAAGGTGGAGGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1159552883 18:69914603-69914625 GTCATTCTCAATTAGAAGGAGGG - Intronic
1160162579 18:76485295-76485317 ATGATTATCAATGTGAATGATGG + Intronic
1161919385 19:7254837-7254859 GTGAGTATCAGGTAGGAGGAAGG + Intronic
1165985396 19:39764425-39764447 ATGATTATTCATAAGGAGGTGGG + Intergenic
1168537363 19:57182182-57182204 ATGATTATTCATGAGGAGGTGGG - Intergenic
925324161 2:3004261-3004283 ATGTTTATCCAATAGGAAGAAGG + Intergenic
926464682 2:13173145-13173167 ATGATTATAAATTTTGATGAAGG + Intergenic
928280331 2:29940629-29940651 ATGTTAATCATTTAGAAGGATGG - Intergenic
930004622 2:46886548-46886570 ATGATTAGCATTTAGCAGGAAGG - Intergenic
933414228 2:81965431-81965453 ATGATTAACATTCATGAGGAAGG + Intergenic
934993760 2:98938944-98938966 ATGATTAGCAATGATGATGATGG - Intergenic
935258199 2:101331199-101331221 ATGAGTAGCTATTAGGAGGCAGG - Intergenic
935829200 2:106982437-106982459 ATGATTATTAAGCAGTAGGAAGG - Intergenic
938872562 2:135495721-135495743 GTGATTTTAATTTAGGAGGATGG + Intronic
939701456 2:145397563-145397585 ATGATGAAATATTAGGAGGATGG + Intergenic
939727758 2:145744551-145744573 ATGATTCTCATTTTGGAAGAAGG - Intergenic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
941229941 2:162899353-162899375 ATGATAATCAGTCAGGAAGATGG - Intergenic
941489120 2:166121630-166121652 ATTATTATCCAGTAGGAGGAGGG + Intronic
942906119 2:181182768-181182790 ATGATTATGTATTAGGTGGCTGG - Intergenic
945194582 2:207226412-207226434 AGCATTATCAACAAGGAGGAAGG + Intergenic
1171783177 20:29439678-29439700 ATTATTATTAATAAGGAGGGGGG + Intergenic
1176337009 21:5608535-5608557 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176390748 21:6212413-6212435 ATTATTATTAATAAGGAGGAGGG + Intergenic
1176470671 21:7103761-7103783 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176494232 21:7485539-7485561 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176506410 21:7652844-7652866 ATTATTATTAATAAGGAGGAGGG + Intergenic
1178123350 21:29491939-29491961 ATGATTGACAAGTGGGAGGATGG - Intronic
1178123458 21:29493072-29493094 ATGATTGACAAGTGGGAGGATGG - Intronic
1182160854 22:28120040-28120062 ATGATTATTAATAAGGGAGAGGG + Intronic
1182794995 22:32985481-32985503 ATGAGGGTCAAATAGGAGGAAGG - Intronic
1184601312 22:45545121-45545143 ATGATTCTCAAATCGGAGGACGG + Intronic
949399394 3:3649844-3649866 ATGACAATTAATTAGCAGGATGG - Intergenic
952212288 3:31240308-31240330 ATGAATATCAAATATGCGGAGGG - Intergenic
952347970 3:32506259-32506281 ATGATTATTCATAAGGAGGTGGG + Intergenic
954578938 3:51692617-51692639 ATGATTATCCAGCAGCAGGAAGG - Intronic
956160204 3:66343739-66343761 ATGATTATGGATTAGTAAGAAGG - Intronic
956672394 3:71703612-71703634 ATGATTATCTATTTGGCAGAAGG - Intronic
962085229 3:132184253-132184275 ATAATTATCCATTTGAAGGACGG - Intronic
964551411 3:157888963-157888985 AAGATTATTAAAAAGGAGGAAGG - Intergenic
965524616 3:169702594-169702616 ATGAGGAGAAATTAGGAGGAAGG - Intergenic
965537688 3:169841062-169841084 CTGATTATTGATTAGGAGGTTGG - Intronic
970271121 4:14348727-14348749 ATGAGTAACAATTTGGAGGTAGG + Intergenic
974919036 4:68214229-68214251 ATGGTTATCAACTAGGAGTGAGG - Intergenic
975260336 4:72290386-72290408 GAGATTATCAGGTAGGAGGAGGG + Intronic
976683494 4:87784847-87784869 ATAATTCTCTATTAGGAGGGAGG + Intergenic
976759606 4:88534005-88534027 ATATTTATCCATTAGCAGGAGGG - Intronic
978027276 4:103892641-103892663 ATTATTACCAATTAAGAGCATGG + Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
979328165 4:119403115-119403137 ATGGTCATCCATGAGGAGGAGGG + Intergenic
979970781 4:127132267-127132289 ATGATTATAAATAAGGCTGATGG + Intergenic
980012183 4:127608989-127609011 TTGATTATAAATTTGGAGCAAGG + Intergenic
982502838 4:156179395-156179417 ATGATTAGATATTATGAGGAGGG + Intergenic
982503695 4:156192391-156192413 ATTATTTTCAAATAGCAGGATGG + Intergenic
983075708 4:163323619-163323641 AAGATTATCAACGAGAAGGAAGG + Intergenic
983535393 4:168851762-168851784 ATGCTTATCAAATAGGGGTAAGG - Intronic
985049749 4:185977400-185977422 ATAAATATCAATTAGGTCGAGGG - Intergenic
987656391 5:20813584-20813606 ATAATTATAAATTGGTAGGAAGG + Intergenic
989184638 5:38611539-38611561 ATGTTTAGGAATTAGTAGGAAGG + Intergenic
989458498 5:41669247-41669269 ATAATTACCAATTTGGAAGAGGG - Intergenic
990206175 5:53431911-53431933 ATGCTTATGAATCAGGAGGCAGG + Intergenic
991221319 5:64222719-64222741 ACTATTATCAATTAGGATGATGG + Intronic
991251446 5:64566472-64566494 ATGATTATTCATTAGGAGGTGGG + Intronic
993162289 5:84307840-84307862 AAGAATATGAATTAGAAGGAGGG + Intronic
993827749 5:92713293-92713315 TTGCTAATAAATTAGGAGGAGGG + Intergenic
994009152 5:94879463-94879485 ATGATTATCAATTAGGAGGAGGG - Intronic
996598138 5:125228536-125228558 ATGATTATGAATTATGCAGAGGG - Intergenic
997276802 5:132599970-132599992 ATGATAGTCACTTAGGTGGAAGG + Intronic
999491582 5:152056537-152056559 ATGATAATCAATGAAGAGGTTGG + Intergenic
1001730266 5:173948764-173948786 ATTATTATCTATTAGGAAGCAGG - Intronic
1002976546 6:2084176-2084198 AAGAGTATCTATGAGGAGGAAGG - Intronic
1003508554 6:6760092-6760114 ATGATGAGCAGTGAGGAGGAGGG - Intergenic
1004189069 6:13448382-13448404 AGGATAAACAATTGGGAGGAGGG - Intronic
1006035856 6:31211515-31211537 ATGATTATTCATAAGGAGGTGGG - Intergenic
1009606594 6:65877678-65877700 ATGATTACCAATTAGGATTTAGG + Intergenic
1009659081 6:66586739-66586761 ATAAATATCAATGAGGAAGATGG + Intergenic
1010623387 6:78104946-78104968 ATGCTTAGCAGTTAGGAGCATGG - Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1013316405 6:108947270-108947292 ATGATTAGCAATGAGGAGTTGGG + Intronic
1014760369 6:125349862-125349884 ATAATTATAAAGTAGTAGGATGG - Intergenic
1015375429 6:132504682-132504704 AAGTTTGTCATTTAGGAGGAAGG + Intronic
1015397794 6:132754481-132754503 ATAAATATTAATTAAGAGGAGGG - Intronic
1017948733 6:159117862-159117884 ATGATTAGCAATAACGAGGAGGG + Intergenic
1020723718 7:11782003-11782025 ATTATTATGACTTAGGGGGAGGG - Intronic
1021378593 7:19938906-19938928 ATCATTATCACTTCAGAGGAAGG - Intergenic
1023401930 7:39797114-39797136 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1024075907 7:45817744-45817766 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1024341402 7:48266552-48266574 ATGAATATCAACTATGAGAAAGG - Intronic
1024647691 7:51383548-51383570 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025051527 7:55738040-55738062 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025128490 7:56363707-56363729 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025176872 7:56806585-56806607 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025694921 7:63769801-63769823 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1027859689 7:83561468-83561490 ATGATTAGGGATTAGGAGGCAGG - Intronic
1030244019 7:107360993-107361015 TTGATGATTTATTAGGAGGATGG - Intronic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1031634051 7:124080638-124080660 CAGTTTGTCAATTAGGAGGACGG + Intergenic
1033995174 7:147337024-147337046 AAGATTATCAATTAGGGAAATGG + Intronic
1037624010 8:20592232-20592254 ATCATGATCAACTGGGAGGATGG + Intergenic
1041197525 8:55415910-55415932 ATGATTATCAATAATAATGAGGG - Intronic
1042219482 8:66459556-66459578 ATGATTAGTAATTAAGAGGCCGG - Intronic
1042995157 8:74690106-74690128 ATGATTAGAAAATAGGATGATGG - Intronic
1043462815 8:80477978-80478000 ATGTGTGTCAATTAGGAGAAGGG + Intergenic
1044903981 8:96979854-96979876 ATGATTATCTAATATGAGGAGGG - Intronic
1051836877 9:21348824-21348846 ATGATTATCCATAAGGAGGTGGG - Intergenic
1055218875 9:73903554-73903576 ATGAATATAAAATAGGAGCATGG - Intergenic
1056569744 9:87804873-87804895 ATGATTATTAATAGGGAGGTGGG + Intergenic
1203424644 Un_GL000195v1:26371-26393 ATTATTATTAATAAGGAGGAGGG + Intergenic
1185942630 X:4338641-4338663 TTGATTATCAATTACCAGAAAGG - Intergenic
1187592944 X:20739042-20739064 ATGATTTTAAACGAGGAGGAAGG - Intergenic
1188087296 X:25915339-25915361 ATGGTTTCTAATTAGGAGGAGGG - Intergenic
1192833414 X:74774204-74774226 ATGATTTTCAAGTGGTAGGATGG - Intronic
1196551544 X:117032616-117032638 ATGATTAACAATTAGCTGGAGGG - Intergenic
1197484074 X:127025275-127025297 ATGATTATTCATAAGGAGGTGGG - Intergenic
1198313516 X:135444007-135444029 ATGATTCCCAATTTGGAGGTGGG - Intergenic
1198363718 X:135920715-135920737 ATGATTATTCATAAGGAGGTGGG + Intergenic
1201789321 Y:17821203-17821225 TTGATGATAAATTATGAGGAAGG - Intergenic
1201812232 Y:18084784-18084806 TTGATGATAAATTATGAGGAAGG + Intergenic
1201905356 Y:19081166-19081188 ACCATTATTAATTAGGAGGCAGG - Intergenic